ID: 950095379

View in Genome Browser
Species Human (GRCh38)
Location 3:10326409-10326431
Sequence CTCCATGTTCATTCGGAGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950095379_950095383 19 Left 950095379 3:10326409-10326431 CCTGGCTCCGAATGAACATGGAG 0: 1
1: 0
2: 0
3: 7
4: 95
Right 950095383 3:10326451-10326473 TATCCTGATGTCATGGAACGAGG 0: 1
1: 0
2: 0
3: 3
4: 86
950095379_950095382 12 Left 950095379 3:10326409-10326431 CCTGGCTCCGAATGAACATGGAG 0: 1
1: 0
2: 0
3: 7
4: 95
Right 950095382 3:10326444-10326466 ACACAGCTATCCTGATGTCATGG 0: 1
1: 0
2: 1
3: 13
4: 163
950095379_950095385 25 Left 950095379 3:10326409-10326431 CCTGGCTCCGAATGAACATGGAG 0: 1
1: 0
2: 0
3: 7
4: 95
Right 950095385 3:10326457-10326479 GATGTCATGGAACGAGGTCACGG 0: 1
1: 0
2: 0
3: 4
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950095379 Original CRISPR CTCCATGTTCATTCGGAGCC AGG (reversed) Exonic
914885735 1:151582890-151582912 CTGCAGGGTCATTCAGAGCCAGG - Exonic
916548632 1:165828884-165828906 CTCCAACTTCATTTGGAGCACGG + Intronic
922172448 1:223167133-223167155 CTCCATCTTCAATGGGAGCTGGG + Intergenic
922452880 1:225750913-225750935 CTCCATGGGCATGTGGAGCCTGG - Intergenic
923102278 1:230826192-230826214 CTCCAGGTGCATTCTGTGCCTGG - Intergenic
1064735483 10:18377999-18378021 CTTCATGTTAATTAGGAGCCAGG + Intronic
1064994272 10:21282690-21282712 CTCCATGTTGAATAGGAGCTGGG + Intergenic
1066447371 10:35495845-35495867 CTCCATGTGCATTCTGAACAGGG + Intronic
1071246588 10:83771941-83771963 CTCATTGTTTATTCAGAGCCAGG + Intergenic
1075598069 10:123746842-123746864 CTCCATGATCTCTCGGATCCTGG + Exonic
1077005328 11:352544-352566 CTCCATCTTGATTAGGAGCTGGG - Intergenic
1081806198 11:45892157-45892179 CCCCATGTTCACCCAGAGCCAGG + Intronic
1082726641 11:56744661-56744683 CTCCATGTGGATTCAAAGCCTGG + Intergenic
1083006290 11:59349946-59349968 CTCCATGGACCTTCCGAGCCAGG + Intergenic
1083968004 11:66054701-66054723 TTCCATGTTCCTTCTGATCCAGG + Intronic
1090339976 11:126009228-126009250 CTCCAGCTTCATTCAGAGCAAGG + Intronic
1091093078 11:132791626-132791648 CTCCATGTTCACTTTGAGGCAGG - Intronic
1092080198 12:5709663-5709685 CTCTGTGTTCATTCGCAGTCTGG + Intronic
1092354921 12:7786842-7786864 CTCCATCTTCAATAGGAGCTGGG - Intergenic
1092367629 12:7890170-7890192 CTCCATCTTCAATAGGAGCTGGG - Intronic
1092881895 12:12893133-12893155 TTCCATGTTCCTGCGGAGCTGGG - Intronic
1098861256 12:75712954-75712976 ATCCATGTTTATTATGAGCCAGG - Intergenic
1102161643 12:110774072-110774094 CTCCATATTAATTCAGAGCAGGG + Intergenic
1102462608 12:113109454-113109476 CTCCATGTGAATCCGGGGCCTGG + Intronic
1106331825 13:28746413-28746435 CTCCATCTTGAATAGGAGCCGGG - Intergenic
1107346371 13:39465778-39465800 CTTCATGTTCATTCAAAGCCAGG - Intronic
1107376051 13:39805799-39805821 CTCCATGTTGAATAGGAGCTGGG - Intergenic
1112709207 13:102107459-102107481 CTCAATGTACATTAGGAGCATGG + Intronic
1113089783 13:106605141-106605163 CTCCATGTTGAATAGGAGCTAGG + Intergenic
1114584266 14:23795449-23795471 CTCCATCTTGAATAGGAGCCGGG - Intergenic
1119865666 14:77971422-77971444 CTACATTTTCATTTGGAGCTCGG - Intergenic
1125087649 15:35748949-35748971 CTCAATGGTCACTCTGAGCCAGG - Intergenic
1125583946 15:40807261-40807283 CTCCAGGTTCATTCGGGTCCTGG - Exonic
1126899011 15:53292203-53292225 CTCCATGTTGCTTCGGAACCGGG - Intergenic
1127324276 15:57880159-57880181 CTGCATGTTCATTCACAGCTTGG - Intergenic
1127650171 15:60999294-60999316 CCCCATGTTCAAATGGAGCCTGG - Intronic
1128704162 15:69826387-69826409 CTCCATTTTCAGACGCAGCCAGG - Intergenic
1132990691 16:2791325-2791347 CTCCCTGTTCAGTGGGAGCTGGG + Intergenic
1135314670 16:21434422-21434444 CTCCATCTTAAATAGGAGCCGGG + Intronic
1135367593 16:21866702-21866724 CTCCATCTTAAATAGGAGCCGGG + Intronic
1135444221 16:22504460-22504482 CTCCATCTTAAATAGGAGCCGGG - Intronic
1135864740 16:26090834-26090856 CTCCATGTGCTTTCAGGGCCTGG - Intronic
1136311334 16:29413104-29413126 CTCCATCTTAAATAGGAGCCGGG + Intergenic
1136324782 16:29514897-29514919 CTCCATCTTAAATAGGAGCCAGG + Intergenic
1136439467 16:30254882-30254904 CTCCATCTTAAATAGGAGCCAGG + Intergenic
1138476558 16:57273610-57273632 CTCCATGGTAATTGGGAACCTGG - Intronic
1140894018 16:79309219-79309241 TTCCCTGTTAATTCGGAGACTGG + Intergenic
1142337878 16:89502027-89502049 CTCCATGTCCACACTGAGCCTGG + Intronic
1144473061 17:15561754-15561776 CTCCATCTTCAATAGGAGCTGGG + Intronic
1144923421 17:18782966-18782988 CTCCATCTTCAATAGGAGCTGGG - Intronic
1157576946 18:48749949-48749971 CACCAGGTTCACGCGGAGCCTGG + Intronic
925297470 2:2787424-2787446 CTCCGTGTTCATGCTGAGCCGGG - Intergenic
928439728 2:31282245-31282267 CTCCATGTTAAATAGGAGCTGGG + Intergenic
932074809 2:68653089-68653111 CTCCATTTTCATTGTGAGTCAGG + Intronic
932143360 2:69298408-69298430 CTCCATGTGGCTTAGGAGCCTGG + Intergenic
939892502 2:147754200-147754222 ATGCATGTTCATTCTGAGACGGG + Intergenic
944682526 2:202090326-202090348 GTCCATGTTCATGGGGAGCCTGG - Intronic
947497354 2:230647608-230647630 CTCCGTCTTGATTAGGAGCCGGG + Intergenic
1174297395 20:49558639-49558661 CTCCATGTTGAATAGGAGCTGGG + Intronic
1175144714 20:56886761-56886783 CTCCATGTTGAATAGGAGCTGGG + Intergenic
1181732730 22:24859407-24859429 CCCCAGGTTCCTTCAGAGCCAGG - Intronic
1183966186 22:41444384-41444406 CTCCATGTTCCTCAGGAGCTAGG + Intronic
1185168751 22:49278639-49278661 CTCTATTTGCATTCGCAGCCCGG - Intergenic
949513830 3:4789381-4789403 TTCCATGTTCATGAGGATCCTGG - Intronic
950095379 3:10326409-10326431 CTCCATGTTCATTCGGAGCCAGG - Exonic
950528513 3:13539052-13539074 CTCCATGTTTATTCTGAGAGCGG - Intergenic
950762362 3:15243352-15243374 CTGCATCTTCATTTGGAGCCAGG - Intronic
951016876 3:17742007-17742029 TTCCATGTTCATTTGGGCCCCGG - Intronic
952507844 3:34023900-34023922 CTCCATGTTCATGCTGAGTGTGG + Intergenic
953202764 3:40792211-40792233 CTCCAGGTTCATGTGGAGGCAGG - Intergenic
954078966 3:48201550-48201572 CTCCATCTTGAATCGGAGCTGGG + Intergenic
954930984 3:54281098-54281120 CTCCAGGTTGTTTAGGAGCCAGG - Intronic
954938020 3:54344754-54344776 CTCCATCTTAATTAGGAGCTGGG + Intronic
958517732 3:95140889-95140911 CTCCATGTTCTTTCATAGCTTGG - Intergenic
962738053 3:138343462-138343484 CTCCAGCTTCATTAGGAGCTAGG - Intergenic
970247510 4:14078845-14078867 CTCCCTCTGCATTCTGAGCCAGG + Intergenic
977100989 4:92814821-92814843 CACCATGTTCTATAGGAGCCAGG + Intronic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
977648935 4:99446872-99446894 CTCCATGTAGATTCAGAGTCTGG + Intergenic
980988198 4:139715932-139715954 CTCCATGTTAAATAGGAGCTGGG - Intronic
992270080 5:75054394-75054416 CTCCACGTCCTTTCGGGGCCGGG + Intergenic
992865846 5:80956492-80956514 CTCCATCTTAAATAGGAGCCGGG - Intergenic
999234093 5:150080124-150080146 GGCCAAGTTCATTCAGAGCCAGG - Exonic
1001732970 5:173973720-173973742 CTCCATGTACATACCGAGCACGG + Intergenic
1007833965 6:44660065-44660087 AGCCAAGGTCATTCGGAGCCAGG - Intergenic
1015023341 6:128503550-128503572 ATGCATGTTCATTCTGTGCCAGG - Intronic
1015985061 6:138876207-138876229 CTCCCTCTTCCTTGGGAGCCAGG - Intronic
1019624480 7:2009040-2009062 CTCCCTGGTCACTCGGTGCCAGG - Intronic
1021888399 7:25163391-25163413 CTCCAGGGCCATTCGGAGGCTGG - Intronic
1030123121 7:106130048-106130070 CTCCATCTTCAATAGGAGCTGGG + Intergenic
1030306425 7:108023504-108023526 CTACATGGTCATTCTCAGCCAGG - Intergenic
1034450931 7:151136929-151136951 CTACATGTTTCTTCGGGGCCTGG + Intronic
1036101536 8:5792389-5792411 CTCCATCTTAATTAGGAGCAGGG + Intergenic
1036948286 8:13116208-13116230 CTCCATGTTCCTTGACAGCCTGG - Intronic
1038645668 8:29359817-29359839 CTCCATCTTAACTCGGAGCTGGG + Intergenic
1052024540 9:23559985-23560007 CCCCAAGTTCATTCCCAGCCAGG + Intergenic
1056054859 9:82811030-82811052 CTCCATCTTGATTAGGAGCTGGG + Intergenic
1058161016 9:101570920-101570942 GTCCATGTACATTAGGAGCATGG + Exonic
1062058791 9:134483428-134483450 GTCCATGTCCTTTCCGAGCCAGG + Intergenic
1186670809 X:11765452-11765474 CTCCATCTTCCCTAGGAGCCAGG + Exonic
1192695814 X:73414805-73414827 CTCCATGTATATTTGGAGGCTGG - Intergenic
1196515522 X:116606284-116606306 GTCTTTGTTCATTCCGAGCCTGG + Intergenic
1198071337 X:133151498-133151520 CTACATATTCACTTGGAGCCAGG - Intergenic