ID: 950106109

View in Genome Browser
Species Human (GRCh38)
Location 3:10389851-10389873
Sequence CTGGGTCCCAGCTGTCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 646
Summary {0: 1, 1: 0, 2: 4, 3: 58, 4: 583}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950106109_950106115 24 Left 950106109 3:10389851-10389873 CCAGGAGGACAGCTGGGACCCAG 0: 1
1: 0
2: 4
3: 58
4: 583
Right 950106115 3:10389898-10389920 CCCACCCAGTTCTAGCAGCGAGG 0: 1
1: 0
2: 1
3: 5
4: 143
950106109_950106117 25 Left 950106109 3:10389851-10389873 CCAGGAGGACAGCTGGGACCCAG 0: 1
1: 0
2: 4
3: 58
4: 583
Right 950106117 3:10389899-10389921 CCACCCAGTTCTAGCAGCGAGGG 0: 1
1: 0
2: 0
3: 4
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950106109 Original CRISPR CTGGGTCCCAGCTGTCCTCC TGG (reversed) Intronic
900140201 1:1136659-1136681 CTGGGTCCCTGCGGGCCGCCTGG + Intergenic
900490988 1:2949073-2949095 CTCAGGCCCAGCTGCCCTCCAGG + Intergenic
900503489 1:3017856-3017878 CTGGTTTCCAGCTGTCCCCAGGG - Intergenic
900710016 1:4107760-4107782 TGGTGACCCAGCTGTCCTCCTGG - Intergenic
901215908 1:7555327-7555349 TCTGGTCCCAGCTGCCCTCCTGG - Intronic
901232583 1:7649463-7649485 GTGGGTCCCAGCCCTCTTCCTGG + Intronic
901674375 1:10874429-10874451 CTGGGTCCCACCTGGCTACCTGG - Intergenic
902622148 1:17656744-17656766 CTGGCACCCAGCTGGCATCCAGG - Intronic
902644496 1:17788886-17788908 CTGTGTGACAGCTGACCTCCTGG + Intronic
904009119 1:27380002-27380024 CTGAGTCCCAGCTTACCTCCTGG - Exonic
904562252 1:31406752-31406774 CTGGTGCCCACCTGTCTTCCTGG + Intergenic
904991171 1:34593876-34593898 GTGGGGCCCAGGAGTCCTCCTGG + Intergenic
905208696 1:36358352-36358374 CTTGGTCCCCCCTCTCCTCCAGG + Exonic
905787340 1:40768832-40768854 CTTGGTCCCAGCAGTCCTCATGG - Intronic
905911028 1:41654796-41654818 GTGGATCCCAGCTGCCCTGCAGG + Intronic
905912315 1:41662886-41662908 CTGGGTGCCAGCCGGGCTCCGGG + Intronic
906524515 1:46486359-46486381 CAGGGTCCCAGCTGTCTGCCCGG - Intergenic
906607758 1:47183481-47183503 CTCGGTCCCAGCTGCCCTGTGGG + Intergenic
906988657 1:50713865-50713887 CTGGGTTCAAGCAATCCTCCCGG + Intronic
907311008 1:53538983-53539005 CTGGATCCCACCTGTCCACTTGG - Intronic
908114922 1:60931233-60931255 ATGGCTCCCTGCTGTCCTCAGGG + Intronic
908530230 1:65027138-65027160 CTGGGTTCAAGCTATTCTCCTGG + Intergenic
908690632 1:66775610-66775632 CTGGGTCCCCACTGCCATCCTGG - Intronic
908708743 1:66991375-66991397 CTGAGTCCCAGTTGCCCTCTGGG + Intergenic
908740646 1:67323841-67323863 CTGGTACCCAGCTGTCATTCTGG - Intronic
911092174 1:94026287-94026309 GTAGGTGCCAGCTCTCCTCCTGG - Intronic
912655364 1:111481813-111481835 CTGGGTCTCTGCTGCCCTCGTGG - Intergenic
912775711 1:112505173-112505195 CTGGGTGGAAGCTGTCCTGCTGG + Intronic
912821978 1:112875011-112875033 CTGGGTTCAAGCTATTCTCCTGG - Intergenic
913109905 1:115648464-115648486 ATGGGTCCCAACTGCCCTCCAGG - Intronic
913539245 1:119803135-119803157 ATGAGACCCAGCTGTGCTCCTGG - Exonic
914833714 1:151190074-151190096 CCGGTTCCCAGCGGTCTTCCGGG + Exonic
915517259 1:156420806-156420828 CTGGGTCGCTGCGGTCTTCCCGG - Intronic
916713638 1:167432835-167432857 CCAAGTCCCAGCTGTGCTCCAGG + Intronic
917284656 1:173411304-173411326 CTGGGTTCCAGCTGTAGTTCTGG + Intergenic
917307054 1:173637917-173637939 GTAGGTCCTGGCTGTCCTCCAGG - Intronic
918253113 1:182722568-182722590 GTGGCTCCCAGCAGTCCTCGGGG + Intergenic
919796333 1:201323452-201323474 CCGGTCCCCAGCTGGCCTCCTGG + Intronic
919926281 1:202193500-202193522 CTGGGTCCCATGTGACCTCGTGG + Intergenic
920311013 1:205048356-205048378 CTGTCCCCCAGCTGTCCCCCAGG + Intronic
920691440 1:208149990-208150012 CAGGCTCCTAGCTGTCCTCCAGG - Intronic
922224601 1:223634364-223634386 ATGGGTCCTTGCTGGCCTCCTGG - Intronic
922750089 1:228066178-228066200 CTGGGGTCCAGCTGTCGACCTGG + Intergenic
922803181 1:228373274-228373296 CTGGGTCCCAGCTGCCCTGTGGG - Intronic
922999849 1:229998046-229998068 CTGTCTCCCATCTGCCCTCCTGG - Intergenic
923199055 1:231694223-231694245 CTGCCTCCCAGCTGGCGTCCAGG - Exonic
924685215 1:246282237-246282259 CTGGGCTCAAGCAGTCCTCCTGG - Intronic
924934824 1:248758908-248758930 CTGGGACTCAGCTGAGCTCCAGG - Intergenic
1063048292 10:2416720-2416742 GTGGGGCCCAGCTCTGCTCCTGG + Intergenic
1063120862 10:3104970-3104992 CTAGGTCCCTGCAGGCCTCCTGG + Intronic
1063201220 10:3786067-3786089 TAGGGTCCCCTCTGTCCTCCGGG + Intergenic
1063272891 10:4530966-4530988 CTGGGTCCAAGCAATCCCCCAGG - Intergenic
1063458720 10:6202585-6202607 CTGCGTCTCTGCTCTCCTCCCGG + Intronic
1063822478 10:9853801-9853823 CGGGGACCCAGCTGGACTCCGGG - Intergenic
1064255338 10:13738510-13738532 CTGGCACCCAGCTGTCATCTTGG - Intronic
1064458973 10:15514894-15514916 CTGGGTCTCAGTCTTCCTCCTGG + Exonic
1065316026 10:24464871-24464893 CTGGGGCCAGGCTGTCCCCCAGG - Intronic
1066532203 10:36353175-36353197 CTGGCTGCCAGCTCTCCCCCAGG - Intergenic
1067016639 10:42761192-42761214 CTGGATGCCAGATGTCTTCCAGG - Intergenic
1067152774 10:43750181-43750203 CTGTTTCTCAGCTGTTCTCCAGG + Intergenic
1067756711 10:49011201-49011223 CTGGGCCTCAGCTGTCCTCCAGG + Intergenic
1067804928 10:49385797-49385819 CTGGGGCCCAGCTCTGTTCCTGG + Intronic
1068033930 10:51736700-51736722 CTGGTTTCAAGCGGTCCTCCTGG + Intronic
1068114596 10:52723311-52723333 CTGGGTCTCATTTGTCATCCAGG - Intergenic
1069572847 10:69504812-69504834 CTGGGTCCCAGGTGGCCCCAGGG - Intronic
1069590003 10:69635694-69635716 CTGGGGACCAGCTGCCCTCCTGG + Intergenic
1069770737 10:70898087-70898109 CTGGGTTCAAGCAGTTCTCCTGG - Intergenic
1070438055 10:76412954-76412976 CTGGATTACAGCTGTTCTCCTGG + Intronic
1070613890 10:77954077-77954099 CTGGGTTCAAGCTATTCTCCTGG + Intergenic
1070724467 10:78778783-78778805 CCAGCTCCCATCTGTCCTCCTGG - Intergenic
1070752593 10:78972949-78972971 CAGGGCCCCAGCAGACCTCCAGG - Intergenic
1070826173 10:79391695-79391717 CAGGCTCCAAGCTATCCTCCGGG + Intronic
1071605413 10:86983176-86983198 CTGGATGCCAGATGTCTTCCAGG - Intronic
1071698836 10:87907013-87907035 TTGTGTCACAGCTGTCATCCTGG - Intronic
1072240528 10:93491559-93491581 ATGGCTCCCAGCTGTTCTTCTGG + Intergenic
1072728120 10:97827282-97827304 CTGGGTTCAAGCAATCCTCCTGG + Intergenic
1072768337 10:98114851-98114873 CTGGGTCCAAGAAGTCTTCCTGG + Intergenic
1073453520 10:103623149-103623171 CTGGGACCCAGCTGTGTGCCCGG - Intronic
1074078556 10:110150694-110150716 CTGACTCCCAGCTGCCCTCCAGG - Intergenic
1074371899 10:112907108-112907130 CTGGGGACATGCTGTCCTCCTGG + Intergenic
1075390503 10:122087629-122087651 CTGTGTCTCAGCTGTGCTCAGGG - Exonic
1075604242 10:123792895-123792917 GTGGGTCCCAGCTCTGCTCTGGG - Intronic
1075647791 10:124107917-124107939 CTGGGAGCCATCAGTCCTCCGGG - Intergenic
1076140155 10:128071795-128071817 CTGGGGCCCCGGTGTCCTGCTGG + Intronic
1076159788 10:128234904-128234926 CTGGCTGCCATCTGGCCTCCAGG - Intergenic
1076908226 10:133373617-133373639 CGGGGTCCCAGCTGGCCCCGGGG + Exonic
1077078520 11:712314-712336 CTGGGTACGAGCTGGGCTCCCGG + Intronic
1077078530 11:712350-712372 CTGGGTGCGAGCTGGGCTCCCGG + Intronic
1077078540 11:712386-712408 CTGGGTGCGAGCTGGGCTCCCGG + Intronic
1077078549 11:712422-712444 CTGGGTGCGAGCTGGGCTCCCGG + Intronic
1077078558 11:712458-712480 CTGGGTGCGAGCTGGGCTCCCGG + Intronic
1077318267 11:1928801-1928823 CTGGGTCTCATCTGTCCCCCCGG - Intronic
1077321868 11:1946448-1946470 AAGGGTCCCAGCAGCCCTCCTGG + Intergenic
1077413474 11:2414038-2414060 GTGAGTGCCAGCTGTCCTCGAGG - Intronic
1077987290 11:7366047-7366069 CTGTGGCCCAGCTGTCCTCCAGG + Intronic
1078134344 11:8639949-8639971 CAGGGTCCCTACTGTCATCCAGG + Intronic
1078508689 11:11969600-11969622 CTGGGGCCCAGCAGACCTTCTGG + Intronic
1078768912 11:14328756-14328778 CTGGGTTCAAGCAATCCTCCTGG + Intronic
1079034078 11:17007414-17007436 CTGGGTTCAAGCGTTCCTCCTGG + Intronic
1079087562 11:17457652-17457674 CTGGGTCCCAGCTTTCCCTGGGG + Intronic
1079814568 11:25039421-25039443 CTGGGGCCCATCAGTCCTACAGG - Intronic
1081530227 11:43953425-43953447 CTGGGTTCAAGCAATCCTCCTGG - Intergenic
1081797507 11:45831508-45831530 CTGGGTCCCAGCTGTGTAGCTGG - Intergenic
1082794601 11:57370109-57370131 TTGGGTCCCAGCTATGCTCATGG - Exonic
1082934584 11:58643171-58643193 CATGATCCCAGCTGTCCTTCAGG - Intronic
1083203150 11:61132130-61132152 CTGGGTCCAAGCTGGGCTGCCGG + Exonic
1083339902 11:61952203-61952225 CTGGGCTCCAGGGGTCCTCCTGG - Intronic
1083717129 11:64583894-64583916 CCGTGTCCCAGCTCTCCACCTGG + Intergenic
1083977296 11:66133607-66133629 CTGTGTTCAAGCTGTCCTCCAGG + Intronic
1084143218 11:67248343-67248365 CTTTCTCCGAGCTGTCCTCCTGG - Exonic
1084311714 11:68320553-68320575 CCGGGTTCCAGCTGTTCTCCTGG + Intronic
1084316981 11:68351301-68351323 CGGGGAGCCAGCTGACCTCCGGG + Intronic
1084323294 11:68385321-68385343 CTGGGTCTCTGCTGCCCCCCAGG - Intronic
1084345376 11:68543723-68543745 CTGGGTCCTGGCTGTCCAGCAGG + Intronic
1084417146 11:69039351-69039373 CTGGGCTCAAGCAGTCCTCCCGG + Intergenic
1084665678 11:70574955-70574977 ATGAGTCCCATCTGTCCTTCAGG + Intronic
1084905561 11:72343648-72343670 CTGGGTCAAAGTGGTCCTCCTGG - Intronic
1084908905 11:72371643-72371665 CTGGGCTCAAGCAGTCCTCCTGG + Intronic
1085769112 11:79309376-79309398 ATGGGCCCCATCTGACCTCCAGG - Intronic
1086489925 11:87348996-87349018 TTGGTTCCCAGCTATCTTCCTGG - Intergenic
1089255703 11:117192798-117192820 CTGTGTCCCTGCTTCCCTCCAGG + Exonic
1089335128 11:117717740-117717762 CTGGCACACAGCTGTCCTCGAGG + Intronic
1089613183 11:119681017-119681039 CCGAGTCCCAGTGGTCCTCCTGG + Intronic
1089736772 11:120555105-120555127 CTGCTGCCCAGATGTCCTCCAGG + Intronic
1090849638 11:130560962-130560984 CTGAGTCCCTGCTGTGGTCCAGG - Intergenic
1091537381 12:1424595-1424617 CTGGGTCTCTCCTGTCTTCCTGG - Intronic
1091558001 12:1590351-1590373 CTGGGTTCCAGCCCTCTTCCTGG + Intronic
1091628300 12:2139484-2139506 CAAGGCCCCAGCTGTACTCCAGG - Intronic
1091641289 12:2239515-2239537 CTGGGTCTCAGCTCTTTTCCTGG + Intronic
1091898511 12:4123803-4123825 CTGGGTCCCAGCAGTGGCCCAGG - Intergenic
1092856091 12:12675083-12675105 TTGGGTCCCAGCCGTGTTCCAGG + Intronic
1094199303 12:27780360-27780382 CCGGGTAGCAGCGGTCCTCCAGG - Exonic
1094619558 12:32067127-32067149 CTGGGTTCAAGCTATTCTCCTGG + Intergenic
1095509145 12:42930272-42930294 CTGCCTCCCACCTGTGCTCCTGG - Intergenic
1095985292 12:47995280-47995302 ATGGGTCCCCGTGGTCCTCCTGG - Exonic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1096519325 12:52175363-52175385 CTGGATCCCAGCAGGCATCCGGG - Intronic
1096637478 12:52970057-52970079 CTGGGTCTAAGCTGTCCCACTGG - Intergenic
1096916603 12:55039948-55039970 CTGGGGCCCAGCTGTCACCCGGG - Intergenic
1096954916 12:55516423-55516445 CTGGCTCACAGATGCCCTCCTGG + Intergenic
1097384471 12:58933435-58933457 CTGGGTCAAAGCTGGCCTGCGGG + Intergenic
1099225681 12:79966332-79966354 CAGGGACACAGCTGTCATCCTGG + Intergenic
1099510584 12:83530790-83530812 CTGGGTTCAAGCAGTTCTCCTGG + Intergenic
1100030664 12:90186328-90186350 ATAGGTTCCAGCTGTCCTCATGG + Intergenic
1100464210 12:94831194-94831216 CTGGGTTTCAGCTGTCACCCAGG - Intergenic
1100565187 12:95789236-95789258 CTGGGTGCCAGCGGCCCTCAGGG + Intronic
1101299957 12:103469056-103469078 CTGGCTCACACCTGACCTCCTGG + Intronic
1101584269 12:106070888-106070910 CCAGGGCCCAGCTGTCCACCTGG + Exonic
1102580639 12:113884599-113884621 CTGGGTGCCAGGTGTGCTCATGG - Intronic
1102677284 12:114667465-114667487 CCGGGTTCCTGCTGACCTCCCGG - Intergenic
1103018738 12:117516354-117516376 TTGTGTCCCAGCTGTGCTCCTGG - Intronic
1103434721 12:120915942-120915964 CTGGGTTCAAGCTATTCTCCTGG + Intergenic
1103621640 12:122190512-122190534 CTGGGTCAGAGCTTTCCACCAGG + Intronic
1104400996 12:128476064-128476086 CTGAGTTCCTGCTTTCCTCCAGG + Intronic
1104482212 12:129117599-129117621 CTGGGACCCAGCCTTTCTCCTGG + Intronic
1104490291 12:129188255-129188277 GCAGGTCCCAGCTGGCCTCCTGG + Intronic
1105246185 13:18652518-18652540 GTGGGGCCCAGCAGTCCTTCAGG + Intergenic
1106287928 13:28334406-28334428 CTTGGTCCCATCTCTCCTACGGG - Intronic
1108586307 13:51873029-51873051 CTGGGCCACAGCTGTCCCCTGGG - Intergenic
1110529508 13:76579866-76579888 CAGGGTGTCAGCTGTCATCCAGG + Intergenic
1111081879 13:83321908-83321930 CTCCGTCCCAGCTGTTTTCCTGG + Intergenic
1113380342 13:109798254-109798276 AGGGGTCCCAGTTGGCCTCCAGG + Intergenic
1113768177 13:112893896-112893918 CGGGGTCCCACCTGCCCCCCTGG - Intergenic
1113855014 13:113438750-113438772 CTGGGTCCAAGTGATCCTCCTGG + Intronic
1113886861 13:113665646-113665668 GTGTGTCCCAGCTGTGCCCCAGG + Intergenic
1114032139 14:18587138-18587160 CTGGGGCCCAGCGATCCACCTGG + Intergenic
1114076917 14:19166168-19166190 CTGGGGCCCAGCGATCCACCTGG + Intergenic
1114085243 14:19233400-19233422 CTGGGGCCCAGCGATCCACCTGG - Intergenic
1115136928 14:30121519-30121541 CTGGGTTCCAGCGATTCTCCTGG + Intronic
1117292073 14:54344108-54344130 CTGGGTCGCAGATGTCCACACGG + Intergenic
1118466880 14:66039177-66039199 CTGGGTCCCAGCTGGATTCTTGG + Intergenic
1118616918 14:67580232-67580254 CTGGGTACCACCTGACATCCAGG - Intronic
1119250489 14:73148837-73148859 CTGGGTTCCAGCGATTCTCCTGG - Intronic
1119452381 14:74722866-74722888 CTGGGTTCTAGTTATCCTCCTGG - Intronic
1119649312 14:76372423-76372445 CTGTGTCCCCTCTGTCCACCAGG + Intronic
1119774666 14:77240786-77240808 CTGGGGCCCAGCTGCTCTCAAGG + Intronic
1120023579 14:79556782-79556804 CTGGGCTCAAGCAGTCCTCCTGG + Intronic
1120443083 14:84562770-84562792 CTGGGACCCATCAGTCCTGCTGG + Intergenic
1121049625 14:90812003-90812025 CCAGGTCCCAGCTGTCAGCCTGG - Intronic
1121473796 14:94175335-94175357 CTGGGTCCCAGCTACAGTCCTGG - Intronic
1121769575 14:96521581-96521603 CTGAGTTCAAGCAGTCCTCCTGG + Intronic
1122414157 14:101540862-101540884 CTGGGCCCCAGTTGCCCTCAGGG + Intergenic
1202896806 14_GL000194v1_random:15108-15130 CTGGGGCCCAGGTATCCACCTGG - Intergenic
1202865769 14_GL000225v1_random:115748-115770 CTGGGTGCCCGCAGACCTCCAGG + Intergenic
1123756118 15:23398990-23399012 CTGGATCCCACCTGTCATTCGGG - Intergenic
1124250043 15:28101125-28101147 CTTGGCCGCAGCTGTCCTGCTGG - Intergenic
1124360891 15:29035919-29035941 CAGGGTGCCAGCTGTCACCCCGG + Intronic
1124579709 15:30942717-30942739 CTGTATCCCAGCTTTCTTCCTGG - Exonic
1125592596 15:40864180-40864202 CTGGCTCCCAGCAGACCTGCAGG - Intergenic
1125956985 15:43797307-43797329 CTGGTTCCTGGCTGTCCTGCTGG - Exonic
1127662691 15:61115102-61115124 CTGGATCCCTGCAGTCCTCTAGG - Intronic
1128173773 15:65535787-65535809 CTGGGTTTGAGCAGTCCTCCTGG + Intronic
1128559070 15:68652591-68652613 CTCAGTCCCAGCTGTACACCGGG + Intronic
1129298094 15:74610783-74610805 CTGGGTCCCAAGGGTCCCCCAGG + Intronic
1129320503 15:74772091-74772113 CTGGCTCCCAGCAGCCCACCTGG + Intergenic
1130553366 15:84905794-84905816 CTGGTCCCCAGCTGCCCACCTGG - Intronic
1130562045 15:84966459-84966481 CTGGGCTCAAGCAGTCCTCCTGG + Intergenic
1131173303 15:90193396-90193418 GAGGGTCCCAGCTGTCAGCCTGG - Intronic
1131848868 15:96516551-96516573 CTGAGGCTCAGCTGTCATCCTGG + Intergenic
1132151283 15:99461519-99461541 CTGGGCACCAGGTGTGCTCCTGG - Intergenic
1132553096 16:561226-561248 GTGGGTGCCAGCTATCCTCCGGG + Intronic
1132738429 16:1398823-1398845 CTGAGCCCCAGCTGTCCCCTGGG - Exonic
1132878904 16:2152597-2152619 CTGGGTTCAAGCTATTCTCCTGG - Intronic
1133185060 16:4090045-4090067 CTGTGACCCAGCTGCCCTACAGG + Intronic
1133835302 16:9362391-9362413 CTGAGCCCCAGCTGTCCACAGGG + Intergenic
1134270553 16:12729261-12729283 CTGGGTCCCAGGTATTCCCCTGG - Intronic
1134529971 16:14975362-14975384 CCGGGCCCCAGCCGCCCTCCCGG - Intronic
1135255742 16:20940289-20940311 CTGGGTTCAAGCAATCCTCCCGG + Intronic
1135502654 16:23010648-23010670 CTGGGATCAAGCTATCCTCCTGG + Intergenic
1136113057 16:28077077-28077099 CTGGGTCCTCTCTGGCCTCCTGG + Intergenic
1136289159 16:29261207-29261229 CTGGGTCTCAGCAGTCCCCGAGG + Intergenic
1136348915 16:29694701-29694723 CTCGGAGCCAGCTGTCCACCAGG - Exonic
1136568904 16:31085229-31085251 CTGGGGACCTGCTGTCCTCAAGG + Exonic
1136611795 16:31371091-31371113 CGGGCTCCCAGCTCTCCTCCAGG + Exonic
1136935981 16:34465156-34465178 CTGGAACCTAACTGTCCTCCTGG - Intergenic
1136963840 16:34883414-34883436 CTGGAACCTAACTGTCCTCCTGG + Intergenic
1137092983 16:36217891-36217913 CTGGGACCTAACTCTCCTCCTGG + Intergenic
1137433290 16:48435491-48435513 CTGGGTCCCAGGTTTCCATCAGG - Intronic
1137985762 16:53106453-53106475 CTGCCTTCCAGCTGTCCTTCGGG - Intronic
1138275469 16:55730956-55730978 GTGGGTCCCAACACTCCTCCAGG - Intergenic
1138376286 16:56566253-56566275 CTGGCTCCCATCTGTAATCCTGG + Intronic
1138550605 16:57745946-57745968 CTGCAGCCCAGCTGTCATCCTGG + Intronic
1139192459 16:64880299-64880321 CTGGGTCTCAGCAGTCCTGCTGG - Intergenic
1139712475 16:68786858-68786880 TTGGCTCCCAGCTGTTCTCTTGG + Intronic
1139866376 16:70065592-70065614 CCGGGCCCCAGCCGCCCTCCCGG + Intergenic
1139967602 16:70754416-70754438 CTGGGACCTAGCTGTCCCCGAGG + Intronic
1140462375 16:75149893-75149915 CCGGGTTCAAGCAGTCCTCCTGG + Intronic
1140512306 16:75517131-75517153 CTGGGTGGGCGCTGTCCTCCCGG - Intergenic
1141198680 16:81881005-81881027 CTGGTGCCCAGCCGGCCTCCAGG + Intronic
1141749149 16:85946709-85946731 CAGCTTCCCAGCTGGCCTCCAGG + Intergenic
1141860834 16:86715061-86715083 CTGGGTCCCAGGGTTGCTCCAGG + Intergenic
1141997144 16:87642722-87642744 CTGAGGCCCAGCCGTCCTCACGG + Intronic
1142094887 16:88234134-88234156 CTGGGTCTCAGCAGTCCCCGAGG + Intergenic
1142137510 16:88458415-88458437 CTGGGTTCCTGGTGACCTCCAGG - Intronic
1142149054 16:88504774-88504796 CTGGCTCCGAGCTGTCCTCAAGG + Intronic
1142149105 16:88504930-88504952 GTGGGGCCCAGCTCTCCTGCAGG - Intronic
1142190386 16:88714673-88714695 CCGGGGCCCTGCTGTTCTCCAGG + Exonic
1142357097 16:89606320-89606342 CTGGGTGTCAGCTCTGCTCCAGG + Intergenic
1143732386 17:8888439-8888461 CCGTGTCCGAGCTGCCCTCCAGG + Exonic
1144066009 17:11624639-11624661 CTTGGAACCAGCTGTCCCCCTGG - Intronic
1144373534 17:14616343-14616365 CTGGCTCCCACGTGTCCTCAAGG - Intergenic
1144436392 17:15246648-15246670 TTGAGTACCTGCTGTCCTCCAGG + Intronic
1144708307 17:17384392-17384414 CCGGGTTCCAGCACTCCTCCTGG + Intergenic
1144795327 17:17887497-17887519 ATGGGTCAGAGCTGTCCCCCAGG + Intronic
1144965765 17:19076521-19076543 CTGGGTCCCAGCTCTGCCCCAGG - Intergenic
1144982202 17:19175661-19175683 CTGGGTCCCAGCTCTGCCCCAGG + Intergenic
1144986021 17:19202578-19202600 CTGGGTCCCAGCTCTGCCCCAGG - Intergenic
1145266663 17:21382986-21383008 CTGCGCCCCAGCCTTCCTCCGGG - Intronic
1145303341 17:21655367-21655389 CTGGGACCCGGGTGTCCACCTGG + Intergenic
1145346697 17:22046473-22046495 CTGGGACCCGGGTGTCCACCTGG - Intergenic
1145388801 17:22438732-22438754 CTGGATCTCAGAAGTCCTCCTGG + Intergenic
1146010856 17:29193341-29193363 CTGGGCCCCATCTGTTCTCAGGG - Intergenic
1146942215 17:36851176-36851198 CTGCGTCCAGGCTGTCTTCCGGG - Intergenic
1147979128 17:44263861-44263883 CTGGGCCCCAGGGATCCTCCTGG + Intronic
1148113685 17:45162231-45162253 CCAGGTCCCAGCTGTGCTTCTGG + Intronic
1148480446 17:47956535-47956557 CTGGTCCCCACATGTCCTCCTGG - Intronic
1148549760 17:48543466-48543488 CAGGGTCGCAGATGTCCTCCAGG + Exonic
1150043479 17:61888140-61888162 CTGGGCTCGAGCAGTCCTCCTGG - Intronic
1150429615 17:65104669-65104691 CTTTGTCCCAACTCTCCTCCTGG - Intergenic
1150642550 17:66959280-66959302 ATGGAGCCCAGCTGTGCTCCAGG + Intergenic
1150672973 17:67218026-67218048 CTGGGTTCAAGCGATCCTCCTGG + Intronic
1151227670 17:72658719-72658741 CTGGGTCCCACCTGTGCACCTGG - Intronic
1151667407 17:75553229-75553251 CTGGGCCCTATCTGTCCCCCTGG + Intronic
1151687131 17:75654385-75654407 CTGGGACACAGCTGTCTTTCCGG + Intronic
1151800502 17:76376712-76376734 CTGGTTCCCAGCTTTCCTTTTGG + Intronic
1151801527 17:76382467-76382489 CCGGGCCCCAGCTCCCCTCCTGG - Intronic
1151876888 17:76871956-76871978 CTTGTTCCCTGCTGTCCCCCTGG + Intronic
1152108892 17:78346147-78346169 TTGGATCCCAGCTCTACTCCTGG + Intergenic
1152341966 17:79730560-79730582 CTGGGTGCCTGTTCTCCTCCTGG - Intergenic
1152587924 17:81197381-81197403 CTGGAGCCCTGCTGTCCTCTGGG - Intronic
1152592719 17:81221853-81221875 CTGGGTGCCTGCTGGCCTACTGG - Intronic
1152822551 17:82444736-82444758 CAGGGCCACAGCAGTCCTCCGGG - Intronic
1153230502 18:2930895-2930917 CTGGGGCCCAGCTGCCCTTCTGG - Intronic
1153799877 18:8659584-8659606 CTGGAGCCCACCTGGCCTCCGGG - Intergenic
1153995262 18:10434676-10434698 GTGGGGCCCAGCAATCCTCCAGG + Intergenic
1154442732 18:14407148-14407170 GTGGGGCCCAGCAGTCCTTCAGG - Intergenic
1154937791 18:21078553-21078575 CTGGGACCCATCAGTCCTGCTGG + Intronic
1155010179 18:21769490-21769512 CTGGTGCCCAGCAGTCATCCTGG + Intronic
1155466702 18:26143813-26143835 CTGGGTTCCAGCGATTCTCCTGG + Intronic
1156495994 18:37525385-37525407 CTGGGAGCCAGCGGTGCTCCTGG + Intronic
1157353310 18:46911034-46911056 CTGTTACCCAGCTGTCATCCTGG - Intronic
1157363019 18:47035694-47035716 CTGGGGCACAGCAGTCCACCTGG - Intronic
1158489956 18:57900988-57901010 TTGAGTCCTAGATGTCCTCCAGG - Intergenic
1159895205 18:73989671-73989693 CAGGGCCCCATCTGTCCTCCTGG + Intergenic
1159953854 18:74505962-74505984 CGCTGTCCCAGCCGTCCTCCAGG - Exonic
1160012375 18:75115861-75115883 CTGGCTCCCAGCAGACCACCGGG + Intergenic
1160909618 19:1468647-1468669 CGGGGTGCCAGCTGTGCTCCGGG + Exonic
1160917479 19:1504106-1504128 ATGGGTCCCCGCTGTCCACTGGG - Intergenic
1161216915 19:3099233-3099255 CTGGGTCCCAGCTGTCTACAGGG - Intronic
1161320129 19:3637267-3637289 CTGGGCCTCAGCTGTGCACCTGG + Intronic
1161596601 19:5154004-5154026 CTGGGTCCCAGTGGCCATCCAGG - Intergenic
1162222560 19:9190204-9190226 CTGGGTCGCAGGTTTCATCCAGG + Intergenic
1162324801 19:9992855-9992877 CTGGGGCCAAGCAGTCCTCGTGG + Exonic
1162485656 19:10959090-10959112 CTGGGCTCAAGCAGTCCTCCTGG - Intergenic
1162489979 19:10986255-10986277 CGGGGCCCCAGATGTCTTCCGGG + Exonic
1162779834 19:13001166-13001188 GTGGCTCACAGCTGTCCTCCTGG - Intronic
1162816124 19:13195862-13195884 CTGTTTGCCAGCTGGCCTCCAGG + Intergenic
1162999331 19:14356234-14356256 CCGGGACCCAGCTTCCCTCCTGG - Intergenic
1163064800 19:14785118-14785140 CCGGGACCCAGCTTCCCTCCTGG + Intergenic
1163301346 19:16448734-16448756 CTGGGTTCAAGCAGTTCTCCTGG - Intronic
1163627094 19:18396486-18396508 CAGGGGCGCAGCTGACCTCCAGG + Exonic
1164617372 19:29675100-29675122 CTGAGTCCCAGGAGGCCTCCTGG + Exonic
1164727065 19:30473110-30473132 CTGGGTTCAAGCAGTTCTCCTGG - Intronic
1165015374 19:32876525-32876547 CTGAGTGCCTGCTGTGCTCCTGG + Intergenic
1165445836 19:35856452-35856474 AGGGGTCCCAACTGTCCCCCAGG + Intronic
1165770892 19:38379546-38379568 CTGAGTCCCAGCTGTGTGCCTGG + Intronic
1165816857 19:38647844-38647866 CCCGGTCCCAGTCGTCCTCCTGG - Exonic
1166287905 19:41843716-41843738 CTGTGTCCCAGCTTTTCTGCGGG - Exonic
1166497833 19:43317003-43317025 GTAGGTCCCGGCTCTCCTCCTGG + Intergenic
1166731847 19:45063859-45063881 CTGGGTCTCCACTGCCCTCCAGG + Intronic
1166889837 19:45984179-45984201 CTGGGCTCCAGCGATCCTCCTGG + Intergenic
1167190622 19:47986508-47986530 CTGGGTTCAAGCAGTCCTCCTGG - Intronic
1167300034 19:48672841-48672863 CTGGGTCCCAGATGGACCCCAGG - Intronic
1167773862 19:51542312-51542334 CTAGGTCCCAATTGTCCTTCAGG - Intergenic
1167926676 19:52826780-52826802 CTGGGTTCAAGCAGTTCTCCTGG - Intronic
1168108799 19:54180680-54180702 CTTGCTCCCCGCTCTCCTCCCGG + Intronic
1168351283 19:55677610-55677632 CTGGGTCCCTGCTGTGTGCCAGG - Exonic
1202645455 1_KI270706v1_random:135596-135618 CTGGGTCAGAGGTATCCTCCAGG + Intergenic
926131113 2:10303599-10303621 TCGGGTCCCAGCTGTCCTCGAGG - Intronic
926329233 2:11811068-11811090 CTGGGTCCCACCTGTCCTTCTGG + Intronic
926707364 2:15846219-15846241 CTGGCTCAGAGCTGGCCTCCAGG + Intergenic
927149844 2:20189195-20189217 CTGGGCCCTAGGTGACCTCCTGG - Intergenic
927194340 2:20537464-20537486 GGGGGTCGAAGCTGTCCTCCTGG + Intergenic
927480633 2:23451298-23451320 CTGGGTCCCTACTGTGTTCCAGG - Intronic
928278875 2:29926512-29926534 TTGGGGCCCAGCTCTCTTCCTGG - Intergenic
928340991 2:30442972-30442994 CTGGGCCCCAGGGATCCTCCTGG - Intergenic
929598951 2:43193106-43193128 CTGGGTCCCAGCTGGAGACCTGG + Intergenic
932321154 2:70822973-70822995 CTGGGCCAAAGCTGTTCTCCTGG - Intergenic
932769159 2:74490854-74490876 CTGGGCCCCTTGTGTCCTCCTGG - Intronic
932781777 2:74563150-74563172 CTGGGTTCAAGCAGTCTTCCTGG - Intronic
932844430 2:75120674-75120696 CTGGGTCCTGGCTCTCCTGCTGG - Exonic
933026679 2:77268477-77268499 CTTGGTCTCAGCTGAACTCCTGG + Intronic
933720576 2:85395015-85395037 CTGGCCCCCTCCTGTCCTCCTGG - Intronic
933747619 2:85582549-85582571 CTGGGTCTCAGTTGTCCTGAGGG + Intergenic
933920586 2:87041394-87041416 CTGGGACCCATCAGTCCTGCTGG - Intergenic
933931038 2:87152392-87152414 CTGGGACCCATCAGTCCTGCTGG + Intergenic
934002411 2:87728504-87728526 CTGGGACCCATCAGTCCTGCTGG + Intergenic
935198749 2:100837400-100837422 CTGGGTTCCAGCTATTCTCCTGG + Intronic
935529753 2:104218018-104218040 CTGGGTCTCAGCTGGCCCCTTGG - Intergenic
935543819 2:104379266-104379288 CTGGGCACGAGCTGTCTTCCAGG + Intergenic
935664278 2:105496690-105496712 CTGGGATCCAGCTGCCCACCTGG - Intergenic
936362084 2:111813040-111813062 CTGGGACCCATCAGTCCTGCTGG - Intronic
937115558 2:119402659-119402681 CTGGGTTTCAGCAGCCCTCCTGG + Intergenic
937439315 2:121903193-121903215 CTGGGTGCCAGCTGTTATGCCGG + Intergenic
938491523 2:131763678-131763700 CTGGGGCCCAGGTATCCACCTGG + Intronic
938496043 2:131798664-131798686 CTGGGGCCCAGGTATCCACCTGG - Intronic
938683211 2:133712862-133712884 TGGGGTCCCAGCTGTGCTTCAGG - Intergenic
939101481 2:137899390-137899412 GTGGGGCCCAGCAGTCCTTCAGG + Intergenic
939310303 2:140467517-140467539 CTGGGTCCAAGCAATTCTCCTGG - Intronic
940991181 2:160098176-160098198 CTTGGTCCCACCTGCCTTCCAGG - Intergenic
941204331 2:162552794-162552816 CTGTGTCCCCACTTTCCTCCTGG - Intronic
943524864 2:189003997-189004019 CCAGGTCCCAGCGGTTCTCCAGG + Exonic
946334975 2:219030357-219030379 CTCGGTCCCTTCTCTCCTCCTGG - Intronic
946388632 2:219401911-219401933 CTGGGACCCTGGTGGCCTCCCGG - Intergenic
947711921 2:232321413-232321435 CTGAGGCCCAGCTGTCACCCAGG + Intronic
948425196 2:237882945-237882967 CAGGGTCCCAGCTGGTCTCAAGG + Intronic
948864568 2:240768751-240768773 CTGGGTGCCAGCTGCCTTCTTGG - Intronic
948876742 2:240833388-240833410 CCTGGACCCAGCTCTCCTCCTGG - Intergenic
1169087332 20:2835611-2835633 CTGGGGCCCAGTGGTCCACCGGG - Exonic
1170314385 20:15027644-15027666 CTGGGCTCCAGCAATCCTCCCGG - Intronic
1170324358 20:15139871-15139893 CTGGGTTGCAGCTGACCTTCTGG + Intronic
1171520858 20:25773058-25773080 CTGGGACCCGGGTGTCCACCTGG + Intronic
1171556065 20:26083433-26083455 CTGGGACCCAGTTGTTCACCTGG - Intergenic
1171556067 20:26083445-26083467 CTGGGTCCCAGGTGATCTTCAGG + Intergenic
1171750830 20:29046810-29046832 GTGGTTCCCAGCGGTCCTACAGG + Intergenic
1172152624 20:32801125-32801147 CTGTGTCCCTGCTGTCATTCAGG + Intronic
1172241040 20:33412608-33412630 CTGGCTCCCAGCTGTGCTGGTGG + Exonic
1172249658 20:33470017-33470039 CTGGGTCCCAGCCAGGCTCCTGG - Intergenic
1172275284 20:33675902-33675924 CAGGGCCCCAGCTGCCCCCCAGG - Exonic
1172738521 20:37147409-37147431 CTGGGCCCACGCAGTCCTCCCGG + Intronic
1172864212 20:38083011-38083033 TTGTTTCTCAGCTGTCCTCCAGG + Intronic
1173356623 20:42298825-42298847 CTGGGTTCCAGCCATTCTCCTGG - Intronic
1173445600 20:43115250-43115272 CTTGGTACCTGCTGTCTTCCAGG - Intronic
1173797214 20:45869948-45869970 CTGGGTTCCAGCGATTCTCCTGG - Intronic
1174104928 20:48155305-48155327 CTGGGTCCCCTCTGTCCACAGGG - Intergenic
1174413518 20:50351748-50351770 CTGAGTCGCAGCTACCCTCCAGG - Intergenic
1174441393 20:50557907-50557929 CTGGGCTCAAGCAGTCCTCCCGG + Intronic
1175199995 20:57270361-57270383 CTGGGCCCCAGCTGGCCTGCAGG - Intergenic
1175506464 20:59488837-59488859 CTGGATACCTGCTTTCCTCCTGG - Intergenic
1175967502 20:62666784-62666806 TTGGGTCCCGGCTGTGCCCCCGG + Intronic
1176262349 20:64188675-64188697 CTGGGGCCCACCTGCCCACCAGG - Intronic
1176313932 21:5224111-5224133 GTGGTTCCCAGCGGTCCTACAGG - Intergenic
1176453353 21:6884045-6884067 GTGGGGCCCAGCAGTCCTTCAGG + Intergenic
1176606432 21:8837146-8837168 CTGGGTCAGAGGTATCCTCCAGG - Intergenic
1176616494 21:9031104-9031126 CTGGGGCCCAGGTATCCACCTGG - Intergenic
1176654520 21:9577255-9577277 CTGAGACCCAGGTGTCCACCTGG - Intergenic
1176654714 21:9578151-9578173 CTGGGTCCCAGGTGATCTTCAGG - Intergenic
1176654717 21:9578163-9578185 CTGGGACCCAGGTGTACACCTGG + Intergenic
1176708635 21:10132527-10132549 CTGGGGCCCAGGTATCCACCTGG + Intergenic
1176831528 21:13749093-13749115 GTGGGGCCCAGCAGTCCTTCAGG + Intergenic
1176988749 21:15468548-15468570 CTGGGTTTCAGCTGTGTTCCTGG - Intergenic
1177017220 21:15807154-15807176 CTGGGCTCAAGCTATCCTCCTGG + Intronic
1179422972 21:41250780-41250802 CTGGGTCCCAGCTGGCGTGCTGG + Exonic
1179580866 21:42343323-42343345 CTGGCTCCCTGCGCTCCTCCAGG - Intergenic
1179876113 21:44268777-44268799 CTGGGTTCAAGCAGTTCTCCTGG + Intergenic
1180204184 21:46247180-46247202 CTGGGCTCGAGCAGTCCTCCTGG + Intronic
1180292729 22:10859793-10859815 CTGGGGCCCAGCGATCCACCTGG + Intergenic
1180356505 22:11846847-11846869 CTGGGTCAGAGGTATCCTCCAGG - Intergenic
1180381757 22:12145483-12145505 CTGGGTCAGAGGTATCCTCCAGG + Intergenic
1180391749 22:12290228-12290250 GTGGTTCCCAGCGGTCCTACAGG - Intergenic
1180407995 22:12574528-12574550 GTGGTTCCCAGCGGTCCTACAGG + Intergenic
1180456253 22:15514195-15514217 CTGGGGCCCAGCGATCCACCTGG + Intergenic
1180614621 22:17119564-17119586 CCCGGTCCCAGCAGCCCTCCAGG + Exonic
1180843404 22:18969660-18969682 CTGACTCCCAGCACTCCTCCAGG + Intergenic
1180858766 22:19064741-19064763 CTGTCTGCCAGCTGTGCTCCAGG + Intronic
1180885610 22:19241123-19241145 CTGGGTCACAGAAGACCTCCTGG + Intronic
1181276584 22:21691056-21691078 CTGGGTTCAAGCGGTTCTCCTGG + Intronic
1181436305 22:22913274-22913296 CTGGTGCCCAGCCATCCTCCAGG + Intergenic
1181463518 22:23098802-23098824 CTGGGGGCCAGCTCACCTCCGGG - Intronic
1181581941 22:23833455-23833477 CTGGGTGCCAGCAGTGCTGCTGG + Intronic
1181807465 22:25383707-25383729 CTGGGAGCCAGCTGACCTCCCGG - Intronic
1182354245 22:29715215-29715237 CTGGGACCCTGCAGTCCCCCAGG - Intergenic
1183507962 22:38219923-38219945 TTGGGGCCCAGCCGTCTTCCTGG - Exonic
1183625687 22:38999958-38999980 CTGGGTCACAGCTGTCCCCAGGG + Intergenic
1184192725 22:42905759-42905781 CTGGCTCCCTGCAGTGCTCCTGG + Intronic
1184243343 22:43223009-43223031 ATTGCTCCCAGCTGTCCTCCAGG - Intronic
1184519628 22:44985502-44985524 CTGGGTTCCAGCGATCCTCCTGG - Intronic
1184565275 22:45288127-45288149 CTGGGCCCCAGCTTTCCACTGGG - Intronic
1184597996 22:45525873-45525895 CTCGGCCCCAGGTGTCCTCCGGG - Intronic
1184790452 22:46696554-46696576 ATGGGCCCCAGATGTCCTACCGG + Intronic
1184831622 22:46992417-46992439 CTGGGCACCTGCTCTCCTCCTGG - Intronic
1185095904 22:48806044-48806066 CTGTCTCCCAGATGACCTCCTGG - Intronic
1185231863 22:49688179-49688201 CTGGGCCACAGCTGCCCTCCTGG + Intergenic
1185275245 22:49947860-49947882 CAGGCTCCCTCCTGTCCTCCGGG + Intergenic
950106109 3:10389851-10389873 CTGGGTCCCAGCTGTCCTCCTGG - Intronic
950340444 3:12239555-12239577 CTGTGTTACAGCTGTCCTGCAGG + Intergenic
950378220 3:12589669-12589691 CTGGGCTCCAGCTATCCTCTTGG - Intronic
952287183 3:31980729-31980751 CTGCGTCCCTGCTCCCCTCCAGG - Intronic
952370646 3:32719439-32719461 CAGGATTCCAGATGTCCTCCTGG + Intronic
953283409 3:41580708-41580730 CGGGCTCCCAGCTGTGCACCCGG - Intronic
954186424 3:48920207-48920229 CTGGGCTCAAGCTATCCTCCCGG + Intronic
954228691 3:49199661-49199683 CAGGATACCAGCGGTCCTCCCGG + Intronic
954661686 3:52229996-52230018 ATGTGGCCCAGCTGCCCTCCCGG - Exonic
954735626 3:52705077-52705099 CTGGGTCCCAGCTGGCTCTCCGG - Intronic
954807037 3:53226651-53226673 CTGGGCCACAGCTGCCCTCCTGG + Intronic
955237672 3:57154153-57154175 CTGGGCTCCAGCAATCCTCCTGG - Intronic
955552155 3:60096473-60096495 CTGGGTCGCAGGTTTCATCCAGG + Intronic
956222896 3:66923157-66923179 CTGGGTTCAAGCTATCCTCTTGG - Intergenic
957038305 3:75315331-75315353 CAAGTTCCCAGCTGTCCGCCAGG - Intergenic
957552958 3:81730631-81730653 CTGATTCTCAGCAGTCCTCCTGG - Intronic
958159606 3:89800529-89800551 CTGTGCTCAAGCTGTCCTCCAGG + Intergenic
959152081 3:102619717-102619739 CTGGGTTCAAGCAATCCTCCTGG + Intergenic
959670142 3:108967757-108967779 ATGGGTTCCAGCAGTCCTCCTGG - Intronic
960064436 3:113355046-113355068 CTGGGTCCCAGCAGAGCTACCGG - Intronic
960464443 3:117979648-117979670 ATGGGGCCCAGCTGTGTTCCAGG - Intergenic
960929102 3:122826160-122826182 CTGGGTTCCAGCTGAGCTCAGGG - Intronic
961001226 3:123375426-123375448 CTGGGACCCAGTGGTCCTCAAGG + Intronic
961025339 3:123550740-123550762 CTCTGTCCCAGCTGCCCACCTGG - Intronic
961086323 3:124070643-124070665 CAAGTTCCCAGCTTTCCTCCAGG - Intergenic
961364569 3:126391029-126391051 CTGGTTCCCAGGTGTGCTCCTGG - Intergenic
961550147 3:127665941-127665963 CTGGGCCCCAGGTGTGCTCATGG + Intronic
961591599 3:127985615-127985637 CTAGGTTCCAGCTGCCCACCAGG + Exonic
961714880 3:128851522-128851544 CTGGGCCGCAGCTGTCCCCTGGG + Intergenic
961754439 3:129119742-129119764 CTGTGTCCCAGCAGAGCTCCTGG - Intronic
962257147 3:133880365-133880387 CTGGGTCTCAGCTGACAACCTGG - Intronic
962280488 3:134048504-134048526 CTGGAACCCAGCTGCCCTCAAGG + Intronic
962374295 3:134847313-134847335 CCTAGTCCCAGCTGTCTTCCTGG - Intronic
962401013 3:135058698-135058720 CTGGGCCCCAGCTGTACTGCAGG - Intronic
962409358 3:135127885-135127907 ATGGGTCTCCGATGTCCTCCAGG - Intronic
962566905 3:136670077-136670099 CTGGGCTCAAGCAGTCCTCCTGG - Intronic
963436400 3:145272940-145272962 CTGTGTCCCAGTTGTCTTCTGGG - Intergenic
966392471 3:179467037-179467059 ATGGGTTCCAGCTGTCTCCCTGG + Intergenic
966873497 3:184307786-184307808 CTTGGTCACATCTTTCCTCCTGG - Intronic
967493991 3:190122395-190122417 CTGGATCCCAGCCTGCCTCCTGG + Intronic
967811519 3:193765117-193765139 CTGGGGCCCAGCTTTCCACATGG - Intergenic
968473527 4:792374-792396 CTGGGTCCCCGCTGGACTCAGGG + Intronic
968685288 4:1953883-1953905 CTGGGCTCAAGCTGTCCTCTCGG + Intronic
968973796 4:3810688-3810710 CAGGGTCCCAGCTCTGCTTCAGG - Intergenic
969196486 4:5567446-5567468 CGGGCTCCCAGATGCCCTCCTGG + Intronic
970137068 4:12936703-12936725 CTGGTTCTCTGCTGTGCTCCAGG + Intergenic
970797112 4:19926089-19926111 CAAGGACCCAGCTTTCCTCCCGG + Intergenic
971344641 4:25800988-25801010 CTGGTTCCCAGCTCTGCCCCTGG - Intronic
972072447 4:35038492-35038514 CTGGGCCCCGGCTGGCGTCCAGG - Intergenic
972517819 4:39825679-39825701 CTGGGTTCAAGTGGTCCTCCAGG + Intronic
972684371 4:41337585-41337607 CTGGGTTCAAGCCGTCCTCCTGG + Intergenic
972975501 4:44630060-44630082 CTGGGTTCAAGCAATCCTCCTGG + Intronic
973371679 4:49254013-49254035 CTGGGTCAGAGGTATCCTCCAGG + Intergenic
973389327 4:49541298-49541320 CTGGGTCAGAGGTATCCTCCAGG - Intergenic
973719185 4:53706170-53706192 CTGGCTGCCTGCTGTCCTCTAGG + Intronic
973970255 4:56206277-56206299 CTGGGTCCCAGATGTCCTTATGG - Intronic
975563514 4:75729431-75729453 CTGGGTTCAAGCAGTTCTCCTGG + Intronic
976383965 4:84434025-84434047 CCAAGTCCCAGGTGTCCTCCTGG - Intergenic
979328375 4:119404023-119404045 CTAGGCCACAGCTGCCCTCCAGG + Intergenic
979375409 4:119940752-119940774 CTGGGCCTCAGCTCACCTCCAGG + Intergenic
979808719 4:125008516-125008538 CTGGGTCACATTTATCCTCCAGG + Intergenic
982255046 4:153443455-153443477 CTGGCCCCAACCTGTCCTCCAGG - Intergenic
985111240 4:186547578-186547600 CTGGATTCCACGTGTCCTCCTGG + Intronic
985885379 5:2673397-2673419 CTGAGTCCTGGGTGTCCTCCTGG - Intergenic
985893959 5:2738505-2738527 CTTGGGCCGAGTTGTCCTCCCGG + Intergenic
985947797 5:3200413-3200435 TTGGGTCACAGCTGTCTCCCTGG - Intergenic
986333234 5:6733362-6733384 CTGGGGCCCTGCTGCCCCCCAGG - Intronic
986703272 5:10432502-10432524 CTTTGTCCCTGCTGTCCTCTTGG + Intronic
988691537 5:33577333-33577355 CTGAGTCCCAGCTGGTCTCCAGG - Intronic
990378695 5:55200050-55200072 CTGGGCCCAAGCTATCCTCCCGG - Intergenic
991031973 5:62091755-62091777 CCAGGGCACAGCTGTCCTCCTGG + Intergenic
991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG + Exonic
992484222 5:77180220-77180242 CTGGGTCCTAGCGCCCCTCCCGG - Intergenic
993480755 5:88421888-88421910 CTGGGTTCAAGCTATTCTCCTGG + Intergenic
993677718 5:90837462-90837484 CTGGGTTCAAGCTATTCTCCCGG + Intronic
996749583 5:126875246-126875268 CTGGGGCCCAGGTGTGCTTCTGG + Intronic
997370371 5:133356025-133356047 CTGGGTCCCAGGGGGCCTTCTGG + Intronic
997676044 5:135714113-135714135 CTGGGCTCCAGCTATCCACCTGG + Intergenic
998470904 5:142382968-142382990 CTGGCTCTCTGCTGTCCTTCCGG - Intergenic
998601553 5:143590564-143590586 CTGGGTCTCACCTGTCACCCAGG + Intergenic
998805235 5:145912155-145912177 CTGAGTGCCAGCTTTGCTCCAGG + Intergenic
999657709 5:153826882-153826904 CTGAGTCCCAGCTCTTCTCCAGG + Intergenic
1000117930 5:158170910-158170932 TTGGGTGCTAGCTGTCCACCTGG - Intergenic
1000324996 5:160165398-160165420 CTGGGTCACAGCTGCCCACCAGG - Intergenic
1000334521 5:160232176-160232198 CTTGGTCCCAGCACTACTCCGGG + Exonic
1001981838 5:176043537-176043559 CTGGGGCCCAGGTGTCCTTCAGG + Intergenic
1002235625 5:177800520-177800542 CTGGGGCCCAGGTGTCCTTCAGG - Intergenic
1002436705 5:179235955-179235977 CCTGGTCCCAGGTGCCCTCCTGG + Intronic
1003632750 6:7802831-7802853 CTGGGGCCCATCTGGCCTTCTGG + Intronic
1004494083 6:16146957-16146979 CTGCGTCCCAGAGCTCCTCCTGG - Intronic
1005813301 6:29531984-29532006 CTGGGTCCCTGCAGTCCTCAGGG - Intergenic
1006515215 6:34541822-34541844 CTAGGTCCTAGATGTCCCCCTGG + Intronic
1007836109 6:44674921-44674943 CAGAGGTCCAGCTGTCCTCCAGG - Intergenic
1009434388 6:63601354-63601376 CTGGGCCCAAGCAATCCTCCTGG + Intergenic
1011300229 6:85865774-85865796 CTGGGTCCCAGGTGGGATCCTGG + Intergenic
1011361180 6:86526726-86526748 CTGGGGCACATCTGTCCTGCAGG - Intergenic
1013990780 6:116252207-116252229 CTGGATCCCAGCTGCCTTCCTGG - Exonic
1014005190 6:116409834-116409856 CTGGTTCCTATCTGTCCTTCAGG - Intronic
1014210918 6:118707139-118707161 GCTGGTCCCAGCAGTCCTCCTGG + Intronic
1014433733 6:121398952-121398974 CTGAGTCCCAGCTGTACTAAAGG + Intergenic
1014945415 6:127491775-127491797 CTGGGCTCAAGCTATCCTCCTGG - Intronic
1016809365 6:148244727-148244749 CTGGGTCACAGCTGTGCTGCCGG + Intergenic
1017352551 6:153459235-153459257 CTGGGTCCCAGGTGTGCTATAGG + Intergenic
1017605790 6:156131435-156131457 CAGGGTCACAGCTGTTCCCCAGG + Intergenic
1017793422 6:157821841-157821863 CTTGGACCCAGCAGCCCTCCTGG - Intronic
1018872931 6:167796802-167796824 CTGTGTCCCGCCTTTCCTCCTGG + Exonic
1018924633 6:168197762-168197784 CTGGGGCCCTGCTGGCCCCCAGG - Intergenic
1019299613 7:296512-296534 CTGGGGGCCAGCTGTGCTCGGGG - Intergenic
1019324836 7:432935-432957 CTGGGTCCCTGCTCACCTCTGGG - Intergenic
1019660777 7:2222896-2222918 CTGGGTCCCAGGTCCCGTCCTGG - Intronic
1020116646 7:5479967-5479989 CTGCCTCCCAGCTCTCCACCTGG - Intronic
1020154097 7:5707993-5708015 GTGGCTCCCACCTGTCATCCTGG - Intronic
1020445518 7:8262616-8262638 GTGGCTCCCACCTGTCCGCCAGG - Intronic
1020762639 7:12287413-12287435 CTGGGTCTCCTCTGTCCTCTTGG + Intergenic
1022034117 7:26517770-26517792 CTGAGTGCCAGCTGTGGTCCTGG - Intergenic
1023581660 7:41690366-41690388 CTGTGTCCAAGCTGCCCTGCGGG + Exonic
1024039083 7:45535565-45535587 CTGGGTTCCACCTGTCCTTTTGG - Intergenic
1024418147 7:49132247-49132269 CTGGGTCCCCTCAGTCCTCCAGG - Intergenic
1025280919 7:57626073-57626095 CTGGGCCCCAGATGAACTCCAGG + Intergenic
1025281335 7:57628009-57628031 CTGGGTCCCAGGTGATCTTCAGG - Intergenic
1025281338 7:57628021-57628043 CTGGGACCCAGGTGTCCACCTGG + Intergenic
1025303391 7:57837486-57837508 CTGGGACCCAGGTGTCCACCTGG - Intergenic
1025303394 7:57837498-57837520 CTGGGTCCCAGGTGATCTTCAGG + Intergenic
1025728719 7:64091099-64091121 CTGGCCTCAAGCTGTCCTCCCGG + Intronic
1025825320 7:65006348-65006370 CGGGGTCCGAGCTGTCAGCCCGG + Intronic
1026188810 7:68105738-68105760 CTGGGCAGCAGGTGTCCTCCAGG + Intergenic
1026571593 7:71536256-71536278 CTGGGTCTCACCTTTTCTCCAGG + Intronic
1026881253 7:73908155-73908177 CTGGCTCCCCACTGCCCTCCAGG + Intergenic
1027187240 7:75979817-75979839 CTGAGTGCCGGCTGCCCTCCTGG + Intronic
1028474691 7:91240325-91240347 CTGGGTTCAAGCAATCCTCCTGG + Intergenic
1029274197 7:99394404-99394426 CTGGTTCTCAGCTGTCCTGCAGG - Intronic
1030481061 7:110104167-110104189 CTGGGCCCAAGCAATCCTCCAGG - Intergenic
1030621815 7:111798261-111798283 CTGGGACCCATCAGTCCTGCTGG - Intronic
1031983376 7:128145206-128145228 CAGGGTCCCAGCTTACCACCTGG + Intergenic
1032078187 7:128845979-128846001 CTGGGCTCCAGGTGTCCTGCGGG + Exonic
1032191844 7:129770145-129770167 CTGGGGTCCAGCTCTGCTCCAGG - Intergenic
1032313904 7:130815941-130815963 CTGGGTAACAGCAGTACTCCTGG - Intergenic
1033228184 7:139576954-139576976 CTGTGCCTCAGCTCTCCTCCAGG + Intronic
1034978615 7:155461830-155461852 CTGGGCCCCTCCTGTCCTCAGGG + Intronic
1034991055 7:155548454-155548476 CTGGGCTCCTGCTGTCCTCAGGG - Intergenic
1035323581 7:158050612-158050634 CGGGGCCCGAGCTGTGCTCCTGG - Intronic
1035710290 8:1708592-1708614 CTGGAACCCACTTGTCCTCCTGG - Intergenic
1035741199 8:1929848-1929870 CTCGGTCCCTGCTGTTCTCTTGG + Intronic
1036556305 8:9863202-9863224 CTGGGTCCAAGCCATCCTACTGG - Intergenic
1037699884 8:21264485-21264507 CTGTGTCCTAGCTGTTCTCTAGG + Intergenic
1038109446 8:24479326-24479348 CAGTTTCCCACCTGTCCTCCAGG + Intronic
1038459338 8:27703017-27703039 GTGGGTGCCAGCTGGCCTCTGGG - Intergenic
1039712590 8:40071411-40071433 CTGGATTCCAGTTTTCCTCCAGG + Intergenic
1040859343 8:51983282-51983304 CTGGGCTCAAGCAGTCCTCCTGG + Intergenic
1041207040 8:55510219-55510241 CAGGATCCCAGGAGTCCTCCAGG + Intronic
1041236894 8:55812257-55812279 CTGGGTCACGCCTGTACTCCTGG + Intronic
1041463157 8:58133514-58133536 CTGAGTCCCATCCTTCCTCCTGG - Intronic
1041476868 8:58277057-58277079 CTGGGCCCCAGTAGGCCTCCAGG - Intergenic
1046135931 8:110027428-110027450 CTGGGACACAGCTGTTATCCTGG + Intergenic
1046395410 8:113633391-113633413 CTGGACCCCGGCTGGCCTCCTGG + Intergenic
1046760323 8:118013548-118013570 TTGGGTCTCTGCTGTCCTCTTGG - Intronic
1048141897 8:131803011-131803033 CAGGGTCTCACCTGTCCCCCAGG + Intergenic
1048891402 8:138952250-138952272 CTGGATCCCAGCTCTTCCCCAGG + Intergenic
1049241866 8:141541873-141541895 CTGGGTCCAGGCTGTCCTGGTGG - Intergenic
1049400698 8:142425694-142425716 GGGGGTACCAGCTCTCCTCCTGG - Intergenic
1049404191 8:142444343-142444365 CTGGGTCCTCTCTGTCTTCCTGG + Intergenic
1049578617 8:143400853-143400875 CTGGGTCACAGCTGTTCCTCAGG - Intergenic
1049680768 8:143917011-143917033 CCAGGACCCAGCTGGCCTCCTGG - Exonic
1049699564 8:144003795-144003817 CTGGGCTCAAGCTATCCTCCTGG - Intronic
1050100517 9:2114254-2114276 ATGGGTCCCAGCTGTTTTCATGG + Intronic
1051445459 9:17135105-17135127 CTGGGGCCCAGCTGTCGCGCTGG - Exonic
1051604848 9:18908880-18908902 CTGGCTCCCTGCTGTCCGCAGGG - Exonic
1052821861 9:33143964-33143986 CTGGGCCCAAGCGATCCTCCTGG + Intronic
1053428580 9:38027146-38027168 CTGGGACCCTGCTGTGCACCAGG - Intronic
1053645605 9:40118023-40118045 CTGGGGCCCAGGTATCCACCTGG + Intergenic
1053760105 9:41345486-41345508 CTGGGGCCCAGGTATCCACCTGG - Intergenic
1054326620 9:63715924-63715946 CTGGGGCCCAGGTATCCACCTGG + Intergenic
1054353232 9:64038252-64038274 CTGGGTCAGAGGTATCCTCCAGG - Intergenic
1054538968 9:66257949-66257971 CTGGGGCCCAGGTATCCACCTGG - Intergenic
1054858238 9:69924008-69924030 CTGAGTGACAGCTGTGCTCCAGG - Intergenic
1055294017 9:74815580-74815602 CTGGTGCACAGCTGTCATCCCGG - Intronic
1056849285 9:90068437-90068459 CTGAGTGCCAGCTAGCCTCCTGG - Intergenic
1057753018 9:97807597-97807619 AGGGGGACCAGCTGTCCTCCAGG - Intergenic
1057787678 9:98099356-98099378 CTGGGTTCAAGCAGTTCTCCTGG - Intronic
1057994208 9:99805370-99805392 CTGGGCTCCAGCGATCCTCCTGG + Intergenic
1058468844 9:105256654-105256676 CTGGGCTCAAGCTATCCTCCTGG + Intronic
1059435812 9:114275657-114275679 CTGGGTCTCCCCTGTCCCCCTGG - Exonic
1059593236 9:115687558-115687580 CAGGGTTCCAGTTGCCCTCCAGG - Intergenic
1060389965 9:123268862-123268884 CTGCGTCCCCGCCTTCCTCCCGG + Intergenic
1060512242 9:124242547-124242569 CTGGGTCCCAGGTGAACTTCAGG + Intergenic
1061012812 9:127965470-127965492 CCAGGTTCCAGCTGTGCTCCTGG + Intronic
1061164910 9:128916646-128916668 CTGGGGCAGAGCTGGCCTCCAGG - Exonic
1061245525 9:129399575-129399597 CTGGGTCCCCGCTGGCTGCCTGG - Intergenic
1061754564 9:132803652-132803674 CTTCCTCCCAGCTGTGCTCCTGG - Intronic
1062033923 9:134374390-134374412 CTGGTCCCCAGCTGTCCTGAGGG + Intronic
1062290332 9:135791568-135791590 CTGGCTCCCAGCTGCCCTCCTGG + Intronic
1062293705 9:135811928-135811950 CTGGGTTCCAGCCGTCCTTGTGG - Intronic
1062318588 9:135979719-135979741 CTGAGTCCCTGCTGGCCCCCAGG - Intergenic
1062422111 9:136487771-136487793 CTGAGTCCCTGCTGTACCCCAGG + Intergenic
1202793396 9_KI270719v1_random:101496-101518 CTGGGGCCCAGGTATCCACCTGG + Intergenic
1203515827 Un_GL000213v1:470-492 GTGGGGCCCAGCAGTCCTTCAGG - Intergenic
1203696118 Un_GL000214v1:99077-99099 CTGGGTCAGAGGTATCCTCCAGG + Intergenic
1203738567 Un_GL000216v2:160410-160432 CTGGGTGCCCGCAGACCTCCAGG - Intergenic
1203741566 Un_GL000218v1:7367-7389 CTGGGTCAGAGGTATCCTCCAGG - Intergenic
1203701750 Un_KI270742v1:1948-1970 CTGGGTCAGAGGTATCCTCCAGG - Intergenic
1203632239 Un_KI270750v1:80713-80735 CTGAGACCCAGGTGTCCACCTGG - Intergenic
1203632435 Un_KI270750v1:81609-81631 CTGGGTCCCAGGTGATCTTCAGG - Intergenic
1203632438 Un_KI270750v1:81621-81643 CTGGGACCCAGGTGTACACCTGG + Intergenic
1203640155 Un_KI270751v1:4986-5008 CTGGGTCAGAGGTATCCTCCAGG - Intergenic
1185611687 X:1397121-1397143 GTGGCTCACAGCTGTCATCCCGG - Intergenic
1185931781 X:4211676-4211698 CGGGGTCACAGATATCCTCCTGG + Intergenic
1186334562 X:8572754-8572776 CTGGGTCCCACCTGCACTCAGGG - Intronic
1187431292 X:19227739-19227761 CTGGGTGCCTGCTGTGTTCCAGG + Intergenic
1187463451 X:19507959-19507981 CTGGGTTCCAGCAATTCTCCTGG + Intronic
1189492007 X:41477255-41477277 CTGGGTTCAAGCGATCCTCCTGG - Intergenic
1190137213 X:47807915-47807937 CCGGGTCCCAGCTCTGCTCTAGG + Intergenic
1190249017 X:48708276-48708298 CTTGGTCCCAGCCTACCTCCAGG - Exonic
1190416929 X:50189426-50189448 ATGGGACCCAGCTGTGCTCAGGG + Intergenic
1191026034 X:55914362-55914384 CTGTCTCCCAGCTGAGCTCCAGG - Intergenic
1192329138 X:70160092-70160114 CAGGGTCCCAGCTGCCCCCCTGG + Intronic
1193310539 X:80003718-80003740 CTGTGGTCCAGCTGTCCACCTGG - Intergenic
1194841747 X:98752317-98752339 CTGTGTCCCAGCTGTGTCCCAGG - Intergenic
1196135237 X:112201600-112201622 CTGGTTCTCAACTGTGCTCCCGG - Intergenic
1196741000 X:119025782-119025804 CTGGGTTCCAGCGATTCTCCTGG - Intergenic
1200215823 X:154367842-154367864 CCGGGGCACAGCTGTCCACCAGG + Exonic
1201149870 Y:11089828-11089850 CTGGGGCCCAGGTATCCACCTGG - Intergenic
1201155096 Y:11124819-11124841 CTGGGTCAGAGGTATCCTCCAGG - Intergenic