ID: 950099278

View in Genome Browser
Species Human (GRCh38)
Location 3:10347197-10347219
Sequence CCGTAAGCACAGATTGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 76}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950099278_950099292 30 Left 950099278 3:10347197-10347219 CCACCCCCAATCTGTGCTTACGG 0: 1
1: 0
2: 0
3: 5
4: 76
Right 950099292 3:10347250-10347272 GTCTGGGCAGGCTGTTCCCTTGG 0: 1
1: 0
2: 1
3: 25
4: 258
950099278_950099287 13 Left 950099278 3:10347197-10347219 CCACCCCCAATCTGTGCTTACGG 0: 1
1: 0
2: 0
3: 5
4: 76
Right 950099287 3:10347233-10347255 GCTCTCACTGGCCCTGTGTCTGG 0: 1
1: 1
2: 3
3: 23
4: 212
950099278_950099289 18 Left 950099278 3:10347197-10347219 CCACCCCCAATCTGTGCTTACGG 0: 1
1: 0
2: 0
3: 5
4: 76
Right 950099289 3:10347238-10347260 CACTGGCCCTGTGTCTGGGCAGG 0: 1
1: 0
2: 1
3: 38
4: 368
950099278_950099285 1 Left 950099278 3:10347197-10347219 CCACCCCCAATCTGTGCTTACGG 0: 1
1: 0
2: 0
3: 5
4: 76
Right 950099285 3:10347221-10347243 CCCACAGAGCTAGCTCTCACTGG 0: 1
1: 0
2: 3
3: 8
4: 125
950099278_950099288 14 Left 950099278 3:10347197-10347219 CCACCCCCAATCTGTGCTTACGG 0: 1
1: 0
2: 0
3: 5
4: 76
Right 950099288 3:10347234-10347256 CTCTCACTGGCCCTGTGTCTGGG 0: 1
1: 0
2: 3
3: 33
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950099278 Original CRISPR CCGTAAGCACAGATTGGGGG TGG (reversed) Intronic
902943562 1:19817312-19817334 CCGTGAGCACAGAATGACGGTGG - Intergenic
903907841 1:26697975-26697997 TTGAAAGCACAGATGGGGGGCGG - Intronic
911831391 1:102554621-102554643 GTGTGAGCACAGAATGGGGGTGG - Intergenic
912460054 1:109824451-109824473 CTGTAAGCACACGCTGGGGGAGG - Intergenic
912956551 1:114157618-114157640 CAGTAAGCAGAGGATGGGGGAGG - Intergenic
920264468 1:204711667-204711689 ATGTAAGCACAGAGTGGGGGTGG - Intergenic
921937461 1:220808262-220808284 CCCTAAACACAGAGTGAGGGTGG + Intronic
1068194801 10:53702585-53702607 GCAGAAGCACACATTGGGGGAGG + Intergenic
1076311342 10:129509965-129509987 CCTTAAGGCCAGATTGGAGGTGG + Intronic
1078604348 11:12761931-12761953 CTTTAAGCACTGAATGGGGGTGG + Intronic
1088918439 11:114244351-114244373 AAGTAAGGACAGATTGGGGGGGG + Intronic
1092659283 12:10722173-10722195 CCGTGGGCACAGAGAGGGGGAGG + Intronic
1095837890 12:46658250-46658272 GAGTAGCCACAGATTGGGGGTGG - Intergenic
1096465793 12:51847351-51847373 CCGTAAGCCCAGAGTTGGGCTGG + Intergenic
1100469305 12:94875364-94875386 CTATCAGCACAGATAGGGGGAGG + Intergenic
1105624207 13:22097428-22097450 CCGAAAGCACAGTTTGGCCGAGG - Intergenic
1119519871 14:75277714-75277736 CCGTAAGCACAGCTTCCTGGCGG + Intergenic
1121584078 14:95051009-95051031 CCCTATCCACAGAATGGGGGTGG - Intergenic
1122289055 14:100669812-100669834 CCCTGAGAACAGACTGGGGGCGG - Intergenic
1137729449 16:50679254-50679276 CCCTGAGCACAGATGGGGGCGGG + Intronic
1141529685 16:84637589-84637611 CCGGAAGCACTGATTGGGAGGGG - Intergenic
1141860051 16:86710405-86710427 CCGTAAGCACTGACTGGGGTTGG + Intergenic
1147169107 17:38607702-38607724 CCTTAGGCACAAAGTGGGGGAGG - Intergenic
1150896722 17:69220221-69220243 TCCTAAACAAAGATTGGGGGAGG + Intronic
1153848122 18:9068143-9068165 CCATGAGAACAGATTGGGGTTGG - Intergenic
1153985254 18:10345149-10345171 CCGTATTCTCAGATTTGGGGAGG - Intergenic
1154249041 18:12727395-12727417 CAGTATGCAAAGATTGGGAGTGG + Intergenic
1160089257 18:75810769-75810791 CCATAAGTGCTGATTGGGGGTGG - Intergenic
1162837845 19:13333007-13333029 CAGTCAGCAGAGAATGGGGGTGG - Intronic
1164820710 19:31249122-31249144 GAGTAAGCACAGAGTGGGTGAGG + Intergenic
1165247588 19:34506005-34506027 CCCTGAGAACAGATTGGGGCTGG + Exonic
929465042 2:42136844-42136866 CCTTAAGGAAAGAGTGGGGGTGG + Intergenic
938030176 2:127985681-127985703 CCGTGGGCACAGGCTGGGGGTGG - Intronic
943198017 2:184780531-184780553 CCTTAATCACAGATGGAGGGAGG + Intronic
944082496 2:195804067-195804089 CCATGAGCACAATTTGGGGGGGG - Intronic
948886149 2:240885935-240885957 TGGTAAGGACAGAGTGGGGGTGG + Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1172587885 20:36097570-36097592 CAGTATTCACAGGTTGGGGGTGG + Intronic
1172796166 20:37539987-37540009 CTTGAAGCAGAGATTGGGGGAGG + Intergenic
1173087616 20:39939309-39939331 CAGGAAGGACAGCTTGGGGGTGG - Intergenic
1173549163 20:43920581-43920603 CCTCCAGCACAGGTTGGGGGAGG - Intronic
1174198726 20:48791994-48792016 CAGAAGGCACAGATTGGGGTTGG + Intronic
1182725106 22:32439028-32439050 CAGAAAGCACAGATTGGGCTGGG + Intronic
950099278 3:10347197-10347219 CCGTAAGCACAGATTGGGGGTGG - Intronic
950446495 3:13041871-13041893 CCCTAAGCACAAGTTTGGGGAGG - Intronic
951846346 3:27088738-27088760 TCATCAGCAAAGATTGGGGGTGG + Intergenic
952329399 3:32350202-32350224 CAGGAAGCAAAGGTTGGGGGTGG - Intronic
964722643 3:159782601-159782623 AAGTAAGCACAGAGTGGTGGTGG - Intronic
971530431 4:27681290-27681312 CTATAAGCAGAGTTTGGGGGAGG + Intergenic
980919287 4:139066529-139066551 AGGAAAGCACAGAATGGGGGAGG + Intronic
980925487 4:139132979-139133001 CAGTGAGCCGAGATTGGGGGAGG - Intronic
983617509 4:169724522-169724544 ACTTAAGAATAGATTGGGGGTGG + Intergenic
985542705 5:494231-494253 CCGTGAGCCCAGATCTGGGGAGG - Intronic
996787771 5:127259172-127259194 TGGTAAACACAGAATGGGGGAGG + Intergenic
1001147679 5:169199061-169199083 CAGTAAGCCCAGTTTGGAGGAGG + Intronic
1001873815 5:175182050-175182072 TCAGAAGAACAGATTGGGGGAGG - Intergenic
1002271286 5:178074252-178074274 CCGTGGGCACAGGCTGGGGGTGG - Intergenic
1003572987 6:7268174-7268196 CAGCAAGAACATATTGGGGGTGG - Intergenic
1011861821 6:91767564-91767586 CTGAAAACACAGATTGGGGCAGG + Intergenic
1014083203 6:117312099-117312121 ACGGAAGCACAGATTGAGAGAGG - Intronic
1018183837 6:161247724-161247746 CTGTAATCACAGATTTTGGGAGG + Intronic
1020427503 7:8085751-8085773 CCGCTAGCACAGATGGGGGGTGG - Intronic
1021220307 7:17968332-17968354 CCGTAAGGAGAGATTAGAGGAGG + Intergenic
1024182485 7:46909964-46909986 CTGTCAGCACAGCTTGGGTGAGG + Intergenic
1025613263 7:63096485-63096507 CCGGAAGCACACCTTGGGAGGGG + Intergenic
1034171273 7:149065291-149065313 CCCTAAGCGCAGCTTGTGGGCGG - Intergenic
1034189884 7:149205816-149205838 CTGTAATCACAGGATGGGGGAGG + Intronic
1035482765 7:159200732-159200754 CCGTGAGAACAGATTGGATGTGG + Intergenic
1036160131 8:6380068-6380090 CAGTAAGAATAGATTGGGGTTGG + Intergenic
1038169402 8:25115311-25115333 CCATAAGCAAAGTTTGGGGTGGG + Intergenic
1042347341 8:67740978-67741000 CCATAAGCACAGCATGGGTGTGG + Intronic
1046438697 8:114230484-114230506 TCGTAAGCACAGGATGGGGTGGG - Intergenic
1046662415 8:116962486-116962508 CAGTAAGAACAGTTTGGGGACGG - Intronic
1053475849 9:38381695-38381717 CCGTGAGGACAGAGTGGAGGTGG - Intergenic
1059027582 9:110652032-110652054 AAGTAAGCAGAGAATGGGGGTGG - Intergenic
1062229319 9:135472693-135472715 GGGTGAGCACAAATTGGGGGTGG - Intergenic
1185804932 X:3048327-3048349 CCTTAAGCACAAATTGTGAGGGG - Intronic
1187241711 X:17519956-17519978 CCATAAGCACAAATGGGGGTGGG - Intronic
1189561472 X:42195446-42195468 TAGGAAGCACAGAATGGGGGTGG + Intergenic
1189960257 X:46317657-46317679 CAGTAGGAACAGATCGGGGGAGG + Intergenic
1200161520 X:154012281-154012303 CTGAAAGCACAGAGTGGGGCAGG + Intronic
1201276325 Y:12302278-12302300 CCTTAAGCACAAATTGTGAGGGG + Intergenic