ID: 950093651

View in Genome Browser
Species Human (GRCh38)
Location 3:10315374-10315396
Sequence GACGGACCTGTCTGATGAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 68}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950093645_950093651 29 Left 950093645 3:10315322-10315344 CCCTGAGGTCGGCGATAAGGATC 0: 1
1: 0
2: 0
3: 3
4: 22
Right 950093651 3:10315374-10315396 GACGGACCTGTCTGATGAGCAGG 0: 1
1: 0
2: 2
3: 7
4: 68
950093646_950093651 28 Left 950093646 3:10315323-10315345 CCTGAGGTCGGCGATAAGGATCT 0: 1
1: 0
2: 0
3: 1
4: 33
Right 950093651 3:10315374-10315396 GACGGACCTGTCTGATGAGCAGG 0: 1
1: 0
2: 2
3: 7
4: 68
950093644_950093651 30 Left 950093644 3:10315321-10315343 CCCCTGAGGTCGGCGATAAGGAT 0: 1
1: 0
2: 0
3: 1
4: 35
Right 950093651 3:10315374-10315396 GACGGACCTGTCTGATGAGCAGG 0: 1
1: 0
2: 2
3: 7
4: 68
950093649_950093651 0 Left 950093649 3:10315351-10315373 CCATTGCGCACATCAAAGATTTT 0: 1
1: 0
2: 1
3: 6
4: 146
Right 950093651 3:10315374-10315396 GACGGACCTGTCTGATGAGCAGG 0: 1
1: 0
2: 2
3: 7
4: 68
950093647_950093651 4 Left 950093647 3:10315347-10315369 CCCTCCATTGCGCACATCAAAGA 0: 1
1: 0
2: 1
3: 5
4: 93
Right 950093651 3:10315374-10315396 GACGGACCTGTCTGATGAGCAGG 0: 1
1: 0
2: 2
3: 7
4: 68
950093648_950093651 3 Left 950093648 3:10315348-10315370 CCTCCATTGCGCACATCAAAGAT 0: 1
1: 0
2: 1
3: 5
4: 53
Right 950093651 3:10315374-10315396 GACGGACCTGTCTGATGAGCAGG 0: 1
1: 0
2: 2
3: 7
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950093651 Original CRISPR GACGGACCTGTCTGATGAGC AGG Exonic
915080660 1:153349610-153349632 GCTGGAGCTGTGTGATGAGCAGG + Intergenic
915605292 1:156946655-156946677 GACGCACCTGCATGAAGAGCTGG + Exonic
922061895 1:222100879-222100901 GAGGGAGCTGTCCGATGAGCTGG + Intergenic
924945261 1:248842240-248842262 GTCGGACATGTCTAAGGAGCTGG + Intronic
1067509575 10:46883985-46884007 GACTGACCTCTCTGAGGAGGAGG - Intergenic
1067652679 10:48167874-48167896 GACTGACCTCTCTGAGGAGGAGG + Intronic
1075655297 10:124157062-124157084 AGAGGACCTGTCTCATGAGCCGG - Intergenic
1076827870 10:132978940-132978962 GATGGGCCTGGCTGAGGAGCTGG + Intergenic
1077556782 11:3229857-3229879 GAGGGAGCTGTCTGATGATGGGG + Intronic
1081701895 11:45157662-45157684 GTCGGTCCTGGCTGATGGGCAGG + Intronic
1082592518 11:55030460-55030482 GAAGAAGCTATCTGATGAGCCGG - Intergenic
1089832134 11:121338159-121338181 GACTGACCTTTCAGATCAGCTGG + Intergenic
1090830708 11:130419046-130419068 CACGGACCTGTCTGGTGAGCAGG + Exonic
1102962479 12:117101604-117101626 GATGGAACTGTCTGATGTGGGGG + Intergenic
1104267123 12:127244137-127244159 GGTGGACCTGCGTGATGAGCAGG + Intergenic
1110151468 13:72260006-72260028 GAAGCACCTGTTTGATGAGAGGG + Intergenic
1113787409 13:113009863-113009885 GACTGTCCTGTCTGATGGACAGG + Intronic
1116737304 14:48708399-48708421 GAAGGACCTGTCTTATGGGATGG - Intergenic
1120670220 14:87354453-87354475 GCCGGACCTGTCTGATAAGTAGG + Intergenic
1121557469 14:94849236-94849258 AAAGGACCTATCAGATGAGCTGG - Intergenic
1122032375 14:98921790-98921812 GGCAGAGCTGGCTGATGAGCAGG - Intergenic
1122530263 14:102420454-102420476 AACGGAAATGTCTGATGAGTGGG - Intronic
1129598991 15:76987008-76987030 GACAGCCCTGTCTGCTCAGCTGG - Intergenic
1130609128 15:85344658-85344680 GAGGGACCTGCCTGGGGAGCAGG + Intergenic
1132633227 16:929824-929846 GACGGACGTGACTGCTGAGCAGG - Intronic
1143013271 17:3878084-3878106 CACAGACCTTGCTGATGAGCAGG - Intronic
1145773977 17:27513834-27513856 GGAGGACCTGTGTGATGAGCAGG - Intronic
1148085942 17:44993883-44993905 GAAGGGCCTGGCGGATGAGCAGG + Intergenic
1151548495 17:74807771-74807793 AACAGACCTGTCTGTGGAGCTGG - Intronic
1151815098 17:76467914-76467936 GAGGGGAATGTCTGATGAGCTGG + Intronic
1153992853 18:10415320-10415342 GAAGGGGCTGTCTGATGGGCTGG - Intergenic
1155384376 18:25261244-25261266 ACCTGACCTGTCTGATTAGCAGG + Intronic
1156011664 18:32503688-32503710 GATGGATCTGTCTGGTGTGCTGG + Intergenic
1157823848 18:50794482-50794504 AATGGACCTGTCTGAAGACCTGG + Intergenic
1158039255 18:53072499-53072521 GAAGTACCTGACTGCTGAGCAGG + Intronic
1162561738 19:11421380-11421402 GGCGGACCTGAGTGATGAGGGGG - Intronic
1162823175 19:13235664-13235686 GACGGAGAAGTTTGATGAGCCGG + Exonic
1163536195 19:17877967-17877989 GGCCGACCTGGTTGATGAGCAGG - Exonic
1163833868 19:19561879-19561901 CACGGGCCTGGCTGAGGAGCAGG + Exonic
1165758676 19:38308440-38308462 GATGGTCCTGTCTGAGGTGCGGG - Intronic
1166310751 19:41961100-41961122 GATGGCCCTGTCTGAGGGGCTGG + Intergenic
1166364630 19:42272299-42272321 GGCGGACCTGGAGGATGAGCCGG + Intronic
1168415432 19:56164736-56164758 GAAGGAACTGGGTGATGAGCTGG - Intergenic
926243616 2:11105915-11105937 GGCAGACCAGTCAGATGAGCTGG - Intergenic
933634416 2:84691941-84691963 AGTGGACCTGTCTGAGGAGCAGG + Intronic
937685594 2:124692869-124692891 GAAGGTCCTGGCTGATGAGTTGG + Intronic
1170916265 20:20628958-20628980 CACGGAGCTCTCTGAGGAGCTGG - Intronic
1172578847 20:36030905-36030927 GAGGGTCTTGTCTGATAAGCTGG + Intergenic
1179948876 21:44698483-44698505 GACGGACTTGCCTGCTGGGCTGG - Intronic
950093651 3:10315374-10315396 GACGGACCTGTCTGATGAGCAGG + Exonic
950988356 3:17401704-17401726 GATTGATCTGTCTAATGAGCAGG - Intronic
952409415 3:33033951-33033973 GACGGATTTTTCTGATGAGCAGG - Intronic
957938421 3:86973701-86973723 GGAGGGCCTGTCTGATGAGCTGG - Intronic
958064744 3:88528877-88528899 GCTGGACCTCTCTGATAAGCAGG + Intergenic
962646235 3:137443893-137443915 GATGGACCTGTAACATGAGCAGG - Intergenic
964397312 3:156258938-156258960 GACAATCCAGTCTGATGAGCAGG + Intronic
966736052 3:183188028-183188050 GAGGGACATGTCTGATGCTCAGG + Intronic
985395443 4:189538718-189538740 GACGGTCCTGTCTCATGGGCAGG - Intergenic
987804716 5:22749254-22749276 GAGAGACCTGTCTGAAGCGCAGG + Intronic
999241137 5:150128065-150128087 GACCGAGATGTGTGATGAGCGGG - Intronic
999756875 5:154671034-154671056 GACAGCCTTGGCTGATGAGCAGG + Intergenic
1000612305 5:163387772-163387794 GACTGACCTGGCTGGTGACCTGG - Intergenic
1004333387 6:14741740-14741762 GGCAAACCTGTCTGGTGAGCCGG + Intergenic
1005939269 6:30548559-30548581 AACGGGCCTGGCTGAGGAGCTGG - Intronic
1017037842 6:150282766-150282788 GACTGACCTGTGTGATGAATAGG + Intergenic
1018662847 6:166104571-166104593 GATAGACCTGGATGATGAGCTGG - Intergenic
1023792763 7:43766599-43766621 GAGGGAGCTGTGTGATGGGCAGG + Intronic
1024851320 7:53720526-53720548 GAAGGACATGTCTCAGGAGCTGG - Intergenic
1027636469 7:80681490-80681512 GACAGACATGTCTGTTCAGCAGG + Intergenic
1037945248 8:22985709-22985731 GCCAGACCTGCCTGATGAGAAGG + Intronic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1058652658 9:107191097-107191119 GTTGTAGCTGTCTGATGAGCTGG - Intergenic
1061847849 9:133397927-133397949 GAGGGACCTTTCTGAGGACCAGG - Intronic
1189942287 X:46137209-46137231 GTAGGACCTGTTTGATGAGGTGG + Intergenic
1195636242 X:107118742-107118764 TAAGGACTTGTCTGAAGAGCAGG - Intronic
1202380267 Y:24270815-24270837 GAGGGACCTGCCTGGGGAGCAGG + Intergenic
1202490516 Y:25399310-25399332 GAGGGACCTGCCTGGGGAGCAGG - Intergenic