ID: 950100018

View in Genome Browser
Species Human (GRCh38)
Location 3:10350912-10350934
Sequence CATGAACGCCTCCTCAGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950100014_950100018 20 Left 950100014 3:10350869-10350891 CCATTGGCTGTCTCGACCTGGGC 0: 1
1: 0
2: 0
3: 9
4: 100
Right 950100018 3:10350912-10350934 CATGAACGCCTCCTCAGATCTGG 0: 1
1: 0
2: 1
3: 7
4: 73
950100016_950100018 4 Left 950100016 3:10350885-10350907 CCTGGGCGAAGACTTTGGAAAGA 0: 1
1: 0
2: 1
3: 6
4: 110
Right 950100018 3:10350912-10350934 CATGAACGCCTCCTCAGATCTGG 0: 1
1: 0
2: 1
3: 7
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950100018 Original CRISPR CATGAACGCCTCCTCAGATC TGG Intronic
904090869 1:27944271-27944293 AAGGAACGCCACTTCAGATCGGG - Intronic
905204212 1:36333724-36333746 CATGGACACCTTCTCAGATTGGG + Intergenic
907576911 1:55534794-55534816 CAGGAAGGCCTTCTCAGATGGGG + Intergenic
912040578 1:105384335-105384357 CATGAAGGACACCCCAGATCAGG - Intergenic
913167279 1:116199925-116199947 AAAGAAAGTCTCCTCAGATCTGG + Intergenic
914355540 1:146881395-146881417 CATGAACACTTCCTCAGAGAAGG - Intergenic
915259066 1:154662826-154662848 CATGTACAACTGCTCAGATCGGG - Intergenic
916388558 1:164305028-164305050 TATGAATGCCTTCTCAGAACTGG - Intergenic
917471820 1:175332269-175332291 CATGAATTGCTCCTCAGAGCTGG - Intronic
919362923 1:196617505-196617527 CATGACCACCTCCTCAGGTTTGG - Intergenic
1063858215 10:10278833-10278855 CATAAATGTCTCCTCAGCTCAGG + Intergenic
1066596924 10:37061397-37061419 CATGAATTCCTCCGTAGATCTGG + Intergenic
1067477253 10:46575251-46575273 CATGACCTCCTCCTCAGATGAGG - Intergenic
1067617486 10:47766530-47766552 CATGACCTCCTCCTCAGATGAGG + Intergenic
1070900233 10:80022231-80022253 CATCACCACCTCCTTAGATCTGG - Intergenic
1070901986 10:80038101-80038123 CATCACCACCTCCTTAGATCTGG - Intergenic
1076320879 10:129580552-129580574 CATGCACACCTCCTCAGACCTGG + Intronic
1077455964 11:2681012-2681034 TATGAAAGCCTCCTCAGATGTGG + Intronic
1083117998 11:60482761-60482783 CATAGACTCTTCCTCAGATCTGG - Intergenic
1084405326 11:68968745-68968767 TGGGACCGCCTCCTCAGATCGGG + Intergenic
1089695971 11:120216571-120216593 GAGGAATTCCTCCTCAGATCAGG + Intronic
1092583902 12:9876656-9876678 CATGGACTCCTCCGCAAATCTGG + Intergenic
1096993433 12:55823461-55823483 CTTGAAGGCCTCCTCAGCCCGGG + Exonic
1099309335 12:80998251-80998273 CATCAACGCCTTCTGAGATCAGG - Intronic
1102259703 12:111436558-111436580 CATGGTCCCCTCCTCAGATATGG - Intronic
1103546146 12:121703067-121703089 CATGAGCGGCTGCTCAGATCGGG + Intergenic
1104320391 12:127745331-127745353 CCTAAACTCCTCCTAAGATCAGG - Intergenic
1118239236 14:64039468-64039490 CATGAACTCCTCCTAAGGGCAGG - Intronic
1119729831 14:76944044-76944066 CATGCACTCCTCCTCTGATTGGG - Intergenic
1121410570 14:93745908-93745930 CAGAACCGCCTCCTCAGAGCTGG + Intronic
1126379480 15:48031284-48031306 CATGGACACCTCCTCTGCTCTGG + Intergenic
1126668928 15:51098453-51098475 CATGGAGGCCCCCTCAGCTCTGG - Intronic
1131504945 15:93009279-93009301 CCTTAAAGCCTACTCAGATCAGG + Exonic
1133126587 16:3651374-3651396 GCTGACCGCCTTCTCAGATCAGG - Intronic
1139288492 16:65836246-65836268 CCTGAACTCTACCTCAGATCTGG - Intergenic
1139742128 16:69044435-69044457 CATGAACTCCCCATCAGAACTGG - Intronic
1139978479 16:70834048-70834070 CATGAACACTTCCTCAGAGAAGG + Exonic
1140373978 16:74430014-74430036 CATGAAAGCCTCCACAGTTAGGG - Intergenic
1142364745 16:89644357-89644379 CAGGAACCCCTCCTCAGCTTGGG + Intergenic
1147140519 17:38458285-38458307 CATGAAAGCTTCCCCAGACCAGG - Intronic
1149745464 17:59093339-59093361 CATGAACTCCTCTCCAGAACTGG + Intronic
1152203286 17:78959541-78959563 CATGACCCCCTCCTCAGGTTTGG + Intergenic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
925538788 2:4944092-4944114 CATGAACCTCACCTCAGAACAGG + Intergenic
932440143 2:71729609-71729631 CAGGAACACCTTGTCAGATCTGG - Intergenic
932651883 2:73566818-73566840 CATGACCCCCTCCTCAGGTTTGG + Intronic
933281878 2:80340906-80340928 CATCATCCCCTCCTCAGATTCGG + Intronic
934518085 2:95001344-95001366 CATGACCCCCTCCTCTGAGCTGG - Intergenic
935489876 2:103705523-103705545 CATCAAAGCCTCTTCAGATATGG - Intergenic
938339879 2:130528275-130528297 CACGACAGCCTCCTCAGATTGGG - Intronic
938349957 2:130592475-130592497 CACGACAGCCTCCTCAGATTGGG + Intronic
944378945 2:199084628-199084650 AATGAACGCTTCCTGAGAACAGG - Intergenic
947563419 2:231177795-231177817 CATGAAGGGATCCTCAGATGAGG - Intergenic
1174762555 20:53220693-53220715 CATGACCGGCCCCTCACATCCGG - Intronic
1180711664 22:17843348-17843370 CATGACAGCCTCCTCTGACCAGG - Intronic
1182483750 22:30626892-30626914 CAAGAAGGCCTCCTCAGCCCGGG + Exonic
950100018 3:10350912-10350934 CATGAACGCCTCCTCAGATCTGG + Intronic
955022011 3:55130786-55130808 CATGAACTCCTTTGCAGATCTGG + Intergenic
958156602 3:89762698-89762720 CATGAAGGACACTTCAGATCTGG - Intergenic
968779635 4:2570736-2570758 GGTGAGCTCCTCCTCAGATCAGG + Intronic
973610204 4:52629122-52629144 CATGAACACCTTCTCAAAACTGG + Intronic
975716767 4:77212618-77212640 CATGACAGCCTCCTTAGATCAGG + Intronic
977528049 4:98167766-98167788 CATGACCGCCTCCTCAGATTTGG - Intergenic
984825525 4:183920642-183920664 CAATAAAGCCTCCTAAGATCTGG + Intronic
986874312 5:12088733-12088755 CAAGAAAGCCTCCACAGATGTGG - Intergenic
1002442604 5:179272205-179272227 CATGACTGTCGCCTCAGATCTGG - Intronic
1003709074 6:8568767-8568789 CATGAAAGTCTCCTCAGAAGAGG + Intergenic
1011701471 6:89959179-89959201 CATCACCCCCTCCTCAAATCAGG - Intronic
1013332970 6:109124279-109124301 CATGCGAGACTCCTCAGATCTGG + Intronic
1014688629 6:124533813-124533835 CATGAAAGTCCCCGCAGATCTGG + Intronic
1016441217 6:144085416-144085438 CATATACGTCTCCTCAGATGCGG - Intergenic
1021703505 7:23343763-23343785 CATGATCTCCTCCTCAGCTTTGG + Exonic
1046765207 8:118061586-118061608 CATGATGGCCTCCACACATCTGG + Intronic
1047771297 8:128032193-128032215 CATGTCCTCCTCCTCAGCTCTGG - Intergenic
1055012153 9:71578879-71578901 CATGATCCCCTCCTCAGGTTTGG + Intergenic
1056072534 9:83003373-83003395 CATGAAAGCCTCATAAGAACTGG - Intronic
1058985069 9:110202521-110202543 CATTTACGGCTCCTCAGAACTGG + Intronic
1059057279 9:110996926-110996948 CATGAACTCCTCCTCTCAGCTGG + Intronic
1059205452 9:112460213-112460235 CATGAAAGACTCTTTAGATCAGG - Intronic
1189361844 X:40359215-40359237 CATGAACGCCACCCTCGATCTGG + Intergenic
1194157017 X:90403940-90403962 CATGAAGGACACCCCAGATCAGG + Intergenic
1200503353 Y:3980922-3980944 CATGAAGGACACCCCAGATCAGG + Intergenic