ID: 950110947

View in Genome Browser
Species Human (GRCh38)
Location 3:10418389-10418411
Sequence GAATGCAGACATTTAACATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 239}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950110947 Original CRISPR GAATGCAGACATTTAACATA TGG Intronic
901615731 1:10538106-10538128 GAAGGCAGACGATTAACAAATGG + Intronic
904375314 1:30077694-30077716 GAACTCAGACATTTAATATGTGG - Intergenic
904770298 1:32877468-32877490 TCATGCAGACTTTTAACAAAGGG - Intergenic
906493294 1:46285091-46285113 GAATGAATACATTTTAGATATGG - Intronic
907330958 1:53671276-53671298 GGATGGAGATGTTTAACATACGG + Intronic
909291202 1:73885884-73885906 CAATGAAGATATTTAACAAAAGG + Intergenic
911127387 1:94353159-94353181 GAATCCAGATATTTTACAAAGGG - Intergenic
911758277 1:101586040-101586062 GATTGCAGAAATTTAAGAAAAGG - Intergenic
911989996 1:104683840-104683862 GAATGCAGAGTGTTAAGATAGGG + Intergenic
916001863 1:160624268-160624290 GAATGCAGAAATAGAACATGAGG - Intronic
918363584 1:183783695-183783717 GAAATAAGACATTTAAAATAAGG + Intronic
918923855 1:190753260-190753282 GAATGCAGGAATCTAAAATAGGG + Intergenic
923670798 1:236039540-236039562 GAATGTGGAAATTTAAAATAGGG - Intronic
1063203032 10:3803539-3803561 GAATGCGTTCATTTCACATACGG - Intergenic
1064468141 10:15606159-15606181 GCATGCAGACATGGAACATTTGG - Intronic
1064515624 10:16144595-16144617 TAATGCAGGCTGTTAACATAGGG - Intergenic
1068547609 10:58366888-58366910 AAAAGAAGACATTTAAAATATGG - Intronic
1068631349 10:59301322-59301344 AAATGCACACGTTTAAAATATGG + Intronic
1069277946 10:66616247-66616269 CACTGCAGACATTTAACACAAGG - Intronic
1070448112 10:76528406-76528428 GAATGCATCCATACAACATATGG + Intronic
1071047824 10:81404800-81404822 GAATGGAAGCATTAAACATAAGG - Intergenic
1071159031 10:82725078-82725100 GAATACAGACGTGTAACAGAGGG - Intronic
1074521462 10:114228714-114228736 GATCCCAGACATTTAAAATATGG - Intronic
1075583316 10:123638869-123638891 GCATGCAGACAATTGACAGATGG - Intergenic
1076591756 10:131588375-131588397 GAATGCAGACTTCTCACAAATGG + Intergenic
1077638186 11:3857542-3857564 AAATCCAGTCATTTTACATAAGG + Intronic
1078492704 11:11784300-11784322 AAATCCAGACATTTGACATCAGG + Intergenic
1078494255 11:11800210-11800232 TTATGCAGACAATTAAAATATGG + Intergenic
1081071920 11:38621514-38621536 TAATGTAGGCATTTAACACATGG + Intergenic
1081419065 11:42850835-42850857 GAGTGAAGACTTCTAACATATGG + Intergenic
1082724115 11:56714707-56714729 GATTGCATATATCTAACATATGG - Intergenic
1086787493 11:90987876-90987898 GAAGTCTGACATTTCACATAGGG + Intergenic
1087176287 11:95099176-95099198 GCAAGCAGACATTTTCCATAAGG + Intronic
1089048572 11:115526051-115526073 AAAGGGGGACATTTAACATATGG - Intergenic
1089831193 11:121329795-121329817 GAATGCAAACATTTAAAAGTTGG - Intergenic
1093471796 12:19510114-19510136 CTATGCAGTCATTTAACATTGGG - Intronic
1093871796 12:24301310-24301332 TAATCCAGACACTTAAGATAAGG - Intergenic
1093894212 12:24559032-24559054 AAATGCAGACAATTTACAAATGG + Intergenic
1094143717 12:27207072-27207094 GATAGGAGACATTTTACATAAGG + Intergenic
1095520641 12:43060875-43060897 GAATGCAGAACTCTAACATCTGG - Intergenic
1096927052 12:55159688-55159710 TAAATCAGATATTTAACATAGGG - Intergenic
1098622344 12:72617600-72617622 GAATGCAGACTGTTAACATAGGG - Intronic
1098755654 12:74360051-74360073 GGATGCATATATTTAACAAAGGG + Intergenic
1099619615 12:84984534-84984556 AAGTGAAGACATTTAAAATAAGG - Intergenic
1100829096 12:98501769-98501791 TAATGCAGATATTAAACAAATGG - Intronic
1101485878 12:105159157-105159179 GAATGGCATCATTTAACATAAGG - Intronic
1106166335 13:27249955-27249977 GAATGTACACATTTAAAAAATGG + Intergenic
1106974800 13:35196924-35196946 GAATGTAGATATATGACATATGG - Intronic
1108281266 13:48864595-48864617 GAATGCTGAAATTTTAAATAGGG + Intergenic
1108813211 13:54256065-54256087 GATTTCAGACAATTAACATGAGG + Intergenic
1109642985 13:65215959-65215981 GCATGGAGTCATTTAAGATATGG + Intergenic
1111257087 13:85684530-85684552 GAAGCCAGACAGGTAACATATGG - Intergenic
1112080978 13:95970013-95970035 AAATGCTGACATTTATCATCAGG + Intronic
1115785331 14:36819217-36819239 GACTGCACACACTTAACAAATGG + Intronic
1117066504 14:52017171-52017193 GAATGCAGACACATAGCACAGGG - Intronic
1119053535 14:71394265-71394287 GAATGGAGAAATTTAAACTAAGG - Intronic
1121590651 14:95104721-95104743 GAATGCAGAGATTTTACTAATGG + Intronic
1121972478 14:98370904-98370926 GAATGTAGAGATTTGGCATAAGG + Intergenic
1122100162 14:99402137-99402159 GACTGAAGACCTTTAGCATAGGG - Intronic
1126941199 15:53767740-53767762 TAATGCTGACAATTAATATATGG - Intergenic
1127024881 15:54793186-54793208 TAATGTAGATATTTAAAATAAGG + Intergenic
1127607805 15:60607163-60607185 GCATGGAGCCATTTAGCATAGGG + Intronic
1128881424 15:71246693-71246715 GAATGTAGACTTTAAAGATAAGG + Intronic
1131786959 15:95923663-95923685 GGATGCAGATATTTACAATAAGG + Intergenic
1131890592 15:96967926-96967948 AAATGAAGATATTTAACAAAAGG + Intergenic
1133819288 16:9222277-9222299 GAATGTAAAAATTAAACATAAGG - Intergenic
1133819371 16:9222942-9222964 GAATGTAAAAATTAAACATAAGG + Intergenic
1133932578 16:10244360-10244382 GAATGCAGACCTTGACCATGGGG - Intergenic
1134865453 16:17603049-17603071 GAATGCAGACATTGAAGAGAAGG - Intergenic
1135856388 16:26014965-26014987 GAATACAGACCTTTTGCATAAGG + Intronic
1139054354 16:63163911-63163933 GAGTGGAGAAATTTAACTTAAGG - Intergenic
1139079840 16:63503324-63503346 AAAAGCAGACATTTAAAATGTGG + Intergenic
1147698973 17:42379767-42379789 CAATGCAGAGATTTATCAGAAGG + Intronic
1155354730 18:24941264-24941286 GTACACAGACATTTAACAGATGG + Intergenic
1155814816 18:30293605-30293627 GATTACAGAGATTCAACATATGG - Intergenic
1156659645 18:39331739-39331761 GAATGCAGAACTTACACATAGGG + Intergenic
1157469488 18:47977915-47977937 CAATGCAAACTTTTAAAATATGG - Intergenic
1158147926 18:54336592-54336614 CAATGCAGACATATACCATAAGG - Intronic
1159099073 18:63938355-63938377 CAATGCCAACATTTAAGATATGG - Intergenic
1159208952 18:65290674-65290696 GTATGCAGACATTTTACTAATGG - Intergenic
1160014276 18:75128490-75128512 GGATGCTGACATTTTACATCTGG - Intergenic
1160400906 18:78610829-78610851 GAATGAGGACATTTATCATATGG + Intergenic
1162454345 19:10773918-10773940 GAATGCAGAGTTTTAAAATCAGG - Intronic
1162672331 19:12267388-12267410 GAATACAGTTATTTAATATATGG + Intronic
1164412522 19:28017769-28017791 GAAGGCAGGCATTTAACAGAAGG - Intergenic
1164880740 19:31730738-31730760 TAATACACACATTTAACATGAGG - Intergenic
1165405001 19:35624411-35624433 GAATCCAGCCATTTCAGATATGG - Exonic
1165816574 19:38646144-38646166 GAAGGCAGACATTTAAACAAAGG - Intergenic
927925826 2:27012944-27012966 GGATGCAGACATTTCAGAGAAGG + Intronic
928571787 2:32616649-32616671 ATTTGCAGACATTTTACATATGG + Intronic
928754924 2:34512654-34512676 TGATGGAGACATTTAAAATATGG - Intergenic
930867425 2:56135674-56135696 GAATGCAGGCATGTACGATAGGG - Intergenic
932736754 2:74259802-74259824 GAAAGCAGCCATTGAACAGAAGG - Intronic
933061757 2:77746619-77746641 GCATCCATACAATTAACATAAGG + Intergenic
933712519 2:85337355-85337377 CAAGGCAAACATTTTACATAAGG - Intergenic
934279894 2:91603343-91603365 TAATTCAGCCATTTAACATGTGG + Intergenic
934524663 2:95044170-95044192 GAATGGAATCATTCAACATATGG - Intronic
936636262 2:114262005-114262027 GACTGTATACATTTAACATATGG + Intergenic
937380228 2:121370090-121370112 AAATGAAGACATTCAACATAGGG - Intronic
937476847 2:122223025-122223047 GAATATAAAAATTTAACATAAGG - Intergenic
937671503 2:124542368-124542390 GAAAGCAGACATCTTACAAAGGG + Intronic
939437217 2:142193499-142193521 GGATGCAGACATTTTAGTTAGGG + Intergenic
939770855 2:146315838-146315860 GAATGCAGATATTAAAAATTTGG - Intergenic
941058003 2:160810473-160810495 CAATGCAGGAATTTATCATAAGG - Intergenic
941424674 2:165327607-165327629 AAATTAACACATTTAACATATGG - Intronic
941969737 2:171336687-171336709 GCATGCAAACATCTTACATAGGG + Intronic
942988580 2:182172038-182172060 AAATGCAGACATAAAACATGAGG + Intronic
943666655 2:190616054-190616076 AACTGCAGACTTTTAACAGAAGG - Intergenic
943762233 2:191622430-191622452 GAAGCCAGGCATTTAACATTAGG - Intergenic
943785862 2:191877985-191878007 TTATGCAGACATTTAATCTATGG + Intergenic
947191514 2:227510805-227510827 TAATTCAGACATCTACCATAAGG - Intronic
1169027413 20:2382557-2382579 CAATGCTGACATTTCACAGACGG - Intronic
1169263272 20:4152850-4152872 GAATCCAAACATTTTACAGACGG + Intronic
1173262187 20:41446469-41446491 GAATGAAGACAGTGAACTTAGGG - Intronic
1173715783 20:45204228-45204250 GAATGCAGATATTGAATTTAAGG + Intergenic
1177049000 21:16208313-16208335 GAATTCAGTTTTTTAACATAGGG + Intergenic
1177584816 21:23077267-23077289 CAATGCAGAGATTTAAAAAAAGG + Intergenic
1177750237 21:25272648-25272670 CAAAGAAGACATTTAAAATATGG + Intergenic
1177859481 21:26436115-26436137 TTATGCAGACATTTAAAATAAGG + Intergenic
1178419942 21:32435360-32435382 GAAGGCAGACATTTAGGAGATGG - Intronic
949359948 3:3221067-3221089 GAATGCATACAATTGATATAGGG + Intergenic
949371876 3:3344068-3344090 GCATGAACACATTTTACATAGGG - Intergenic
949451469 3:4189899-4189921 GAAAGCAGACACTTTACATGAGG - Intronic
950110947 3:10418389-10418411 GAATGCAGACATTTAACATATGG + Intronic
950261640 3:11546470-11546492 AAATGTAAACATTTAAAATAAGG - Intronic
951040097 3:17980420-17980442 GGATTCAGACATTGAACATCAGG - Intronic
952085435 3:29814881-29814903 GAAGACAGATATTTAACACATGG + Intronic
953127761 3:40108464-40108486 GAGTGCTGACATTCAACAAATGG + Intronic
955091738 3:55758678-55758700 AAATCCAGCCATTTAATATAAGG + Intronic
955638134 3:61052769-61052791 GAATGAACACATTTATAATAAGG + Intronic
955733104 3:62008529-62008551 GATTGCAGACCTGTACCATATGG - Intronic
955794011 3:62616852-62616874 TAATGCAAACTTTTAACATTTGG - Intronic
956027793 3:65002108-65002130 GAATGCAAACATGCAACAAAAGG + Intergenic
956638363 3:71389832-71389854 GAATGCCAACATTTAACAGCTGG - Intronic
956987613 3:74720873-74720895 ATATGTAGACATTTGACATATGG - Intergenic
959194473 3:103161730-103161752 GAATACAGATGTTTAACAAACGG - Intergenic
960555565 3:119025733-119025755 GGATGTACACATTTAACATCCGG - Intronic
960730159 3:120718344-120718366 GAAGGCAGATTTTTAATATAAGG - Intronic
962091283 3:132246521-132246543 GAATGCCCACATCAAACATAAGG + Intronic
962503935 3:136027062-136027084 GAAAGCAGACATTTATGAAATGG + Exonic
963788615 3:149560176-149560198 GAATGCAAACATATGAAATAGGG + Intronic
963830834 3:150007200-150007222 GAATGGAAACATCTAACATGGGG + Intronic
966505549 3:180697312-180697334 GAATGCAGAGATGTAGCAAAAGG - Intronic
966656646 3:182365802-182365824 GAAGTCAAAGATTTAACATATGG + Intergenic
966728987 3:183134786-183134808 TATTGTAGACATTTAAAATACGG + Intronic
967329241 3:188274038-188274060 AAAAGCAGACATTTAAGAGAAGG - Intronic
968154856 3:196371790-196371812 GAATTAAGACATTTAAAAAAAGG - Intronic
968214331 3:196875469-196875491 CGATGCTGACACTTAACATAAGG - Intronic
969820715 4:9718140-9718162 GAAAGCAGACATTTAGGAGATGG - Intergenic
971189504 4:24413886-24413908 GATTAAAGACATTTAACATATGG - Intergenic
972318809 4:37953090-37953112 GCATGCAGACATTTTGCATTCGG + Intronic
972376200 4:38473237-38473259 GAATGAAAACATTTTAGATAAGG + Intergenic
976985213 4:91286579-91286601 GAATGGAGATCTTTAACATTTGG + Intronic
977310182 4:95376648-95376670 AAATACAGTCATTTGACATAAGG + Intronic
977433611 4:96965381-96965403 ATATGCATACATTTACCATAGGG + Intergenic
977479744 4:97560687-97560709 GAATCCAGAGATTCAACATCTGG + Intronic
978190534 4:105906030-105906052 GAATTCACACAATTAAAATAAGG + Intronic
983743000 4:171158659-171158681 GAACGCTGACTTTTAAAATATGG - Intergenic
984257962 4:177409731-177409753 GAAGGCAGACATTCAAGATTAGG + Intergenic
984641312 4:182167253-182167275 AAATGAAGACATTTATCAAAAGG + Intronic
985897505 5:2757516-2757538 GAATGCAGAAATTTTAAAAATGG + Intergenic
986167292 5:5285808-5285830 GAATGCAGATATCTAATATATGG - Intronic
986365459 5:7024309-7024331 GAATGAAACCATTAAACATAGGG - Intergenic
986472806 5:8092938-8092960 GAATGCAGATATTTAACAGAGGG - Intergenic
987484345 5:18505014-18505036 TAATGCATTCACTTAACATATGG - Intergenic
988022328 5:25637055-25637077 GAGTGCAGACATATTACATTGGG + Intergenic
989010360 5:36864675-36864697 GAATGCAATCATATAACATATGG + Intergenic
989780859 5:45263063-45263085 AAATGGAGATATTTAACATGAGG + Intronic
990219415 5:53571277-53571299 AAATGCAGTCATATAATATATGG + Intronic
990398920 5:55416715-55416737 GAATGCAGCATTTTAAAATATGG - Intronic
991933896 5:71783057-71783079 AAAAGCAGACGTTTAACACAAGG - Intergenic
992386236 5:76287221-76287243 AAAGGCAGACATTTCACACATGG + Intronic
993405101 5:87501713-87501735 TAATGCAAACATTAAAAATAAGG + Intergenic
993649450 5:90501295-90501317 GAATGCAGAATTTTGAGATATGG + Intronic
993878034 5:93330893-93330915 AAATGGAGACATTAAACATTAGG - Intergenic
994504995 5:100631260-100631282 GGATGTAGACATTAGACATAAGG - Intergenic
995684157 5:114752985-114753007 GAATGCAGTCTTTAAACAGAAGG - Intergenic
995935269 5:117503446-117503468 GAAAGCAAACAATTTACATAGGG - Intergenic
996037460 5:118774201-118774223 GAATTCAGTGAGTTAACATAGGG + Intergenic
996417400 5:123225050-123225072 TTATGCAGCCATTTAAAATAAGG + Intergenic
996468898 5:123836575-123836597 GCATGCAGACACTTAAAACAGGG - Intergenic
996476177 5:123924205-123924227 GCAGACAGACTTTTAACATAAGG + Intergenic
997779063 5:136638863-136638885 CATTGCAGACATCTAACAGATGG - Intergenic
997865112 5:137455159-137455181 GAATGCACCCATTTATCATTGGG + Intronic
998506716 5:142678336-142678358 ATATGCAGACTTTTTACATACGG + Intronic
999102690 5:149039579-149039601 CAATGTAGATATTTAACACATGG - Intronic
1000657842 5:163903336-163903358 AAATCCAGTCATTTAACATTAGG + Intergenic
1001723201 5:173873566-173873588 GAATATACACATTTAAAATACGG - Intergenic
1002512383 5:179730910-179730932 AAAAGCAGACACTTAACACAGGG - Exonic
1007046184 6:38776654-38776676 GAATGCAGGCATAAAGCATAAGG - Intronic
1007089965 6:39177777-39177799 GAATGCATAAATATTACATAAGG - Intergenic
1007542302 6:42659189-42659211 GAATGTATATATTTAACACATGG - Intronic
1009798198 6:68499120-68499142 GAGTGCAGACATTGCATATATGG - Intergenic
1010094223 6:72020853-72020875 GAATGCTCACATTTAAAATGTGG - Intronic
1010474017 6:76263845-76263867 GAATGTGGACATTTGACATTTGG + Intergenic
1011989687 6:93498836-93498858 CAATGCAAAAATTTGACATACGG - Intergenic
1011991798 6:93529917-93529939 GAATGAAGACATTAAGTATAAGG + Intergenic
1012111448 6:95240695-95240717 GAATGAACAGATATAACATATGG + Intergenic
1012743083 6:103045614-103045636 GAATGCAGAGGTAGAACATAGGG + Intergenic
1012850023 6:104435400-104435422 GAATGCAAACTTTTAAGACATGG + Intergenic
1013035747 6:106380711-106380733 GAATTCAGTCTTTTATCATAGGG + Intergenic
1013821623 6:114160390-114160412 GAAGCCAGTCATTTAAGATAAGG + Intronic
1013879714 6:114881983-114882005 GAATGCAGACTTTTTATTTAGGG - Intergenic
1015925354 6:138304249-138304271 AAATGTAGTCATATAACATATGG - Intronic
1016710536 6:147166124-147166146 GAATGCATATATTTATCAGAAGG - Intergenic
1017135608 6:151144682-151144704 GAATGCAGAAATTTTACAGAGGG - Intergenic
1018841193 6:167518342-167518364 GGATGTAGTCAGTTAACATAGGG + Intergenic
1019871114 7:3762664-3762686 GCATGCAAATATTTAACAGAGGG + Intronic
1020384202 7:7580143-7580165 GAATGCAGTCATTTAATTTCAGG - Intronic
1020634647 7:10682054-10682076 TAATGAAGACTTTTAAGATATGG - Intergenic
1021855632 7:24852483-24852505 GGAGGCAGACATGTAACTTACGG + Exonic
1025263732 7:57439398-57439420 CAATGCAGACATTTAACTGGGGG + Intergenic
1025785590 7:64640629-64640651 CAATGCAGATATTTATCACAAGG - Intergenic
1026143851 7:67728643-67728665 GAATGCAACCATTTACCACATGG - Intergenic
1027129670 7:75582007-75582029 GAATGCTGACACTTCTCATAAGG - Intronic
1028817444 7:95163468-95163490 GGTTGCAAGCATTTAACATAAGG - Intronic
1028915512 7:96254486-96254508 AAATGAAGACATTTATTATAAGG - Intronic
1032763244 7:134964765-134964787 GAGTGCAGAAATTTAAAATGAGG + Intronic
1034702355 7:153107617-153107639 GAATGTAAACTTTTAACAAAAGG + Intergenic
1035927049 8:3739823-3739845 GAATGCAGACATTTTACATTTGG + Intronic
1036976264 8:13416458-13416480 GAGTGCAGACATACAAAATATGG + Intronic
1037156953 8:15713401-15713423 GAAAGCTGACAATAAACATAAGG + Intronic
1038302313 8:26364040-26364062 GTATATATACATTTAACATAAGG - Intronic
1038435673 8:27534274-27534296 GAATGGAGACATTGATCATCTGG - Intronic
1039597706 8:38805776-38805798 GAGTGCCGACATTGAACATCTGG + Intronic
1039629767 8:39097953-39097975 GAAAGCAGACAATCAACACATGG - Intronic
1040678917 8:49785868-49785890 GAATACACATATTTAACATCTGG + Intergenic
1042895560 8:73663449-73663471 GACAGCAGAAAATTAACATAGGG - Intronic
1043807668 8:84693018-84693040 GAAGTTAGACATTTAAAATAAGG - Intronic
1044644806 8:94428432-94428454 GAATACAAACATTTTATATAAGG - Intronic
1046240285 8:111481431-111481453 AAATGCATATATTTTACATAAGG - Intergenic
1048657914 8:136562867-136562889 CAATGGAGACATTTAAGAGAGGG - Intergenic
1050634083 9:7591745-7591767 GAATGAAAACAGTTAACAAATGG + Intergenic
1050666161 9:7938837-7938859 GAATATAGCCATATAACATAGGG - Intergenic
1051360109 9:16274765-16274787 GGCTGCAGACGTTTAACAGATGG + Intronic
1052573173 9:30255952-30255974 GAATGCAGTCATATAATATGTGG - Intergenic
1055668465 9:78575756-78575778 GAATGCATACATTTGAGAAAGGG - Intergenic
1057399891 9:94714061-94714083 GTATGCAGGCATTTAACTTGGGG + Intergenic
1186108952 X:6235746-6235768 AAAAGGAGACATTTAACATGGGG + Intergenic
1186137953 X:6539425-6539447 GACTCCAGACTTCTAACATAAGG + Intergenic
1186315725 X:8368024-8368046 GATTGCAGACTTTTGATATATGG + Intergenic
1186712656 X:12216319-12216341 GCATCCAGACTTCTAACATAGGG + Intronic
1187988668 X:24845199-24845221 GGATCCAGATATTTAACACAAGG + Intronic
1189046349 X:37595778-37595800 GAATGCAAGCTTTAAACATAAGG - Intronic
1189541618 X:41997473-41997495 AAATGCAGAAAATAAACATATGG - Intergenic
1191212736 X:57906301-57906323 TAATGGAGACATTTTATATAAGG - Intergenic
1191896053 X:65994579-65994601 GAATTCAGACCTTGAACTTATGG - Intergenic
1191987545 X:66998827-66998849 GACAGCAGACATTTTACAAAAGG - Intergenic
1192690246 X:73354653-73354675 GGATGCAGACACTTAACTGAAGG - Intergenic
1193220362 X:78918168-78918190 GAATGGAATCATTTAACACATGG + Intergenic
1193648876 X:84105301-84105323 GAATGCTCACTTTTCACATAAGG - Intronic
1194589650 X:95783814-95783836 CACTGCAGACATTTAAGATTCGG + Intergenic
1196481007 X:116148342-116148364 GAATTCAGAATATTAACATAAGG - Intergenic
1196580869 X:117377507-117377529 GAATGCAATCCTTTAAAATACGG - Intergenic
1196749540 X:119102712-119102734 AAATGCTGGCATTTAACATTTGG - Intronic
1198948067 X:142037835-142037857 GAAGGCACACATTTAACAGATGG - Intergenic