ID: 950113338

View in Genome Browser
Species Human (GRCh38)
Location 3:10434684-10434706
Sequence CTTGACAGGGCCTGGCCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 205}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950113338_950113350 16 Left 950113338 3:10434684-10434706 CCCCATGGCCAGGCCCTGTCAAG 0: 1
1: 0
2: 0
3: 21
4: 205
Right 950113350 3:10434723-10434745 AGCCTCCAACCCCTGGGTCTGGG 0: 1
1: 0
2: 2
3: 78
4: 654
950113338_950113348 10 Left 950113338 3:10434684-10434706 CCCCATGGCCAGGCCCTGTCAAG 0: 1
1: 0
2: 0
3: 21
4: 205
Right 950113348 3:10434717-10434739 GCTGACAGCCTCCAACCCCTGGG 0: 1
1: 0
2: 2
3: 18
4: 293
950113338_950113347 9 Left 950113338 3:10434684-10434706 CCCCATGGCCAGGCCCTGTCAAG 0: 1
1: 0
2: 0
3: 21
4: 205
Right 950113347 3:10434716-10434738 GGCTGACAGCCTCCAACCCCTGG 0: 1
1: 0
2: 1
3: 25
4: 264
950113338_950113349 15 Left 950113338 3:10434684-10434706 CCCCATGGCCAGGCCCTGTCAAG 0: 1
1: 0
2: 0
3: 21
4: 205
Right 950113349 3:10434722-10434744 CAGCCTCCAACCCCTGGGTCTGG 0: 1
1: 0
2: 8
3: 50
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950113338 Original CRISPR CTTGACAGGGCCTGGCCATG GGG (reversed) Intronic
900472891 1:2863360-2863382 CATGAGGGGTCCTGGCCATGTGG + Intergenic
907215937 1:52864060-52864082 CACGCCAGGGCCTGGCCAAGGGG + Exonic
907421077 1:54347825-54347847 CTTCAGAGGGCATGGCCCTGCGG + Intronic
907710178 1:56873473-56873495 GTTGACAGAGCATGGACATGAGG - Intronic
912562197 1:110559096-110559118 CTTGCCAGGGTCTGGGCAGGAGG + Intergenic
912998341 1:114554200-114554222 CTAGACAGGGTTTTGCCATGTGG - Intergenic
913166878 1:116196003-116196025 TCTGACAGAGACTGGCCATGGGG - Intergenic
916552967 1:165866674-165866696 GTTGCCAGGGCCTGGGGATGAGG - Intronic
917444123 1:175092309-175092331 CTCCAGAGGCCCTGGCCATGGGG + Intronic
918011058 1:180586943-180586965 CTTCAAAGCCCCTGGCCATGAGG - Intergenic
921261907 1:213392040-213392062 CTTAGCAGGGCTTGGCCATAGGG + Intergenic
923203875 1:231739421-231739443 CCTGCCAGGGCCTGGGGATGAGG - Intronic
923227963 1:231956855-231956877 CTACACAGGGCCTCTCCATGTGG + Intronic
923270556 1:232351852-232351874 GTAGACACAGCCTGGCCATGAGG - Intergenic
923362656 1:233226809-233226831 CTTGACTGGGTGTGGGCATGGGG - Intronic
923547533 1:234933686-234933708 CTTGGCAGAGCCTGGCCCTTGGG - Intergenic
923567897 1:235090480-235090502 CTGCACAGGGCCTGGGGATGTGG - Intergenic
1064660455 10:17602356-17602378 CATGACAGGGCCGGGCGAGGTGG - Intronic
1067237825 10:44466597-44466619 CTGCACTGGGCCTGGTCATGAGG + Intergenic
1067275173 10:44827697-44827719 CCTGACAGGGCCTGGCTCTCTGG + Intergenic
1072683277 10:97521787-97521809 CATGCCAGAGCCTGGCCAGGTGG - Intronic
1079307266 11:19334263-19334285 CTTTCCAGGGACTGGCCTTGGGG + Intergenic
1081827502 11:46071126-46071148 CTTTGCAAGGCTTGGCCATGTGG + Intronic
1086989339 11:93286322-93286344 CTGGACAGTGGCTGGCCATGAGG - Intergenic
1088804758 11:113342002-113342024 CTTTCCAGGGCCTGGCCTTTGGG - Intronic
1095961018 12:47834341-47834363 CTAGACAAGGCCAGGCCCTGCGG + Intergenic
1100366877 12:93929682-93929704 CATGACTGGGCTTGGCCATTTGG - Intergenic
1100922120 12:99499954-99499976 CTTGACAGGCACTGGCTTTGGGG - Intronic
1101445429 12:104733934-104733956 TTTGCCAGGGCTGGGCCATGGGG - Intronic
1103596382 12:122026713-122026735 GGTGACAGGGACTAGCCATGAGG + Intronic
1104182037 12:126391016-126391038 CTTGGCAGGTCCTGGCCAGGTGG + Intergenic
1104360429 12:128128081-128128103 GTTGCCAGGGCCTGGCAGTGGGG + Intergenic
1104962715 12:132495796-132495818 CCAGACAGGGCCTGGACAGGTGG - Intronic
1105517288 13:21102049-21102071 CCTGACAGGGAGAGGCCATGGGG + Intergenic
1105763429 13:23534140-23534162 GTTGCCAGGGGCTGACCATGTGG - Intergenic
1106195779 13:27492815-27492837 CTTGACTTGGGCTGGCCAGGTGG + Intergenic
1113437377 13:110303812-110303834 CTTGCCAGGTGCTGGCCATGCGG - Intronic
1113797315 13:113066006-113066028 CTGGACGGGGCCGGGACATGAGG + Intronic
1119037289 14:71241206-71241228 CATGCCAGGGCCTGACCCTGAGG - Intergenic
1119627836 14:76196983-76197005 CAGCTCAGGGCCTGGCCATGTGG - Intronic
1119656780 14:76422831-76422853 ACTGACAGGGCCTGGGCATGAGG - Intronic
1119884673 14:78130222-78130244 CTTGCCAGGGCCTGTCCTAGGGG + Intergenic
1121210874 14:92207306-92207328 CTGGGCAGGGCCAGGCCAAGGGG - Intergenic
1121311003 14:92934942-92934964 CTTGGCAGGTCCTGGCCAGATGG + Exonic
1121552804 14:94815035-94815057 CATTCCAGGGCCTGGCCAGGAGG + Intergenic
1121890619 14:97587172-97587194 CTTGATAGGGGCTGGGGATGGGG - Intergenic
1122115998 14:99527579-99527601 CTGGACAGGGCCTGGGACTGGGG - Intronic
1122149755 14:99718502-99718524 CTGGCCAGGGCCTGGCAGTGAGG + Intronic
1123115927 14:105894029-105894051 CTGTCCAGGGCCTGGCCCTGCGG + Intergenic
1123117954 14:105903139-105903161 CTGTCCAGGGCCTGGCCCTGCGG + Intergenic
1202839646 14_GL000009v2_random:110091-110113 CTAGTCACGGACTGGCCATGTGG - Intergenic
1202909020 14_GL000194v1_random:100231-100253 CTAGTCATGGACTGGCCATGTGG - Intergenic
1124011993 15:25846136-25846158 GTTGCCAGGGGCTGGGCATGGGG + Intronic
1124017824 15:25892758-25892780 CCTGGCAGGGCCTCTCCATGAGG - Intergenic
1127581327 15:60341722-60341744 CTTGACTGGGCCTGGGAATGGGG - Intergenic
1129251995 15:74314310-74314332 CACCACAGGGCCTGGCCAAGTGG + Intronic
1130320617 15:82837826-82837848 GTTCCCAGGGCCTGGGCATGAGG + Intronic
1130651583 15:85765012-85765034 GTTGACAGGGCAGGGCCAGGTGG + Intronic
1132614413 16:833086-833108 CATGACAGGGCCAGCCCAAGAGG - Intergenic
1133272912 16:4619412-4619434 CTTCACATGGCCAGTCCATGGGG + Intronic
1134186333 16:12087966-12087988 CTGCACAGGGTCTAGCCATGAGG - Exonic
1136041564 16:27583555-27583577 CATGAAAGTGCCAGGCCATGGGG + Intronic
1136228743 16:28875189-28875211 CCTGGGAGGGCCTGGCCCTGTGG + Intergenic
1136279288 16:29198595-29198617 GATCACAGGGCCTGGCCATCAGG + Intergenic
1142005417 16:87687506-87687528 CATGAAGGAGCCTGGCCATGCGG + Intronic
1142474824 17:182496-182518 CTGCACAGGGCCTGGTCAGGAGG + Intergenic
1142869107 17:2809119-2809141 CATGGCAGGGACTGGCCAGGAGG - Intronic
1143770720 17:9166819-9166841 CTTTACAGGGCCTGGGCAGGGGG + Intronic
1144726924 17:17506804-17506826 CCTCCCAGGGCGTGGCCATGGGG - Intronic
1145002637 17:19315897-19315919 GTTGCCAGGGCCTGGGTATGCGG - Intronic
1145268378 17:21391473-21391495 CATCACAGGGGATGGCCATGAGG - Intronic
1145883378 17:28367336-28367358 CTACAGAGGGCCCGGCCATGTGG + Exonic
1145943830 17:28758746-28758768 GTTGGCAGGGCCTGGCTTTGTGG - Exonic
1146258964 17:31409432-31409454 CCTGACCAGGCCTGGCCAAGTGG - Intronic
1146845895 17:36181980-36182002 CAGGACAGGGCCTGGTCAGGAGG - Intronic
1146895129 17:36535250-36535272 CCTGATAGGGCCTCGCCGTGAGG + Intronic
1147820351 17:43237853-43237875 CTTGAGAAGGCCTGGCCACGAGG - Intergenic
1149849094 17:60024910-60024932 CAGGACAGGGCCTGGTCAGGAGG - Intergenic
1149861074 17:60121614-60121636 CAGGACAGGGCCTGGTCAGGAGG + Intergenic
1151362220 17:73595770-73595792 CTTGCCAGGGCCTGCCGGTGAGG - Intronic
1151599554 17:75097876-75097898 CCTGCCATGGACTGGCCATGTGG - Intronic
1152296726 17:79471725-79471747 CTGCACACGCCCTGGCCATGGGG - Intronic
1152331222 17:79674409-79674431 CAAGACAGGGCTTGGTCATGTGG + Intergenic
1152532079 17:80924604-80924626 CTCCCCAGGGCCTGGCCAGGAGG - Intronic
1153415007 18:4836659-4836681 ATTCACAGTGCCTAGCCATGTGG - Intergenic
1155053631 18:22167990-22168012 CGGGACAGGGCCTGGCAGTGCGG - Intergenic
1155547931 18:26934023-26934045 CGTGAATGGGCCTGGCCAGGTGG + Intronic
1156721200 18:40071869-40071891 CTGAAAAGGGCCTGGCCATTTGG + Intergenic
1157595383 18:48860861-48860883 CTTGGCAGGCCCTGGTCCTGGGG + Exonic
1158302157 18:56064359-56064381 CTTCCCAGGCTCTGGCCATGGGG + Intergenic
1160439555 18:78878966-78878988 CTTCCCAGGGCCTTCCCATGTGG - Intergenic
1161163255 19:2772213-2772235 TCAGACAGGGCCTGGCCAAGAGG + Intronic
1162307911 19:9886650-9886672 CATGACAGGGGCTGCACATGTGG - Intronic
1163129695 19:15264836-15264858 CAAGACAGGGCCTGGCTTTGGGG - Intronic
1163251526 19:16128809-16128831 CTAGTCAGGGCCTGGCCCTGGGG + Intronic
1163810024 19:19425339-19425361 TTTGACTGGTCCTGGCCATTCGG + Intronic
1164250484 19:23470866-23470888 GGGGCCAGGGCCTGGCCATGGGG + Intergenic
1165469100 19:35993153-35993175 ATTGACAGGCCCTGGGCAGGAGG + Intergenic
927640859 2:24844430-24844452 CCTGACAAGGCCTGGGCAGGGGG + Intronic
929160211 2:38824335-38824357 GTTGCCAGGGGCTGGACATGAGG + Intronic
929760308 2:44801419-44801441 CTTGACTGGGCCTGACCCGGCGG - Intergenic
931450389 2:62363298-62363320 CTTCACAGTGCCTGTCCAGGAGG + Intergenic
933684652 2:85133541-85133563 TTTGACAGGGCGTGGCCCCGCGG - Exonic
936068735 2:109351255-109351277 CTTGGCAGGGCCTTGCAGTGAGG + Intronic
936072500 2:109380681-109380703 GTTGTCAGGGCCTGGCGAAGGGG + Intronic
937094312 2:119225482-119225504 CTTGACCTGGCCTGGTCCTGGGG - Intronic
937132385 2:119523457-119523479 CTTGCCAGGACCTGGCTTTGGGG + Intronic
937716809 2:125040991-125041013 ATTGGCAGGGCCCGTCCATGTGG - Intergenic
938713224 2:133993334-133993356 TTTGCCAGGGCCTGGCCAGCAGG - Intergenic
943879114 2:193116212-193116234 CTTGACATGGCCTGGCGCGGTGG + Intergenic
946478532 2:220032046-220032068 ATAGACATGGCCAGGCCATGTGG - Intergenic
948302972 2:236922214-236922236 CCTGCCAAGGCCTGGCCAGGAGG - Intergenic
948485359 2:238277529-238277551 CTCGACAGGGCCTCGTTATGAGG + Intronic
948908589 2:240991753-240991775 CCTGACAGGGCCTGGCCCCGGGG - Intronic
1169200249 20:3705822-3705844 CCTGCCAGGACATGGCCATGTGG + Exonic
1170648002 20:18213702-18213724 CTTACCAGGGCCTGGCCCTGGGG - Intergenic
1170801115 20:19591047-19591069 CCTGTCAGGACCTGGCCTTGAGG - Intronic
1171422036 20:25024080-25024102 CTAGACAGGGCCTGGCCACATGG - Intronic
1171488573 20:25500879-25500901 CTGATCAGGTCCTGGCCATGTGG - Exonic
1172495311 20:35378324-35378346 TTTGAAAGGGCCTGGCAAGGTGG + Intronic
1174361992 20:50034738-50034760 CTCCCCAGGGTCTGGCCATGAGG - Intergenic
1175564563 20:59962801-59962823 CTTGACAGAACTTGGACATGGGG + Intronic
1175804357 20:61819195-61819217 CCCTACAGGGCCTGGCCGTGGGG - Intronic
1179518730 21:41928170-41928192 CCTGACAGGGCCAGGCCACTTGG + Intronic
1180378771 22:12118517-12118539 CTAGTCATGGACTGGCCATGTGG + Intergenic
1181370157 22:22409381-22409403 CCTGTCAGGGCCAGGCCAGGTGG - Intergenic
1181475552 22:23165788-23165810 CTTGGCAGGGCCTTGCCACATGG + Intergenic
1182551744 22:31104476-31104498 CTTGCCACTGGCTGGCCATGCGG - Exonic
1183089757 22:35513807-35513829 ATGGACAGGGCCAGCCCATGGGG + Intergenic
1184235692 22:43181960-43181982 CTTGTTAGGGCCTGGCAATCAGG + Intronic
1184292172 22:43503246-43503268 CAGGCCAGGGCGTGGCCATGTGG - Intronic
1184715964 22:46281963-46281985 CCTTACAGGGCCTGGTCAGGAGG + Intronic
1184889013 22:47368233-47368255 CTTGGCAGGTGCTGGCCACGTGG + Intergenic
1185391486 22:50563687-50563709 CTTGACAGGGCTTGGTAATGTGG + Intergenic
950113338 3:10434684-10434706 CTTGACAGGGCCTGGCCATGGGG - Intronic
950509026 3:13414566-13414588 GTTGGCAGGGCGGGGCCATGTGG - Intronic
950791947 3:15479079-15479101 GATGACTGGGCATGGCCATGTGG + Intronic
953409826 3:42684445-42684467 CCTGAGACTGCCTGGCCATGGGG - Intergenic
954447151 3:50552952-50552974 CCTGAGAGGGGCTGTCCATGGGG - Intergenic
954606576 3:51915419-51915441 TGTGACTGGGCCTGGCCTTGGGG - Intergenic
954658595 3:52213643-52213665 GTTGACAGGGGCTGGGGATGGGG - Intronic
954762692 3:52888257-52888279 CTTGCCAGGGCTTTGCCTTGGGG - Intronic
958159021 3:89792252-89792274 GATGACAGGGGCTGGCCATGAGG - Intergenic
960882780 3:122362725-122362747 CTTTACAGGGCCAGGCGAGGTGG - Intronic
964939016 3:162131524-162131546 CTTGGCAGGTCCTGGTCATGTGG + Intergenic
965671052 3:171148211-171148233 CTTGACAGTGCTTAGCCATGGGG - Intronic
967548694 3:190763733-190763755 CATGACAGCACCAGGCCATGAGG - Intergenic
969817454 4:9697064-9697086 CTTGACAGGGCCAGGCGCGGTGG + Intergenic
969824612 4:9747592-9747614 CTTGGCAGGTCCTGGGAATGAGG - Intergenic
971028401 4:22610725-22610747 CGTGAATGGGCCTGGCCAGGTGG + Intergenic
972247382 4:37259658-37259680 CTTGACAGGGCCTCACCTAGAGG + Intronic
974026478 4:56737554-56737576 TTTGCCAGGGCCTTGCCATGAGG - Intergenic
975272325 4:72450328-72450350 GGTGCCAGAGCCTGGCCATGTGG - Intronic
975313085 4:72925256-72925278 CTTAACTGGTGCTGGCCATGGGG - Intergenic
1202760388 4_GL000008v2_random:103987-104009 CTAGTCATGGACTGGCCATGTGG + Intergenic
986112214 5:4730698-4730720 CTGGAGAGTCCCTGGCCATGTGG - Intergenic
987299100 5:16581040-16581062 CTTGAGAAGGCCTGAACATGAGG - Intronic
987387164 5:17341079-17341101 CTAGAAAGGGCTTGGTCATGGGG + Intergenic
988919508 5:35927299-35927321 CATGACATGGTCTGGCTATGGGG - Intronic
990586244 5:57214066-57214088 TGTGACAGGGACTTGCCATGAGG + Intronic
997363768 5:133312290-133312312 CAGGCTAGGGCCTGGCCATGTGG - Intronic
997510484 5:134450482-134450504 CTTGACTCTGCTTGGCCATGGGG - Intergenic
998182815 5:139957103-139957125 CTTGAGAGGGCCTGGCCAGCTGG - Intronic
999173920 5:149618346-149618368 CTGTGCAGGGCCTGGCCTTGGGG - Intronic
999489987 5:152040201-152040223 CTTGACCTGGCCTCTCCATGTGG + Intergenic
1001410361 5:171507117-171507139 CATGACAGGCACTGGGCATGTGG - Intergenic
1001596955 5:172904686-172904708 CTTGGCAGGCCCCTGCCATGGGG + Intronic
1002858231 6:1056715-1056737 CTTGACAGAGCCAGGACATGCGG + Intergenic
1007172196 6:39871695-39871717 GATCACAGGACCTGGCCATGGGG - Intronic
1009194182 6:60664795-60664817 CTTGACAGGACCTGGGGAAGAGG + Intergenic
1009993694 6:70876126-70876148 CTTGACATGGCCTGGGTAAGAGG + Intronic
1010058493 6:71592475-71592497 CTTGGCAGGGCCTGGAAAAGAGG + Intergenic
1011177560 6:84581599-84581621 CAAGAGAGGGCCTGGCTATGGGG - Intergenic
1011497711 6:87952794-87952816 ATTGACAGGGGCTGGCCGGGCGG - Intergenic
1014213472 6:118730846-118730868 GTTGACCTGGCCTCGCCATGTGG + Intergenic
1018720093 6:166565713-166565735 CTGGACAGAGCCTGGACCTGGGG + Intronic
1021215711 7:17913125-17913147 CTTGGCAGGGACTGCCCCTGAGG + Intronic
1022701966 7:32769736-32769758 CTACACAGTTCCTGGCCATGAGG - Intergenic
1022906208 7:34859897-34859919 CTACACAGTTCCTGGCCATGAGG - Intronic
1023660882 7:42469756-42469778 CTTGTCAGTGCCTGGGTATGTGG - Intergenic
1025190367 7:56891494-56891516 CCTATCAGGGCCTGTCCATGGGG + Intergenic
1025681572 7:63685426-63685448 CCTATCAGGGCCTGTCCATGGGG - Intergenic
1028506635 7:91578720-91578742 CATGACAGAGCTTGGACATGTGG - Intergenic
1034276673 7:149826819-149826841 CTGGTGAGGGCCTGGCCCTGGGG + Intergenic
1035397842 7:158546747-158546769 CTTGGCAGGCGCTGGCCGTGGGG - Intronic
1036380737 8:8234856-8234878 CTTGACAGGGCCAGGCGCAGTGG + Intergenic
1036711563 8:11082739-11082761 TTTGACAGAGCCTGGCCACTGGG + Intronic
1037815820 8:22111255-22111277 CATGATAGGGCCTGGCCCAGCGG - Intergenic
1037892174 8:22629206-22629228 CTTGCCAGGGCCGGGTAATGAGG - Intronic
1037951080 8:23019145-23019167 GCTGAGAGGGCCTGGCCCTGGGG + Intronic
1037966038 8:23134846-23134868 GCTGAGAGGGCCTGGCCATGGGG + Intergenic
1038925012 8:32128888-32128910 CTTTTCAGAGCTTGGCCATGTGG + Intronic
1039954553 8:42197016-42197038 CCTGACAGGGCTAGGCCTTGGGG - Intronic
1040104594 8:43534595-43534617 ATCGACAGGGCCAGGCCCTGAGG - Intergenic
1041381680 8:57259211-57259233 CTTCACAGAGTCTGGCCCTGGGG - Intergenic
1050134584 9:2448563-2448585 CTTGGCAGGGCCAGGCTTTGAGG + Intergenic
1053287949 9:36861996-36862018 CTGGGAAGGGCCAGGCCATGTGG + Intronic
1055380096 9:75697286-75697308 CTAGAGAGGGTGTGGCCATGGGG - Intergenic
1055473896 9:76642453-76642475 CCTGGCAGGGCCTGGCTTTGGGG + Intronic
1055845268 9:80555025-80555047 CTTGAAAGGAGGTGGCCATGTGG - Intergenic
1056680737 9:88715602-88715624 CTTGACAGGGCCTCTTCATCAGG - Intergenic
1057560305 9:96123011-96123033 CCTCACAGGGCCTTGCCATAGGG + Intergenic
1057796357 9:98160781-98160803 CTGGAAGGGGCCTGGACATGAGG - Intronic
1058942727 9:109828907-109828929 CTTGAAAGGGCCTTGCCAAAAGG + Intronic
1059326067 9:113504714-113504736 CATGAGAGGGCCTTGCCATCTGG - Intronic
1060139973 9:121201509-121201531 CCTGACGGGGCCTGGCCCCGGGG + Intronic
1060527167 9:124327209-124327231 CAGGACAGGGCCTTGCCCTGAGG + Intronic
1061177778 9:129008003-129008025 CCTGTCAGGGCCTGGCCCTGAGG - Intronic
1061229896 9:129309323-129309345 CTGGCCAGAGCCTGGTCATGTGG + Intergenic
1061355241 9:130099671-130099693 TCTGGGAGGGCCTGGCCATGCGG + Intronic
1061386174 9:130290509-130290531 CCTGACAAGGCCTGGCCCGGGGG + Intronic
1062128596 9:134880401-134880423 CATGACCAGCCCTGGCCATGAGG + Intergenic
1062140502 9:134955249-134955271 CCTGCCAGGGCCTGGGCTTGAGG + Intergenic
1062391931 9:136337327-136337349 CTTTCCAGGGCATGGCCCTGAGG + Intronic
1203541163 Un_KI270743v1:88880-88902 CTAGTCATGGACTGGCCATGTGG + Intergenic
1188416222 X:29938390-29938412 CTACACAGGGGCTGGGCATGTGG - Intronic
1188817526 X:34733340-34733362 CTTGACAGAGCCTGGAAATGGGG - Intergenic
1190118307 X:47639787-47639809 GTTCACAGGGCCAGGCCTTGTGG + Intronic
1190708870 X:53051057-53051079 GTTGGCAGGGCCTGGAGATGAGG + Intronic
1192022788 X:67411851-67411873 CTTGCCAGGGGATGGGCATGGGG - Intergenic
1193473436 X:81934481-81934503 CTTGGTAGGGACTGGCCGTGAGG - Intergenic
1195267280 X:103194891-103194913 GTTGTCAGGGGCTGGCGATGGGG + Intergenic
1197730136 X:129803072-129803094 ACTAACAGGGCCAGGCCATGGGG + Intergenic
1199787775 X:151120161-151120183 ATTGCCAGGGCCTGGGCCTGGGG - Intergenic
1199808692 X:151327746-151327768 ATAGCCAGGGCCTGGCCAGGAGG + Intergenic
1200256060 X:154584143-154584165 CCAGACAGGGCCTAGCCCTGAGG - Intergenic
1200261709 X:154620260-154620282 CCAGACAGGGCCTAGCCCTGAGG + Intergenic