ID: 950097368

View in Genome Browser
Species Human (GRCh38)
Location 3:10337932-10337954
Sequence GGCAGCACGGGGAAGTGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 211}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950097368_950097380 7 Left 950097368 3:10337932-10337954 CCCTACCACTTCCCCGTGCTGCC 0: 1
1: 0
2: 0
3: 15
4: 211
Right 950097380 3:10337962-10337984 GGCACAATGGGACCTCTCTGAGG 0: 1
1: 0
2: 0
3: 35
4: 3052
950097368_950097377 -5 Left 950097368 3:10337932-10337954 CCCTACCACTTCCCCGTGCTGCC 0: 1
1: 0
2: 0
3: 15
4: 211
Right 950097377 3:10337950-10337972 CTGCCCTGAGAGGGCACAATGGG 0: 1
1: 0
2: 0
3: 9
4: 176
950097368_950097376 -6 Left 950097368 3:10337932-10337954 CCCTACCACTTCCCCGTGCTGCC 0: 1
1: 0
2: 0
3: 15
4: 211
Right 950097376 3:10337949-10337971 GCTGCCCTGAGAGGGCACAATGG 0: 1
1: 0
2: 2
3: 36
4: 293
950097368_950097381 10 Left 950097368 3:10337932-10337954 CCCTACCACTTCCCCGTGCTGCC 0: 1
1: 0
2: 0
3: 15
4: 211
Right 950097381 3:10337965-10337987 ACAATGGGACCTCTCTGAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950097368 Original CRISPR GGCAGCACGGGGAAGTGGTA GGG (reversed) Intronic
902554741 1:17240277-17240299 GGCACTACCGGGAAGGGGTAAGG - Intronic
903328769 1:22586338-22586360 GGCAGCACTGGGCAGTGTGAAGG + Intronic
903640517 1:24856780-24856802 GGCAGCATGGGGAGGTGGAGAGG + Intergenic
904044887 1:27603179-27603201 GGCAGCGCCGGGAAGGGGGAGGG - Intronic
904483009 1:30805772-30805794 GGCAAGAGGGGGAAGTGGTTAGG + Intergenic
905347087 1:37318609-37318631 GGCAGCGCGGGGACGCGGGATGG + Intergenic
907806123 1:57822050-57822072 GGCTGAACTGGGAAGTGGAATGG + Intronic
910241815 1:85094928-85094950 GAGAGCACTGGGGAGTGGTAGGG + Intronic
913613290 1:120529892-120529914 GGCTGCTCGGGGAGGTGGCAGGG - Intergenic
914371642 1:147030649-147030671 GGCTGCTCGGGGAGGTGGCAGGG - Intergenic
914577896 1:148992355-148992377 GGCTGCTCGGGGAGGTGGCAGGG + Intronic
915316984 1:155034268-155034290 GGGAGCCTGAGGAAGTGGTATGG - Intronic
917087083 1:171314576-171314598 GGAAGCAAAGGGAAGTTGTAAGG + Intronic
919844045 1:201629705-201629727 GGCAGCATAGGGAAGTGGCCAGG + Intronic
919861603 1:201742296-201742318 GGCAGCACTGGGAAGATGTGAGG + Intronic
921427743 1:215023885-215023907 GGCAGCAAGGTGAAGTGGAGGGG - Intronic
922885831 1:229019828-229019850 GGCAGGACGGGGAAGGGGTCAGG - Intergenic
924036748 1:239945605-239945627 GGGAGCCAGGGGAAGTGGCAGGG - Intergenic
924041998 1:239992834-239992856 GGGAGCCAGGGGAAGTGGCAGGG + Intergenic
1062838678 10:652691-652713 GTCAGCACCGGGAAGTGGGATGG - Intronic
1063292145 10:4760715-4760737 GGCAGCACTTGGAAATGGGAAGG + Intergenic
1063511941 10:6654289-6654311 GTGAGCACGGAGAATTGGTAAGG + Intergenic
1063765669 10:9137555-9137577 AGCAGCATGGGCAACTGGTATGG + Intergenic
1065493652 10:26307662-26307684 GGCAGGATGGGGAAGGGATATGG - Intergenic
1067216153 10:44305605-44305627 GGCAGGAAGGGGAAGAGGGAAGG + Intergenic
1067788538 10:49270782-49270804 AGCAGCACAGGGAAGGGGCATGG + Intergenic
1069694861 10:70379270-70379292 GGCAGCATGGTGAAGTTGTTGGG - Intronic
1070771675 10:79085903-79085925 GGCAGCACCGGGCACTGGAAGGG + Intronic
1070827516 10:79399750-79399772 TGCAGGGCGGGGAAGTGGGAGGG + Intronic
1071426621 10:85561772-85561794 GGCAGCTAGGGGATGTGGTGGGG + Intergenic
1073614452 10:104978957-104978979 GGGAGCAAGGGGCAGAGGTAGGG - Intronic
1074360498 10:112821328-112821350 GGGAGGCCGGGGAAGTGGGAGGG - Intergenic
1074408081 10:113197967-113197989 AGCAGCTCAGGGAAGAGGTAAGG + Intergenic
1075515001 10:123101504-123101526 GGGGGCATGGGGAAGTGGCAAGG - Intergenic
1076667757 10:132102722-132102744 GGCAGGACGGGCAGGTGGGAGGG - Intergenic
1076861467 10:133140134-133140156 GGCAGCACGGGGCAGGGGCAGGG - Intergenic
1079648202 11:22893724-22893746 GGTAGCAAGAGGGAGTGGTAGGG + Intergenic
1081710165 11:45211103-45211125 GGCAGAACGGGGACCTGGGAGGG + Intronic
1084008416 11:66334987-66335009 GGCAGCACGGGGACGGGGGGAGG + Exonic
1084496855 11:69510221-69510243 GGCAGCATGGGGCCGTGGGAGGG - Intergenic
1084859910 11:72011540-72011562 GGCAGCACAGGGGAGAGGCAAGG + Intronic
1086414035 11:86570862-86570884 GCCAGCATGGGGGAGTGGGAAGG + Intronic
1088711681 11:112514144-112514166 GGCAGCACGGGGGAAGGGGAAGG - Intergenic
1088721213 11:112593424-112593446 GGCAGCCTGGGGAAGTGAAAAGG - Intergenic
1090073978 11:123567711-123567733 GGCAGCAGGGGGGAGTGGGATGG + Intronic
1091282896 11:134391928-134391950 GGCAGCACATGGGAGTGGGAGGG + Exonic
1091727857 12:2858024-2858046 GGAAACACGGGGAGGTGGCAGGG + Exonic
1092256387 12:6928466-6928488 GGCAGGAGGGGGAACTGGGAGGG - Intronic
1094330535 12:29287263-29287285 GGCAGCATGGTGTAGTAGTATGG - Intronic
1095088263 12:38082160-38082182 CGCAGCCCTGGGAAGTGGTTTGG - Intergenic
1100221136 12:92505578-92505600 GGCAGCTGGGGGAAGTGGGGAGG + Intergenic
1100228668 12:92585282-92585304 GGAGGTACAGGGAAGTGGTAAGG - Intergenic
1101965770 12:109281028-109281050 GGCAGAACAGGGATGTGGAATGG + Intronic
1103674759 12:122646953-122646975 GGCACCACGGGGAAGGGGGAGGG - Intergenic
1107004958 13:35599184-35599206 GGCAGCAGGCAGAAGTGGGAGGG - Intronic
1107399926 13:40059875-40059897 GGCAGCAGGGAGAAGAGGAAAGG + Intergenic
1110496364 13:76173270-76173292 GGCAGCAAGGAGAAGTGCTGAGG + Intergenic
1111800818 13:92978339-92978361 GGCAGCATGGCGGAGTGGAATGG + Intergenic
1113692577 13:112322106-112322128 GGCAGCACTGGGCAGTGATGAGG + Intergenic
1114036081 14:18628921-18628943 GGCAGCATGGTATAGTGGTATGG - Intergenic
1114122557 14:19686110-19686132 GGCAGCATGGTATAGTGGTATGG + Intergenic
1116318996 14:43435635-43435657 GAGAGAAAGGGGAAGTGGTAGGG + Intergenic
1118334630 14:64842404-64842426 GGCAGTAGGGGGTAGTGGTTAGG + Intronic
1119134994 14:72209591-72209613 GGCAGCATGGGGAGGTGAGAGGG - Intronic
1122540767 14:102496583-102496605 GGCAGCACAGGCAGGTGGCAGGG + Intronic
1122812038 14:104293846-104293868 GGCAGGACGGAGCAGTGGTTAGG + Intergenic
1123632139 15:22268840-22268862 GGGAGAAAGGGGAAGTGGGAGGG - Intergenic
1127597317 15:60498746-60498768 GGCAGGAATGGGAAGTGGAAGGG - Intronic
1128319194 15:66681006-66681028 GGCAGCATGAGCAAGTGGTTGGG + Intronic
1129287557 15:74538370-74538392 GGAAGTCAGGGGAAGTGGTAAGG + Intergenic
1129363414 15:75039255-75039277 GGCAGTAGGGAGATGTGGTAGGG - Intronic
1129904068 15:79173505-79173527 GGCAGCACAGGGCAGTGGCAGGG + Intergenic
1131683290 15:94746128-94746150 GGCAGCAAGGGGAAGAGAGAGGG - Intergenic
1131928117 15:97408496-97408518 CGCAGGAAGGGGAAGTGGTCCGG + Intergenic
1132279664 15:100602310-100602332 GCCACCACGGGGAAGCTGTAAGG + Intronic
1132680895 16:1141337-1141359 GGCTGCTCGGGGATGTGGAATGG - Intergenic
1133741093 16:8652073-8652095 GGCAGCCCGTGGAAGTGGAGTGG - Intergenic
1135717170 16:24781672-24781694 CGCAGGAGGAGGAAGTGGTACGG - Intronic
1136229950 16:28880138-28880160 GGGAGCGCGGGGAAGGGCTAAGG - Intronic
1136472255 16:30488996-30489018 GGCAGGACGGGGAAGAAGTGAGG - Intronic
1137275968 16:46933704-46933726 GACAGCACTGAGAAGTGGTCAGG - Intergenic
1138189814 16:55005355-55005377 GGCAGCATGGGGAGGTTGTAGGG - Intergenic
1140832534 16:78765101-78765123 GGCTGTGCGGGGATGTGGTAGGG + Intronic
1142535591 17:615757-615779 GGTAGCATGGGGAAGGGGTCAGG + Intronic
1142711472 17:1726088-1726110 GGCAGCACGGGGTGGTAGTTGGG - Exonic
1143251653 17:5527463-5527485 GGCAGGACTGGGGAGGGGTAGGG + Intronic
1144060184 17:11576256-11576278 GGTAGCACCGGAGAGTGGTAAGG + Intergenic
1144118217 17:12122289-12122311 GGCAGCAGGGGGACGAGGGAGGG - Intronic
1146306167 17:31731309-31731331 GGCAGCCTGGGAAAGTGGGAAGG - Intergenic
1148391286 17:47275008-47275030 GGCAGCAAGGGGTATAGGTACGG + Intronic
1149643270 17:58219028-58219050 GGGAGCCCGGAGAAGTGGTCGGG + Intronic
1151453696 17:74214019-74214041 GGCGGCGCGGGGGAGGGGTAAGG + Intronic
1152022276 17:77786471-77786493 GGCAGCAAGGGGAGTGGGTAGGG - Intergenic
1152064353 17:78102262-78102284 GTCACCACGGGGAAGTGGGAAGG + Intronic
1152103125 17:78314302-78314324 GGCAGCCCGGGGAAGCCGTGGGG + Intergenic
1152208061 17:78986779-78986801 GGCTGGAGGGGGAAGTGGGAGGG + Intergenic
1152572584 17:81127184-81127206 GGCAGCCTGGGGAAGTGGCCAGG + Intronic
1155840012 18:30632352-30632374 GGCAGGAGGGGGAAGTGGGTAGG + Intergenic
1157193550 18:45601064-45601086 GACAGCCTAGGGAAGTGGTAAGG - Intronic
1157211411 18:45745732-45745754 GGCAGCAGTGGAAACTGGTATGG - Intronic
1158943922 18:62432096-62432118 GGCAGCCCAGGGAAGTGCCATGG + Intergenic
1159492705 18:69159148-69159170 AGCAGCACAGGGAAGTGGCTAGG + Intergenic
1160251230 18:77204973-77204995 GGGAGCACGGGGCAGCGGGAGGG - Intergenic
1160254059 18:77232445-77232467 GGGAGCACTTGGAAGTGGAAAGG + Intergenic
1160745348 19:708837-708859 CGCAGCGCGGGGAGGTGGGAGGG + Intergenic
1161470118 19:4453042-4453064 GGCAGGACTGGGCAGTGCTAGGG + Intronic
1161966087 19:7549995-7550017 CGCAGCCCGGGGAACTGGTGGGG + Exonic
1165080345 19:33302885-33302907 GGCTGCACGGGGTAGGGGTGGGG + Intergenic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1165281588 19:34802820-34802842 GGGAGCAGGGGGAAGAGCTATGG - Intergenic
1165534418 19:36431404-36431426 GGCAGCCAGGGGAAGTGATGGGG + Intergenic
1166169771 19:41019546-41019568 GGCAGCCCTGGGAGGTGGGATGG - Intergenic
926113616 2:10197462-10197484 GGCAGCACTGGGAAGCAGAAGGG + Intronic
926384882 2:12326230-12326252 GGCAGCATTGGGAAGAGGGAGGG + Intergenic
926652139 2:15358170-15358192 GGCAGCGCAGGTGAGTGGTAGGG - Intronic
927865328 2:26584228-26584250 TGCAGCACCAGGAAGTGGAAGGG + Intronic
929621113 2:43354935-43354957 GGCAGCAAGGAGAAGTGCCAAGG - Intronic
929989947 2:46778442-46778464 GGCAGCAGAGGGAGGTGGGAGGG + Intergenic
930977594 2:57482689-57482711 GGCTGCACAGGGGAGAGGTAGGG - Intergenic
934047658 2:88185892-88185914 GGCAGCACCGGGGAGTGCTGTGG - Exonic
934863845 2:97788380-97788402 GACTGCTGGGGGAAGTGGTAGGG - Intronic
935110712 2:100091961-100091983 GGCACCACGGTGTAGTGGGAGGG - Intronic
936124259 2:109773201-109773223 GGCACCACGGTGTAGTGGGAGGG + Intergenic
936220429 2:110598263-110598285 GGCACCACGGTGTAGTGGGAGGG - Intergenic
940389827 2:153119317-153119339 GGCTACACTGAGAAGTGGTAAGG - Intergenic
940737411 2:157469043-157469065 AGCAGAATGGGGAAGTGGGATGG - Intronic
943575328 2:189625218-189625240 GGCAGCATGGAGAAGAGGTGGGG - Intergenic
946114386 2:217448659-217448681 GGCAGCCCAGGGGAGAGGTAGGG + Intronic
947291927 2:228585332-228585354 GGCAGGATGGGAAAGTGGTTAGG - Intergenic
947563994 2:231182059-231182081 AGCAGCAGGGGGAAGTGAGAGGG + Intergenic
948708655 2:239811594-239811616 GGCAGCACGGGGCAGGGAGAAGG - Intergenic
1168844666 20:935661-935683 GGCAGCAAGAAGAAGTTGTATGG + Intergenic
1172707781 20:36895278-36895300 GGCAGCAGGAGGTGGTGGTAGGG - Intronic
1173021410 20:39270826-39270848 GACAGAATGGGGAAATGGTAGGG - Intergenic
1174863926 20:54117442-54117464 GGCAGTAAGGTGAAGTGGTTAGG - Intergenic
1175833036 20:61977507-61977529 GGCAGAACGGGGAAGGGGGGAGG - Intronic
1175918411 20:62438370-62438392 GTCAGCATGGGGCAGTGGTGCGG + Intergenic
1176069645 20:63219348-63219370 GGCAGCACCCTCAAGTGGTATGG + Intergenic
1178121477 21:29474229-29474251 GTCAGCCAGGGGAAGTGGTGGGG + Intronic
1178695891 21:34792559-34792581 GGCAGCGCGGGGAACTGGCGCGG + Exonic
1179412925 21:41175866-41175888 GGCAGCACGATGTAGTGGGAAGG - Intronic
1180460207 22:15555983-15556005 GGCAGCATGGTATAGTGGTATGG - Intergenic
1181175716 22:21033696-21033718 GGCAACACAGGGATGGGGTAAGG - Intergenic
1182076366 22:27498139-27498161 GGCACCAGGGGGAAGTGTAAAGG + Intergenic
1182727751 22:32461376-32461398 GGAAGCACAGGGAAATGGGAGGG + Intronic
1183407093 22:37635572-37635594 GGCAGCCAGGAGAAGTGGCAAGG + Intronic
1184317055 22:43702627-43702649 GGCAACACAGGGAAATGGCATGG + Intronic
1185061287 22:48608106-48608128 GGCAGCCCGGGGCCGTGGGAGGG - Intronic
1185272928 22:49936936-49936958 TCCAGCATGGGGAAGGGGTAAGG - Intergenic
949503169 3:4701460-4701482 GGCAGCCCGGGAAACTGGCAGGG - Intronic
950097368 3:10337932-10337954 GGCAGCACGGGGAAGTGGTAGGG - Intronic
951702423 3:25509819-25509841 GGGAGGACGGGGAAGGGGAAGGG - Intronic
953351915 3:42222327-42222349 GGCAGCACGGTGCAGAGGAAAGG + Intronic
953927734 3:46990887-46990909 GTCATCATGGGGAAGTGGAAGGG + Intronic
954880599 3:53833494-53833516 GGCAGCCCAGGGAAGTGGAAGGG - Intronic
955068725 3:55554728-55554750 TGCAGCACGGGGAAGGGGGGAGG - Intronic
955996413 3:64685065-64685087 GGCAGCTTGGCGAAGTGGGAGGG - Intronic
960244080 3:115380405-115380427 GGCTGCACAGGGAAGTGGGGTGG + Intergenic
962867700 3:139461220-139461242 GGCAGCAGGGAGAAGTGGAGAGG - Intronic
968712829 4:2132073-2132095 AGAAGCCCTGGGAAGTGGTAAGG + Intronic
971264370 4:25085058-25085080 GGCAGCACAGGGTAGTTGGAGGG - Intergenic
971328883 4:25665949-25665971 GGCAGCACTGGGAAGAGGCATGG + Intronic
976675069 4:87694075-87694097 GGAAGCAAGGGGGAGTGGTAGGG + Intergenic
977633132 4:99264791-99264813 GGCAGCATGGAGAAGTGAGAGGG - Intergenic
982695834 4:158599302-158599324 TGAATCAAGGGGAAGTGGTAAGG - Intronic
982964071 4:161879807-161879829 GTAAGCAAGGGGAAGTGATAGGG - Intronic
984098056 4:175455502-175455524 AGCAGCATGGGGAACTGGAAAGG + Intergenic
986171073 5:5315140-5315162 GGCAGCAAGGAGAAGTGCTGAGG + Intronic
987075769 5:14380426-14380448 GGCAGCAGTGGGAAGCGGGATGG - Intronic
998392041 5:141793509-141793531 GGAAGCACAGGGGAGTTGTAAGG - Intergenic
1001112925 5:168913094-168913116 GGCAGTACAGGCAAGTGGTAAGG - Intronic
1002005020 5:176225468-176225490 GCCAGCACGGGTACGTGGTGAGG - Intergenic
1002093718 5:176818803-176818825 GGCAGCATGGGGATGGGGAATGG - Intronic
1002162195 5:177321009-177321031 GGCAGCACTGGCAAGCGGTGGGG + Intergenic
1002173675 5:177389365-177389387 AGCAGCAAGGGGAAGGGGAAGGG - Intronic
1002221354 5:177685157-177685179 GCCAGCACGGGTACGTGGTGAGG + Intergenic
1002329019 5:178428961-178428983 GGCAGCACTGGGGTGTGGTAGGG - Intronic
1002426575 5:179180306-179180328 GGCTGCAAGAGGAAGTGGGACGG + Intronic
1004018985 6:11759216-11759238 GGCAGAGAGGGGAAGTGGAAGGG + Intronic
1005031892 6:21516884-21516906 GGAAGTACAGGGAAGTAGTATGG - Intergenic
1007074066 6:39055709-39055731 GGGAGCACGGGGAGGGGGTGGGG + Intronic
1007414808 6:41685024-41685046 TGCCGGACGGGGAGGTGGTAGGG + Exonic
1015083194 6:129253376-129253398 GGCAGCACAGGGAAATGATGAGG - Intronic
1015790152 6:136957853-136957875 GGCTGCATGGGTAGGTGGTAGGG - Intergenic
1017229081 6:152052798-152052820 GACAGCACGGGCAAGTGTTCTGG + Intronic
1018072148 6:160174254-160174276 GGCTGAACGGGGAAGAGGTGTGG + Intronic
1018196299 6:161358709-161358731 GGGTGCACTGGGAAGTGGGAGGG - Intronic
1018210943 6:161481019-161481041 AGCAGCACGTGGAAGTGGGCAGG + Intronic
1019057110 6:169231870-169231892 GGCAGCACAGGGAATTTGGAAGG - Intronic
1019540322 7:1548320-1548342 GCCAGCACGGGGGAGTGGGGAGG - Intronic
1020277625 7:6634483-6634505 GGCAGCACTGGGAAGTGACAGGG + Intergenic
1022421287 7:30226116-30226138 GGCAGAAAAGGGAAGTGGAAAGG - Intergenic
1022506029 7:30909071-30909093 GGGACCAGGGGGAAGTGGTCAGG - Intergenic
1023831928 7:44044607-44044629 GGCAGGAAGCGGAAATGGTAGGG - Intergenic
1023925792 7:44668628-44668650 GGCACCAGGGGGGAGTGATAAGG + Intronic
1025944003 7:66092670-66092692 GGCAGCATGGGGAAGGGGATGGG - Intronic
1029188387 7:98755297-98755319 GGCAGCATGGGACAGTGGTCAGG + Intergenic
1029984942 7:104914467-104914489 GGCAGCACTGGGATGTGCTGGGG + Intergenic
1030609757 7:111676322-111676344 GGCAGCAAGGGCAGGAGGTAGGG + Intergenic
1035122362 7:156579232-156579254 GGAAGCCCGGGGAGGTGGTGGGG + Intergenic
1035389950 7:158497226-158497248 GGCAGCCCAGGGAAGGGGGAGGG - Intronic
1036445809 8:8821037-8821059 GTCAGCACAGGGAAGTGGGGAGG + Intronic
1036678174 8:10851949-10851971 GGGAGCGCGGGGAAGGGGAAGGG + Intergenic
1037217920 8:16480320-16480342 GGCAGGATTGGGAAGTGGGAGGG + Intronic
1040304815 8:46206544-46206566 GGCCACAGGGGGAAGTGGGAGGG + Intergenic
1040550350 8:48432619-48432641 GGCAGCACAGGACAGGGGTAGGG - Intergenic
1041333868 8:56758024-56758046 GGCAGCAAGGAGAAGTGCTGAGG + Intergenic
1043395717 8:79834038-79834060 GGAAGGATGGGGAAGTGATAAGG - Intergenic
1044389056 8:91627220-91627242 GGCAGCACGGAGCAGAGGTATGG + Intergenic
1044626928 8:94243066-94243088 GGAAGGATGGGGAAGTGGGAGGG + Intergenic
1045071349 8:98507645-98507667 AGCAGGATAGGGAAGTGGTAGGG - Intronic
1046286490 8:112099383-112099405 GGAAACACTGGGAAGTGGTCTGG - Intergenic
1047383664 8:124388021-124388043 GTAAACAGGGGGAAGTGGTAAGG + Intergenic
1047491542 8:125378883-125378905 GGCAGCACAGGCCAGTGATAGGG + Intergenic
1048948566 8:139473710-139473732 GGCAGCTCGGTGAAGGGGTGGGG + Intergenic
1049974313 9:847012-847034 GGCCGCACTGGGCAGTGGGATGG - Exonic
1053383555 9:37668530-37668552 GCCAGCAGGGGGAAGAGGTGTGG + Exonic
1056759866 9:89406810-89406832 GGCGGCATGTGGAGGTGGTAGGG - Intronic
1061004589 9:127921360-127921382 GTAAGCACGGGTAAGTGGCAAGG - Exonic
1061785157 9:133023415-133023437 GGCAGCAGGGGCAAGCGGTGTGG - Intergenic
1062408208 9:136408074-136408096 GGCAGCACTAGGAAGTGTGAAGG + Intronic
1187191080 X:17035700-17035722 GGCTGTGCGGGGAAATGGTAGGG - Intronic
1189197763 X:39166389-39166411 GGCAGCTCTGGGTAGTGGGAGGG + Intergenic
1194534380 X:95087137-95087159 GGCAGCAAGGAGAAGTGCCAAGG + Intergenic
1196375203 X:115025867-115025889 GGCAACAGGGGGATGTGGGAGGG - Intergenic
1196810513 X:119625487-119625509 AGCAGGAAGGGGAAGTGGGAAGG + Intronic
1199298293 X:146183934-146183956 GTCAGCATGTGGAGGTGGTAAGG + Intergenic