ID: 950113865

View in Genome Browser
Species Human (GRCh38)
Location 3:10438100-10438122
Sequence GCCCATACCCACTGTGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950113865 Original CRISPR GCCCATACCCACTGTGTGCT GGG Intronic
900332437 1:2142727-2142749 CCCGATGCCCACTGTGTGCTGGG + Intronic
901002141 1:6154197-6154219 CTGCATACCCACTGTGTGCAGGG - Intronic
901083871 1:6599011-6599033 GCCGAGCCCCACTGTGTGTTTGG - Intronic
901192795 1:7422478-7422500 GGCCAGACCCCCTCTGTGCTGGG + Intronic
902480074 1:16707129-16707151 GCCCAGAACCACTGCCTGCTGGG - Intergenic
902670949 1:17973217-17973239 TTACATACCTACTGTGTGCTGGG - Intergenic
903350769 1:22715341-22715363 GCCAGCAGCCACTGTGTGCTAGG + Intronic
903657535 1:24958568-24958590 TCCCATCCCCACTGTGTCCAGGG + Intronic
906628951 1:47348721-47348743 TTCCATACCCACTTTGTGTTTGG + Intronic
907458478 1:54591421-54591443 GGCCATTCCCACTGTGTTCACGG + Intronic
908065245 1:60396276-60396298 TGGCATACCCACTGTGTGCCAGG + Intergenic
908770787 1:67593682-67593704 ACGAATACCTACTGTGTGCTGGG - Intergenic
915928002 1:160038960-160038982 CCCCATACCAACTGTGGACTTGG - Exonic
917615736 1:176742219-176742241 TCTCATACCTACTATGTGCTAGG - Intronic
919153798 1:193734633-193734655 GCCCATAACCAGAATGTGCTTGG - Intergenic
920030616 1:203035380-203035402 GCCCATCCCTCCTGTGTGTTAGG + Intronic
920053428 1:203176604-203176626 GCCCATGCCCACAGCCTGCTTGG - Intergenic
922580547 1:226694716-226694738 GCCTCTACCCACTATGTGCCAGG + Intronic
924401875 1:243691984-243692006 GACCACTCCCACTGTGTTCTGGG - Intronic
1064688000 10:17884309-17884331 GCCCATATACTCAGTGTGCTTGG - Intronic
1067835254 10:49634331-49634353 GCCAACACCCTCTGTGTGCCAGG - Intronic
1067971072 10:50971440-50971462 GCACACACCTACTGTGTTCTGGG + Intergenic
1069857382 10:71448816-71448838 GTCCATACCCACCATCTGCTTGG - Intronic
1071805289 10:89113013-89113035 GACTGTACCCACTGTGTTCTTGG + Intergenic
1072579037 10:96723999-96724021 TTACGTACCCACTGTGTGCTGGG - Intergenic
1076329572 10:129654576-129654598 CCCCATTCCCACTGGCTGCTTGG + Intronic
1076379250 10:130014025-130014047 GCCCAGGGCCACTGTGTGCCTGG - Intergenic
1079005017 11:16785440-16785462 CCACGTACCCACTGTGTGCCAGG + Intronic
1080955909 11:37095205-37095227 GACCATACCCACTTGGTTCTGGG - Intergenic
1081796473 11:45823988-45824010 GCCCTCACCCACAGTGTGATGGG + Intergenic
1089666392 11:120022941-120022963 GCCCATCCCAAATGTGGGCTTGG - Intergenic
1092291281 12:7160692-7160714 TCCCTTACCCATTGTGTGCCTGG + Intergenic
1093429806 12:19071643-19071665 GCCTAAACCCACAGTTTGCTAGG + Intergenic
1093860193 12:24156018-24156040 GCCCATAGCCACTGGGAGTTGGG - Intergenic
1097087939 12:56482601-56482623 TCGAAGACCCACTGTGTGCTAGG - Intronic
1097290493 12:57910403-57910425 GGCCTCACCCACTCTGTGCTTGG + Intergenic
1102412683 12:112733776-112733798 TGCCATGCCCACTCTGTGCTGGG - Intronic
1103091718 12:118102834-118102856 GTGCATGCCTACTGTGTGCTGGG - Intronic
1103286740 12:119808682-119808704 GCGCATGCCCACTGTATTCTAGG - Intronic
1104058835 12:125250822-125250844 GCCCCTGCCCACGGTCTGCTGGG + Intronic
1105680167 13:22717927-22717949 TCCCATACCAAGTGTGTGCAGGG - Intergenic
1106288669 13:28340694-28340716 GCCCTTACTCACTCTGTTCTGGG + Intronic
1113429684 13:110238996-110239018 GCACAGAGCCACTGTGTGCAAGG + Intronic
1113485690 13:110650827-110650849 GCCCACATCCACTGTGGGCCGGG + Intronic
1113892155 13:113742148-113742170 TCCAATATGCACTGTGTGCTTGG + Intergenic
1113949353 13:114062896-114062918 GCCCATGGCCTCTGTGTGCGTGG - Intronic
1115693901 14:35876063-35876085 GCTCATGCCCACTCTGTGCAAGG + Intronic
1116505478 14:45673487-45673509 ACCCTTACCCAATGTGTTCTTGG + Intergenic
1121340698 14:93103478-93103500 GCTCTTGCCCACAGTGTGCTGGG - Intronic
1122393706 14:101407902-101407924 TCGCAAACCCACTGTGTGCCTGG - Intergenic
1126412399 15:48385757-48385779 GCCCATATCCAATGAGTACTGGG - Intergenic
1129179991 15:73868001-73868023 GCCCATGGGCAATGTGTGCTAGG + Intergenic
1131553521 15:93377713-93377735 GCCCATAGCTACTCTGTTCTTGG + Intergenic
1132399898 15:101498765-101498787 GCCCTGACCCAGTGTGGGCTCGG + Intronic
1132551141 16:554257-554279 GCCCGTGCCCACGATGTGCTGGG - Exonic
1133002099 16:2856889-2856911 GCCCCTCACCACTGTGTCCTGGG - Intronic
1133107152 16:3519412-3519434 GCCCTAACCCACTGCCTGCTGGG - Intronic
1134268906 16:12716769-12716791 CCTGCTACCCACTGTGTGCTAGG + Intronic
1136540731 16:30926458-30926480 CCCGATCCCTACTGTGTGCTGGG - Intronic
1138597724 16:58038140-58038162 CCCCATCCCCACTGTGTCATAGG + Intronic
1140188207 16:72793161-72793183 ACCCAAACCCTCTGAGTGCTGGG - Intronic
1141643031 16:85352526-85352548 ATCCAGACCCACTGTGGGCTTGG + Intergenic
1142010692 16:87712336-87712358 GCCCATGCCCAGTGTGGGCGTGG + Intronic
1143032076 17:3973422-3973444 CCCCCTACCTACTGTGTGCTGGG - Intergenic
1143851784 17:9818256-9818278 TCCCACTCCCACTGTGTGATTGG - Intronic
1144468324 17:15515097-15515119 GCCCATACCCACAGTGGGCATGG + Intronic
1144706695 17:17373202-17373224 TCCCATCCCCAGTCTGTGCTGGG - Intergenic
1146001366 17:29132496-29132518 GCTCCTACCCACATTGTGCTGGG - Intronic
1146705768 17:34999637-34999659 GGTCATACCCACTCTGGGCTGGG + Intronic
1147246861 17:39127410-39127432 TCCCACTCCCACTGTGTGCTAGG + Intronic
1148153821 17:45411481-45411503 TCCTGTACCCACTGTGGGCTGGG + Intronic
1148645002 17:49214809-49214831 GCACATTCCCACTGTATTCTAGG - Intronic
1151868807 17:76822616-76822638 GCTCATACCCAGAGGGTGCTAGG - Intergenic
1152142155 17:78542972-78542994 GGCCATACCCACATTGTGCTGGG + Intronic
1152271051 17:79325125-79325147 GCCCATTCCTGCTATGTGCTGGG + Intronic
1152847798 17:82613321-82613343 ACCCATACCCACCCTGTGTTTGG - Intronic
1154066078 18:11108704-11108726 TCCCACACCCACTGTGTGGTGGG + Intronic
1155449502 18:25948976-25948998 GCACTTACCTACTTTGTGCTAGG - Intergenic
1156200273 18:34822599-34822621 GCCTGTACCCAGTGGGTGCTAGG + Intronic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1160480575 18:79236684-79236706 CCCCTTCCCCACTGTGTGCACGG + Intronic
1160480585 18:79236735-79236757 CCCCTTCCCCACTGTGTGCACGG + Intronic
1160513507 18:79465852-79465874 GCCCAGACCCACAGTGCTCTGGG + Intronic
1160957528 19:1700358-1700380 GTCAAGACCCACTGTGTGCTGGG + Intergenic
1160997200 19:1888278-1888300 GCCCCTTCCCACTGTGAGCTAGG + Intergenic
1162500843 19:11052745-11052767 GCCCATGGCCACTGTCTGCAGGG - Intronic
1162932773 19:13965614-13965636 GCCCATCCCCAGTGAGTGCTCGG - Exonic
1162961097 19:14127376-14127398 GGCCCTGCCCACTGGGTGCTGGG + Intronic
1163612393 19:18308259-18308281 CCCCACACCCTCTGTGTGCCTGG + Intronic
1166781227 19:45344743-45344765 GCCCCCACCCACTATGAGCTGGG + Intronic
1168303917 19:55423739-55423761 CTCCACACCCACTGTGTGCAGGG - Intergenic
1202714111 1_KI270714v1_random:33035-33057 GCCCAGAACCACTGCCTGCTGGG - Intergenic
930781175 2:55225697-55225719 GCCCAGCCCCACTGCGTGCCAGG + Intronic
933629431 2:84639131-84639153 CCCCATACCCACTGTGGGCATGG + Intronic
933762998 2:85686485-85686507 GCCCAAACTCACTGTTTTCTTGG - Intronic
936617383 2:114061851-114061873 GCCCATGTCCACTGCGTGGTTGG + Intergenic
936667806 2:114617713-114617735 TCGCATACCCACTGAGTGTTTGG - Intronic
938150560 2:128879106-128879128 TCCCATACCTAGTATGTGCTGGG - Intergenic
940269964 2:151879930-151879952 GCTAATACCCACTGTGTCCAAGG - Intronic
942134478 2:172911272-172911294 CCCTATACCCATTGTTTGCTGGG - Intronic
944343353 2:198630600-198630622 TGCCTAACCCACTGTGTGCTAGG + Intergenic
945000953 2:205349973-205349995 GCCAAAACCCACTGGCTGCTTGG - Intronic
945040791 2:205742293-205742315 TCCCATTCCCAGTGTGTGCCTGG - Intronic
948197476 2:236106471-236106493 GCCCCTGCCCTCTGTGTGATGGG + Intronic
1172128489 20:32639684-32639706 GAGCACACCCACTGTGTGCCTGG - Intergenic
1172921515 20:38486885-38486907 GTCAATGTCCACTGTGTGCTAGG + Intronic
1175732742 20:61365129-61365151 GCCCAACTCTACTGTGTGCTTGG + Intronic
1175865831 20:62175952-62175974 GCCTCTCCCCAGTGTGTGCTGGG + Intronic
1178023767 21:28441089-28441111 TTCCATACCTACTATGTGCTTGG - Intergenic
1178212808 21:30557029-30557051 AGCCATACCAACTCTGTGCTGGG + Intronic
1181001865 22:19991588-19991610 GCCCAATCCCACCCTGTGCTTGG - Intronic
1181784894 22:25219879-25219901 CCCAATGCCCACTGTGTGCCAGG - Intronic
1181864633 22:25845713-25845735 GCACGTGCCTACTGTGTGCTAGG + Intronic
1183043226 22:35199016-35199038 GCGCATGCCCACTGTGCACTTGG - Intergenic
1183262698 22:36806096-36806118 TCGCATTCCCACTGTGTGCCAGG - Intronic
1183270140 22:36856912-36856934 CCAGACACCCACTGTGTGCTAGG - Intergenic
1183727942 22:39599813-39599835 CCACATACCTACTGTGTGCCAGG - Intronic
1184189373 22:42884812-42884834 GACCATACACACTGAGTTCTGGG - Intronic
1184355794 22:43978776-43978798 GCCCCCAGCCACTGGGTGCTGGG - Intronic
1184384362 22:44165943-44165965 GCTCATGTCCACTGTGGGCTTGG + Intronic
1184480763 22:44745591-44745613 GCCAATACCCATTGTGTTCCAGG + Intronic
1185333827 22:50262843-50262865 GCCCATACCCTTTGTGCCCTGGG + Intergenic
949599697 3:5584560-5584582 GCACCTGCCCACTGTGTTCTGGG + Intergenic
950113865 3:10438100-10438122 GCCCATACCCACTGTGTGCTGGG + Intronic
950554334 3:13686108-13686130 TCCCATCCCCACTCTGTGGTCGG - Intergenic
950702148 3:14758057-14758079 ACAAGTACCCACTGTGTGCTGGG + Intronic
951116110 3:18863879-18863901 GCCCATACCCCCTGTACACTGGG - Intergenic
953910054 3:46888096-46888118 GCCCACACCCACTGTCTCATAGG + Intronic
956654687 3:71537364-71537386 GCCAATACCCACACTGAGCTGGG - Intronic
957415764 3:79901425-79901447 GCACATATTCACTATGTGCTAGG - Intergenic
958587845 3:96114485-96114507 GCCCCTGCCCAGTGTCTGCTGGG + Intergenic
960854080 3:122085433-122085455 TCGAATACCCACTGTGTGCCAGG + Intronic
960854261 3:122086643-122086665 TCGAATACCCACTGTGTGCCAGG - Intronic
963069265 3:141289404-141289426 GCCCCTACCCACTAGGTGCCAGG + Intronic
968480825 4:832340-832362 CCCCTTTGCCACTGTGTGCTGGG - Intergenic
971035802 4:22691681-22691703 ACCCATACCCACTGGGTTCCTGG + Intergenic
973638021 4:52877712-52877734 CCCCATAACTACTGTGAGCTGGG - Intronic
975701424 4:77070439-77070461 GCCCCAACCCATTGTGTGCGAGG + Intronic
976854514 4:89587539-89587561 GCACCCACCCACTATGTGCTGGG - Intergenic
983461420 4:168029276-168029298 GCTGATACCCACTGGGTGTTAGG + Intergenic
985806210 5:2045317-2045339 GCCCATAATCACTGTGTTTTGGG - Intergenic
987270656 5:16305011-16305033 GGCCAGACCCACTTTGTGGTCGG + Intergenic
989217642 5:38921716-38921738 GACCATACCCAGGATGTGCTCGG + Exonic
997893611 5:137696274-137696296 TGCCAGACCCACTGTGTGATTGG - Intronic
999175457 5:149628804-149628826 GCACATACCCACGATGTCCTAGG - Exonic
1000208603 5:159088190-159088212 GCCCATACCTTCTGTATGATAGG - Intronic
1003300267 6:4874390-4874412 GGCCTTCCCCACTGTGTGCCTGG + Intronic
1004732135 6:18368246-18368268 GCACATAACCACAGTGTGCGAGG + Intergenic
1004775058 6:18834808-18834830 GGCCTTGCACACTGTGTGCTGGG + Intergenic
1006360735 6:33585707-33585729 GCCCTTACCCACTGTGTCTGTGG - Intergenic
1006449267 6:34096587-34096609 GTCAATACCCACTGCGTTCTGGG + Intronic
1006795317 6:36728654-36728676 AGCCACACCCACTGTGTGCCAGG - Intronic
1007249951 6:40488721-40488743 CCCTATACCCACTGTGTTTTAGG + Intronic
1007886202 6:45233005-45233027 GATCATACTCTCTGTGTGCTAGG + Intronic
1007916055 6:45562657-45562679 GCCCATAGCCACTGTGGGTTAGG + Intronic
1008541320 6:52548863-52548885 CTCCATACCCACAGTGTTCTTGG + Intronic
1015688240 6:135890535-135890557 AGTCATACCCACTGCGTGCTGGG - Intronic
1016000982 6:139040900-139040922 GCTGATACTCAGTGTGTGCTAGG + Intronic
1017396117 6:154002108-154002130 GCCCATCCCCACTCTGTGCCTGG - Intergenic
1018739159 6:166714161-166714183 TCCCATCCCCACAGCGTGCTGGG - Intronic
1020417488 7:7962537-7962559 GCCCAAACCCTCTATGTGTTGGG + Intronic
1024118815 7:46217030-46217052 GCCCATTCCCACTGTTTGTGGGG - Intergenic
1026760344 7:73121825-73121847 CCCCATACCCACTGGGTGCCAGG + Intergenic
1027036686 7:74930646-74930668 CCCCATACCCACTGGGTGCCAGG + Intergenic
1027086877 7:75270813-75270835 CCCCATACCCACTGGGTGCCAGG - Intergenic
1028846751 7:95490093-95490115 GCCCATAGCCACTGATTCCTTGG + Intronic
1029393177 7:100288811-100288833 CCCCATACCCACTGGGTGCCAGG - Intergenic
1029688374 7:102164437-102164459 TCCCAGCCCCACTGTGGGCTAGG - Intronic
1032706750 7:134426602-134426624 GCTCATGCCCACAGTGCGCTGGG + Intergenic
1033456179 7:141505986-141506008 GCCCATAACCTCTGTCTGGTGGG - Intergenic
1034525439 7:151657390-151657412 GCCAATGTCCACTGTGTGCCTGG + Intronic
1035341738 7:158166743-158166765 CCTCATACCCTCTCTGTGCTGGG - Intronic
1036233882 8:7021787-7021809 GTCCACACACACTGTCTGCTGGG - Intergenic
1037665996 8:20970724-20970746 GCACTTAGCCACTGTTTGCTTGG - Intergenic
1045383483 8:101649031-101649053 GCCCATAGGCTATGTGTGCTAGG - Intronic
1049312845 8:141942648-141942670 GCCCATTCCCAGTGAGTGCCAGG + Intergenic
1052751674 9:32498148-32498170 GGCCAGACCCACTCTGTGGTTGG - Intronic
1053139498 9:35673918-35673940 GCCCGTACACACCGTGTGCTGGG + Exonic
1054873404 9:70070160-70070182 GCCCATGCCCATTTTGTGCCTGG - Intronic
1054877189 9:70109200-70109222 TCCAATACCCACTGTCTGCTTGG + Intronic
1055428234 9:76217683-76217705 TCTCATTCCCACTGTGTGCTCGG - Intronic
1056814849 9:89793653-89793675 CCGCAGTCCCACTGTGTGCTTGG + Intergenic
1057268615 9:93634741-93634763 CCCTGTGCCCACTGTGTGCTGGG + Intronic
1057340768 9:94199073-94199095 GCCTACACCCACTGTGAGCCAGG - Intergenic
1057575768 9:96241139-96241161 TCCCATTCACACTGTGTGTTGGG - Intronic
1057792786 9:98135076-98135098 GCCCATAGCCACTGAGTGGGAGG - Intronic
1058032794 9:100217576-100217598 ATGCAAACCCACTGTGTGCTGGG - Intronic
1058205830 9:102105640-102105662 ACTCCTACCCACAGTGTGCTAGG - Intergenic
1058903516 9:109462139-109462161 GCCCATTCCCACTCTCTGCCAGG + Intronic
1059406337 9:114100026-114100048 CCCCAGACACACTGTGAGCTGGG - Intergenic
1060513535 9:124251202-124251224 ACCCATCCCCACATTGTGCTAGG - Intergenic
1060513840 9:124253599-124253621 ACCCATCCCCACATTGTGCTAGG + Intergenic
1062025061 9:134336369-134336391 GCCCAGGCCCACTGTCTGCAGGG - Intronic
1062347686 9:136122940-136122962 CCCCAGAACCACCGTGTGCTGGG + Intergenic
1062711206 9:137976090-137976112 GGCCATGCCCAGTGTGGGCTGGG + Intronic
1186890767 X:13957186-13957208 TCCCACCCCCACTGTGTCCTTGG + Intergenic
1188289897 X:28374551-28374573 TCCCATATTCATTGTGTGCTTGG + Intergenic
1192178545 X:68901035-68901057 TCTCATGCCCACTGTCTGCTAGG - Intergenic