ID: 950095383

View in Genome Browser
Species Human (GRCh38)
Location 3:10326451-10326473
Sequence TATCCTGATGTCATGGAACG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 86}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950095376_950095383 23 Left 950095376 3:10326405-10326427 CCCTCCTGGCTCCGAATGAACAT 0: 1
1: 0
2: 0
3: 6
4: 75
Right 950095383 3:10326451-10326473 TATCCTGATGTCATGGAACGAGG 0: 1
1: 0
2: 0
3: 3
4: 86
950095375_950095383 24 Left 950095375 3:10326404-10326426 CCCCTCCTGGCTCCGAATGAACA 0: 1
1: 0
2: 0
3: 9
4: 112
Right 950095383 3:10326451-10326473 TATCCTGATGTCATGGAACGAGG 0: 1
1: 0
2: 0
3: 3
4: 86
950095377_950095383 22 Left 950095377 3:10326406-10326428 CCTCCTGGCTCCGAATGAACATG 0: 1
1: 0
2: 0
3: 5
4: 71
Right 950095383 3:10326451-10326473 TATCCTGATGTCATGGAACGAGG 0: 1
1: 0
2: 0
3: 3
4: 86
950095381_950095383 12 Left 950095381 3:10326416-10326438 CCGAATGAACATGGAGCATGGTG 0: 1
1: 0
2: 0
3: 10
4: 110
Right 950095383 3:10326451-10326473 TATCCTGATGTCATGGAACGAGG 0: 1
1: 0
2: 0
3: 3
4: 86
950095379_950095383 19 Left 950095379 3:10326409-10326431 CCTGGCTCCGAATGAACATGGAG 0: 1
1: 0
2: 0
3: 7
4: 95
Right 950095383 3:10326451-10326473 TATCCTGATGTCATGGAACGAGG 0: 1
1: 0
2: 0
3: 3
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950095383 Original CRISPR TATCCTGATGTCATGGAACG AGG Exonic
900327063 1:2113581-2113603 TATCCTGACATCCTGGAAGGGGG + Intronic
901946575 1:12708897-12708919 TTTTCTGATGTCTGGGAACGTGG + Intergenic
905511778 1:38527472-38527494 TAGGCTGATGTCATGGAAAGAGG + Intergenic
905763393 1:40580028-40580050 TAGCCCTATGTCATGGAAAGAGG + Intergenic
909662563 1:78100259-78100281 TAACCTGATGTCAATGAAGGAGG - Intronic
911297082 1:96131082-96131104 TATTCTGATATTATGGAACTGGG - Intergenic
920029906 1:203030541-203030563 TAAGCTGAAGTCATGGAACTGGG - Intronic
921514894 1:216078261-216078283 TATCCTATTGTAATGGAAAGTGG - Exonic
923518527 1:234718054-234718076 TATCCTGTTTTCATGGGACCTGG - Intergenic
1063264226 10:4429188-4429210 TATCCTAATATCAGGGAATGAGG + Intergenic
1063703730 10:8410633-8410655 TGACCTGATGTCATAGACCGAGG + Intergenic
1063919949 10:10922382-10922404 AATCCTGAAATAATGGAACGAGG + Intergenic
1064360089 10:14656459-14656481 CATTCTGATGACATGGAAGGTGG - Intronic
1066498601 10:35967767-35967789 AATCCTGATCTCATAGAAAGAGG - Intergenic
1066795157 10:39112106-39112128 TCTCTTGATGTAATGGAAAGTGG + Intergenic
1069382057 10:67851366-67851388 TCTCCTGATTTCTTGGAAGGTGG + Intergenic
1070219526 10:74425581-74425603 CAGCCTGAAGTCATTGAACGTGG + Intronic
1071098077 10:82002557-82002579 TGTTCTGCTGTCATGGAACATGG + Intronic
1072192058 10:93084032-93084054 TATCCTCATGGCATGGCACTTGG + Intergenic
1084947636 11:72647240-72647262 TATCCTGTTGCCATGGACCATGG + Intronic
1086154442 11:83650011-83650033 TATCCTGATGTTATAAAAGGAGG + Intronic
1087504542 11:99002755-99002777 ATTCCTGATGTCATGGAAGATGG - Intergenic
1088462627 11:110097848-110097870 TCTCCTGATGTCATAGCACAAGG + Intronic
1088542539 11:110928254-110928276 TCCTCTGATGTCATGGAACAAGG + Intergenic
1089568770 11:119388303-119388325 TGTGCTCATGTCATGGAACTGGG + Intergenic
1095142638 12:38685442-38685464 TATTCTGATGTACTGGAACATGG - Intronic
1099118918 12:78663624-78663646 TACCCTGATGTCATGCCAGGAGG - Intergenic
1101214246 12:102564665-102564687 TATGCTCATTCCATGGAACGAGG - Intergenic
1102608993 12:114094791-114094813 TATCCTGAGGGCATGGAAAAGGG + Intergenic
1117621202 14:57588702-57588724 TGGCCTGATTTCATGCAACGGGG - Intronic
1124037768 15:26071988-26072010 TATCCTGATTGCATGAAAAGAGG - Intergenic
1126241714 15:46452571-46452593 TTTCCTGGTGTCATGGAAGATGG + Intergenic
1128126755 15:65198576-65198598 CATCTTGATTTCATGGAACACGG + Exonic
1130277911 15:82492410-82492432 TTTTCTGATGTCCTGGAACATGG - Intergenic
1134784302 16:16927065-16927087 CATCCTCATGTCATGAAACTTGG + Intergenic
1139953069 16:70681251-70681273 TGTCCTGATGTCAGGGAGGGAGG - Intronic
1140849518 16:78922002-78922024 TGTCCTGATGTCATGGGTAGAGG - Intronic
1141111431 16:81273976-81273998 TGTGCTGATTTCATGGGACGTGG - Intronic
1147546377 17:41405178-41405200 TATCCTGATCTGATGGTATGAGG + Intergenic
1149331049 17:55582194-55582216 TTCCCTGATGTCAGGGAATGTGG - Intergenic
1150321068 17:64214913-64214935 TATCCTGATGCCTCAGAACGTGG - Intronic
1150990504 17:70252212-70252234 TACCCTGAAGTCATTGAAGGTGG + Intergenic
1157137887 18:45075166-45075188 TATCCTCATGTGGTGGAAGGGGG + Intergenic
1162185334 19:8900402-8900424 TATCCTGGTGCCATGGGACAGGG + Intronic
928547616 2:32343035-32343057 TATCCTGGTGTCCTGGAAAGAGG - Intergenic
928869540 2:35960566-35960588 TATGCTCATGTCATTGAACTTGG - Intergenic
933870139 2:86558069-86558091 AATTCTGATGCCATGGAAGGGGG + Intronic
937107679 2:119333514-119333536 TTTCCTGATGTGATGCAACAAGG + Intronic
938566367 2:132522549-132522571 TATCCTGATTTCATGGAGGAGGG + Intronic
939012394 2:136862026-136862048 TATCCTCATGACATGGAAGCTGG + Intronic
1169250318 20:4055753-4055775 TATCCTGATGTCAATAAACTTGG - Intergenic
1174696672 20:52566405-52566427 TAACATGATGTCACTGAACGTGG - Intergenic
1184810257 22:46826576-46826598 TGTCCTGGTGTCCTGGAAGGTGG + Intronic
1185223960 22:49642726-49642748 TCTCCTGATGTCCTGGTACCTGG - Intronic
950095383 3:10326451-10326473 TATCCTGATGTCATGGAACGAGG + Exonic
952288213 3:31988674-31988696 TATCCTTATGTCATGGCAGCTGG - Exonic
954468038 3:50668616-50668638 TTCCCTAATGTCATGGGACGTGG + Intergenic
960698978 3:120422605-120422627 TATCTGGATGTCATGGAGCCTGG - Intronic
964289673 3:155163507-155163529 TTTCCTAATGTCATGGCACAGGG - Intronic
966699230 3:182826957-182826979 TATCCTGATCTCAGGCAATGAGG - Intronic
969211844 4:5693774-5693796 TATTCTGATTTTATGTAACGTGG - Intronic
972041935 4:34613205-34613227 TATTCTTATTTCATAGAACGAGG + Intergenic
972411594 4:38800888-38800910 TATCCTGATTTCTTCTAACGAGG + Exonic
973057432 4:45678711-45678733 TATCCTGGGGTTATGGAACTTGG + Intergenic
974224372 4:59019360-59019382 TAACATCATGTCAAGGAACGAGG - Intergenic
979296483 4:119038251-119038273 TTTCCTAATGTCATTGAATGTGG - Intronic
986862606 5:11945087-11945109 TATCCTGATGGGATGGGACTGGG - Intergenic
994041911 5:95268399-95268421 TTTCCAGATGTCTTGGAATGGGG - Intronic
996178266 5:120387098-120387120 TATGCTCATGTGATGGAAGGAGG + Intergenic
997394589 5:133548037-133548059 TAGCCTGATTTCATGGGAAGTGG + Intronic
1007795031 6:44340185-44340207 GATCTTGATGTCTTGGAACCTGG + Intronic
1015049413 6:128821095-128821117 TTTCCTGATGACATGTAATGTGG - Intergenic
1017855070 6:158343554-158343576 TATCCTCATGTGAGGGAAAGAGG - Intronic
1019312386 7:369164-369186 TAACCTGTTGTCACGGAAGGGGG + Intergenic
1022978587 7:35580892-35580914 TATCCTCATGTCATGGCAGCTGG + Intergenic
1029197472 7:98815893-98815915 TATCCTGATCTCATAAAACAAGG + Intergenic
1032986300 7:137341429-137341451 TCTCATGATCTCATGGAAAGGGG + Intronic
1041461652 8:58118372-58118394 AATCCTAATGTCCTGGAATGCGG - Intronic
1046175174 8:110566336-110566358 TATCCTGAATTCATGCAAAGTGG - Intergenic
1046907291 8:119587328-119587350 TATCCTGGTGCTATGGAAGGAGG - Intronic
1054848919 9:69826253-69826275 TATCCTAGTGTCTTGGAACTGGG - Intronic
1055864962 9:80801911-80801933 TATCCTGATATCAGTGAAAGAGG + Intergenic
1057858906 9:98624395-98624417 TATCCACCTCTCATGGAACGGGG - Intronic
1062232823 9:135491629-135491651 CAGCCTGATGTCGGGGAACGGGG + Intergenic
1186062920 X:5730224-5730246 TATCCTGATGCCTGGGAACCAGG + Intergenic
1192209398 X:69118101-69118123 TATCCTGCTGTCAGGGAAAGGGG - Intergenic
1197062989 X:122203814-122203836 CAACCTAATGTCATGGAACAAGG - Intergenic
1197088411 X:122507742-122507764 GTTCCTGATGTCATGCAAGGAGG + Intergenic
1199031985 X:143011826-143011848 TTTCCTGAAGTCATTGAAAGGGG + Intergenic
1201533850 Y:15023527-15023549 TATCTTGATGCCTTGGAACCAGG - Intergenic