ID: 950094905

View in Genome Browser
Species Human (GRCh38)
Location 3:10323387-10323409
Sequence AACTGCGTATGGAAGTCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950094900_950094905 21 Left 950094900 3:10323343-10323365 CCTCTGAAGGTTGATATTGGGAT 0: 1
1: 0
2: 0
3: 9
4: 110
Right 950094905 3:10323387-10323409 AACTGCGTATGGAAGTCAGATGG 0: 1
1: 0
2: 0
3: 6
4: 106
950094902_950094905 -10 Left 950094902 3:10323374-10323396 CCCTTGGATATGAAACTGCGTAT 0: 1
1: 0
2: 0
3: 3
4: 77
Right 950094905 3:10323387-10323409 AACTGCGTATGGAAGTCAGATGG 0: 1
1: 0
2: 0
3: 6
4: 106
950094897_950094905 24 Left 950094897 3:10323340-10323362 CCTCCTCTGAAGGTTGATATTGG 0: 1
1: 0
2: 2
3: 4
4: 130
Right 950094905 3:10323387-10323409 AACTGCGTATGGAAGTCAGATGG 0: 1
1: 0
2: 0
3: 6
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950094905 Original CRISPR AACTGCGTATGGAAGTCAGA TGG Intergenic
901081983 1:6588765-6588787 AACTGCGTGTGCACGTCAGACGG + Exonic
905345922 1:37311247-37311269 AGCTCCGTAAGGAAGACAGATGG - Intergenic
906326316 1:44848322-44848344 CACTGAGTATGGAAGTGGGATGG + Intergenic
908139226 1:61166403-61166425 AAATGAGTATGGAACACAGACGG - Intronic
911137030 1:94451904-94451926 AACTGCATATGGAAATGAGAGGG - Intronic
912799602 1:112712673-112712695 AACTCTGTGTGGAAGCCAGAGGG - Intronic
921191012 1:212708742-212708764 AACTGCCTGTGGAAGTTGGATGG - Intergenic
921362660 1:214344167-214344189 AACTGTGTATGCAAGTCATGTGG - Intergenic
923148283 1:231212984-231213006 AGCAGCGTATGGCAGGCAGAAGG - Intronic
1069061270 10:63897142-63897164 AACAGGGTATCGAAGACAGAAGG - Intergenic
1073671494 10:105595461-105595483 AACTGCTTAAGGAAGTGAGGAGG - Intergenic
1074500771 10:114022029-114022051 AACTGGGTCTGGAAGGCAGGGGG + Intergenic
1075957483 10:126536419-126536441 ATCTGCGTAAGGACCTCAGATGG + Intronic
1082694637 11:56346602-56346624 AACAGAGTATGGACATCAGAGGG - Exonic
1082985787 11:59170190-59170212 AAAGGCGAATGGAAGGCAGAAGG - Intergenic
1083448666 11:62727685-62727707 CACAGCAAATGGAAGTCAGACGG - Intergenic
1084692282 11:70734409-70734431 GACTGGGTATGGGAGTCAGGCGG - Intronic
1085377733 11:76082055-76082077 AACTACCTCTGGAAGTGAGAAGG + Intronic
1085791823 11:79503149-79503171 AATTGCCAATGGCAGTCAGAAGG + Intergenic
1091986508 12:4913910-4913932 AAGTGCATATGTTAGTCAGATGG + Exonic
1092756631 12:11769800-11769822 TACTTCGTTTGGAAGTAAGAAGG + Intronic
1093056608 12:14562050-14562072 TACTGCATATGCAAGGCAGATGG + Intronic
1095594338 12:43941495-43941517 AACTGCCTGAGGATGTCAGATGG - Intronic
1095945579 12:47751515-47751537 CACTGCCTATGGAAGGTAGAAGG + Exonic
1098863880 12:75740226-75740248 AAATGTATATGGAAATCAGATGG + Intergenic
1099414702 12:82371790-82371812 AGCTGCTCAGGGAAGTCAGAAGG + Intronic
1100173365 12:92002589-92002611 AACTGCCTGTGGAAGTGAGGGGG - Intronic
1102503805 12:113371463-113371485 AACTGCGACTGGGTGTCAGAAGG - Intronic
1104767149 12:131337525-131337547 AACTGCTCAAGGAAGGCAGAAGG - Intergenic
1108108067 13:47034929-47034951 AACTGCGTATGCCACCCAGAAGG - Intergenic
1108241893 13:48473892-48473914 AACTTCGTATTCAAGTCAGACGG - Intronic
1110906113 13:80891921-80891943 AACAGAGTAGGGAAGACAGAGGG - Intergenic
1121412322 14:93756659-93756681 AGCTGGATATGGAAGTCAGGGGG - Intronic
1123847740 15:24320503-24320525 AACTGCATACGGAAGGCACAGGG + Intergenic
1126751134 15:51877766-51877788 AATTGGGTAGGGAACTCAGAAGG - Intronic
1127234149 15:57029395-57029417 AAGTGCATATGGAAGTACGAAGG - Intronic
1129488601 15:75902364-75902386 AGCTGCTTAAGGAAGCCAGATGG - Intergenic
1130391345 15:83458399-83458421 CACTGGATTTGGAAGTCAGAAGG - Intronic
1131635171 15:94225330-94225352 AAGTGTGACTGGAAGTCAGAAGG - Intergenic
1132790306 16:1682717-1682739 AAATGGATATGGAAGTCAGATGG + Intronic
1134761133 16:16716251-16716273 AACTGCATGTGTCAGTCAGAAGG - Intergenic
1134984926 16:18642925-18642947 AACTGCATGTGTCAGTCAGAAGG + Intergenic
1136062735 16:27737781-27737803 TATTGCGTATGGCAGTCAGCTGG + Intronic
1137510667 16:49097140-49097162 AAGTGAGAATGGAAGACAGATGG - Intergenic
1139583013 16:67884300-67884322 TACAGCGTGTGGTAGTCAGAAGG + Exonic
1141324865 16:83046963-83046985 AGCTGTTTATGGAAATCAGATGG + Intronic
1141439754 16:84022348-84022370 AACTGTGTGTGGGAGGCAGAGGG - Intronic
1144337206 17:14282094-14282116 AACTGCTAATGGAAGTCAATGGG + Intergenic
1146698985 17:34937224-34937246 AAATTCATATGGAAGTCATATGG + Intronic
1153319680 18:3760266-3760288 AACTGCGGAAGGAAGACAGGAGG + Intronic
1159557022 18:69956152-69956174 AACTGTTTATGGAAATCAGTGGG - Intronic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
927429406 2:23014257-23014279 AACTGCCCATGGAGCTCAGAAGG - Intergenic
928177882 2:29047225-29047247 AACAGGGTATGTAAGTAAGATGG + Intronic
934647990 2:96070446-96070468 CACTGCATCTGGAACTCAGATGG - Intergenic
934841365 2:97626267-97626289 CACTGCATCTGGAACTCAGATGG - Intergenic
937646815 2:124274852-124274874 AGCTGCTTAAAGAAGTCAGATGG - Intronic
944069744 2:195655802-195655824 AACTACGTATGGCAATCAGTAGG + Intronic
944960251 2:204864219-204864241 ATTTGCATATGGAAGTCAAAGGG + Intronic
1170360768 20:15543756-15543778 AGCTGTGTCTGGAAGTCAGCTGG + Intronic
1171237516 20:23539492-23539514 AGCTGCCCATGGAGGTCAGAGGG + Intergenic
1173198614 20:40937520-40937542 AACTGGATATGGAGGTGAGAGGG + Intergenic
1173402981 20:42741091-42741113 AATTGAGGATGAAAGTCAGAAGG + Intronic
1177417314 21:20811418-20811440 ACCTGTCTATGGAAGTCACATGG - Intergenic
1181328111 22:22066950-22066972 AGATGCGTAGAGAAGTCAGAAGG + Intergenic
1181767268 22:25100825-25100847 AAGTGCCTGTTGAAGTCAGAAGG + Intronic
949372331 3:3348976-3348998 AAATGCCTATGGAGGCCAGATGG + Intergenic
950094905 3:10323387-10323409 AACTGCGTATGGAAGTCAGATGG + Intergenic
951164779 3:19471743-19471765 AACTGGGTTTTGAAGTCAGGTGG - Intronic
952918507 3:38267640-38267662 AACTGTGCGGGGAAGTCAGAGGG + Intronic
961925343 3:130473649-130473671 AACTGCGTATGCCACCCAGAAGG + Intronic
962331283 3:134480972-134480994 AACTTCGCCTGGAAGTCAGCAGG + Intronic
962696541 3:137953390-137953412 CACTGCGCAAGGAAATCAGATGG - Intergenic
963315662 3:143755711-143755733 AAATCCTTTTGGAAGTCAGAGGG - Intronic
974267287 4:59602086-59602108 AACTGGGTATAGAAGTTATATGG + Intergenic
977276012 4:94978098-94978120 GACAGCATATGGAAGACAGAAGG - Intronic
978635435 4:110799213-110799235 AACTGCCTATGTAAATGAGAGGG + Intergenic
981776340 4:148372346-148372368 AACTGGGTATAGAAATGAGAGGG - Intronic
983146513 4:164222541-164222563 AACTGCCTATGGAAAACATAGGG - Intronic
986080555 5:4387715-4387737 AATTGAGTATGGAGGTCAAAAGG - Intergenic
986565673 5:9111299-9111321 AAATGGGTATGGAAGGCAGAGGG + Intronic
987116093 5:14728120-14728142 AAGTGCGGAGGGAAGGCAGAGGG + Intronic
987952331 5:24691125-24691147 AACTCCTTATGGAGGGCAGATGG + Intergenic
990029326 5:51237440-51237462 AACAGGGTAAGGAAGACAGAGGG - Intergenic
990942055 5:61212790-61212812 AACTCTGTGTGGAAGTCAGGAGG + Intergenic
996119084 5:119650971-119650993 CAGTGTGAATGGAAGTCAGATGG + Intergenic
998687379 5:144543905-144543927 AACTCCTTGTGGAAATCAGAAGG + Intergenic
1002557484 5:180054711-180054733 AACTTCATATGGAAGTAAAAGGG - Intronic
1002879084 6:1235662-1235684 AACTGTCTCAGGAAGTCAGAAGG - Intergenic
1003121802 6:3324181-3324203 AACTGGGAAGGGAAGTGAGACGG + Intronic
1012758349 6:103263126-103263148 CACTGGGTTAGGAAGTCAGAAGG + Intergenic
1014881121 6:126725807-126725829 AACTGTCTATGGAAGCCACATGG - Intergenic
1015908759 6:138145668-138145690 GCCTGGGTATAGAAGTCAGAGGG - Intergenic
1018054878 6:160043167-160043189 AGCTGTGGATGGCAGTCAGACGG + Exonic
1025795276 7:64733830-64733852 AACTGCTTATGGAGGCCACATGG + Intergenic
1027185593 7:75968858-75968880 AACTGCGTCAGGAGGTCACATGG + Intronic
1027764301 7:82320703-82320725 AACAGCATATGGGAGTCAGGTGG - Intronic
1035047706 7:155980171-155980193 CACTGGGTTAGGAAGTCAGAAGG + Intergenic
1036111521 8:5908194-5908216 ATCTGGCTATGGAAGTCGGATGG - Intergenic
1036127098 8:6072889-6072911 TACTCCGAGTGGAAGTCAGAGGG - Intergenic
1036757329 8:11479911-11479933 AACTGCGTCTGCAGCTCAGAAGG + Intergenic
1041453313 8:58031116-58031138 AACTGCATTTGGAGGACAGAAGG + Intronic
1043990663 8:86750049-86750071 AAATGCATATGGAATCCAGATGG + Intergenic
1044108757 8:88245364-88245386 TTCTGAGTATGGAAGTCATATGG + Intronic
1051779047 9:20669000-20669022 GACTTCCTATGGAAGTCACAGGG - Intronic
1051860015 9:21613904-21613926 AACTCCGTATGAAATTTAGAAGG + Intergenic
1052104855 9:24500679-24500701 AACTGCTTATTGAAATCAGAGGG + Intergenic
1055533165 9:77208058-77208080 AGCTGCATAAGGAAGTCAGGAGG + Intronic
1057829673 9:98396813-98396835 AGCAGCGTATGTGAGTCAGAGGG - Intronic
1195388323 X:104334643-104334665 AAGTGGATATGGAAGTCACACGG + Intergenic
1196402863 X:115334164-115334186 AACTGCATATGTAAGTTACATGG - Intergenic
1198923989 X:141766379-141766401 AGCTGAGTATGGGTGTCAGAGGG + Intergenic
1199226972 X:145387977-145387999 AAATGTGTATGGAAATCAAAAGG - Intergenic