ID: 950114379

View in Genome Browser
Species Human (GRCh38)
Location 3:10441155-10441177
Sequence CAGTGTAGCCAGGGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 363}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950114379_950114387 0 Left 950114379 3:10441155-10441177 CCTTCCTCCCCCTGGCTACACTG 0: 1
1: 0
2: 2
3: 38
4: 363
Right 950114387 3:10441178-10441200 AGGCCTTGGCTTCCTGCCCTTGG 0: 1
1: 1
2: 4
3: 40
4: 520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950114379 Original CRISPR CAGTGTAGCCAGGGGGAGGA AGG (reversed) Intronic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900428941 1:2592991-2593013 CAGTGCAGCCAGGGGCATGTGGG - Intronic
900599568 1:3497251-3497273 CAGTGAAGCCAGGGGGACAGCGG + Exonic
900610246 1:3541672-3541694 CACTGTCCCCAGGGAGAGGAAGG - Intronic
900940401 1:5795030-5795052 CAGGCTAGCCAGGGTGAGGGAGG + Intergenic
902816516 1:18919413-18919435 CAGGGGAGCCCGGGGGAGGGCGG + Intronic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
904079112 1:27860963-27860985 CAGTGGAGCAAGTGGGAGGTCGG - Intergenic
904416134 1:30362097-30362119 CAGTGTAGACAGGGGTATGGAGG - Intergenic
905019076 1:34796037-34796059 CAGTGTGGCCAGGGCGACGATGG - Intronic
905120664 1:35679428-35679450 CAGAGAAGCCAGGAGGAGGGAGG - Intergenic
905478040 1:38242664-38242686 CATTATAGCCTGGGGGAGGTGGG - Intergenic
907306084 1:53513865-53513887 GGCTGTAGCCAGGAGGAGGAAGG + Intronic
907328028 1:53653604-53653626 CAGTGGGGTGAGGGGGAGGAGGG - Intronic
907367664 1:53976027-53976049 CGTTGCTGCCAGGGGGAGGAGGG - Intergenic
908267593 1:62394637-62394659 TAGTGTAGACAATGGGAGGAAGG + Intergenic
908634100 1:66143273-66143295 CATTTTAGCCAGGGGAAGTAAGG + Intronic
908818447 1:68057768-68057790 CAATGCAGCTAGGGGGAGCAGGG - Intergenic
909169154 1:72272253-72272275 CAGAGTAGAGATGGGGAGGAAGG - Intronic
909532928 1:76700848-76700870 CAGTGTAAGAAGGGAGAGGATGG - Intergenic
909684220 1:78328494-78328516 CAGTTGTGCCAAGGGGAGGAGGG - Intronic
910482329 1:87672487-87672509 GAGTGGAGCCAGGGGAAGGTGGG - Intergenic
912816268 1:112831218-112831240 CTGTATAGCAAGGGTGAGGACGG + Intergenic
912903248 1:113675420-113675442 CAGGGAAGCCAAGGGGAGAAAGG + Intronic
913483499 1:119312302-119312324 CTGTGTAGAAAGGGGTAGGATGG + Intergenic
915267118 1:154726847-154726869 CAGGGGAGCCCGGGGGAGGGTGG + Intronic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
915895536 1:159808629-159808651 ACATGTAGCCAGGGGAAGGAGGG + Intronic
915920745 1:159973591-159973613 ACATGTAGCCAGGGGAAGGAGGG - Intergenic
916348371 1:163820478-163820500 CAGATAAGCCAGAGGGAGGAAGG + Intergenic
916720768 1:167483409-167483431 CAGGGTAGGGAGGGGGAGGGAGG - Intronic
917794766 1:178525305-178525327 CAGAGTAGGCATGGGGAGGCAGG - Intronic
918242566 1:182633684-182633706 CAGTGTACCATGGGGGAGGGTGG - Intergenic
920309660 1:205041616-205041638 CAGTGTGGGCAGGGGAAGGAAGG + Intergenic
920681880 1:208079303-208079325 CAGTCGAGCCAGGGGCTGGAAGG + Exonic
921531699 1:216290875-216290897 GAGTGTAGGCAAGGGAAGGAAGG - Intronic
922724313 1:227915349-227915371 CTGTGTAGCCAGGTGGGGCAGGG + Intergenic
923341284 1:233009033-233009055 CAGTGTGGCCAGTAGGAGCAAGG + Intronic
923545481 1:234920299-234920321 CAGTGGTGCCAGCTGGAGGAGGG - Intergenic
924646027 1:245878005-245878027 GAGTGTTCCCAGGAGGAGGAAGG + Intronic
924769858 1:247069844-247069866 AAGTGTAGTCAGGGGGACTAGGG + Intronic
1063361895 10:5466306-5466328 CAGACTTGCCTGGGGGAGGAGGG - Intergenic
1063482338 10:6386644-6386666 CAGTGGAGGCTGGGTGAGGAAGG - Intergenic
1065476342 10:26141951-26141973 CAATGTAGCCAGTGGCAGGTGGG - Intronic
1066579245 10:36861975-36861997 TAGTGAAGCCAGTGGGTGGATGG + Intergenic
1067793601 10:49305212-49305234 CAAGGTAGCCAGGGGCAGGTGGG + Intronic
1067805952 10:49394065-49394087 CAGTGTACCCTAGGGGATGAGGG - Intronic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1069742250 10:70692254-70692276 CAGAAGAGCCAGGCGGAGGAGGG + Intronic
1069825668 10:71253685-71253707 CAGGGCTGCCAAGGGGAGGAGGG + Intronic
1070906313 10:80076514-80076536 CAGGGTAGCCTTGGTGAGGATGG + Intergenic
1072799936 10:98385748-98385770 CACAGAGGCCAGGGGGAGGAAGG - Intronic
1074059699 10:109953830-109953852 CAGTGCAGCCAGGAGTCGGAAGG - Exonic
1074077659 10:110143340-110143362 CAGTGTGCCCAGGTGGAGAAGGG - Intergenic
1074358594 10:112807151-112807173 CAGTGCAGCCATGGGGAAGAAGG + Intronic
1075067248 10:119297439-119297461 CAGAGCAGCCTGGTGGAGGATGG - Intronic
1075073694 10:119336246-119336268 CTGTGGAGCCGTGGGGAGGAAGG - Intronic
1076090429 10:127680805-127680827 CAGGGAAGCCAGCTGGAGGAAGG + Intergenic
1076726702 10:132417199-132417221 CAGTGTGTCCAGGGAGGGGATGG + Exonic
1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG + Intergenic
1077308048 11:1876621-1876643 AAGTGTCTGCAGGGGGAGGACGG + Intronic
1077501475 11:2911484-2911506 CAGGGTGGCCAGGGTGAGGAAGG + Intronic
1077573441 11:3357800-3357822 GAGTTCAGCCAGGGGAAGGAGGG + Intronic
1078069808 11:8101064-8101086 CAGTGTAGGCAGGGCTAGGTGGG - Intronic
1079419456 11:20272477-20272499 GAGCTTGGCCAGGGGGAGGAAGG - Intergenic
1081190153 11:40094207-40094229 CAGTGTAGCCAGTGGAAGGAAGG + Intergenic
1081751422 11:45513867-45513889 AAGTGAAGGCAGAGGGAGGAAGG + Intergenic
1083204794 11:61141844-61141866 AGGTGCAGCCAGGTGGAGGATGG + Intronic
1083672642 11:64307536-64307558 CAGTGTACCCAGAGGGTGCAGGG - Intronic
1084061069 11:66674987-66675009 CAGTGGAGACTGGGGAAGGAGGG - Intronic
1084425774 11:69083898-69083920 CAGTGGGGCCAGGAGGAGTAAGG + Intronic
1084533911 11:69745784-69745806 CAGGGAAGCCAGGGCCAGGAAGG + Intergenic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1084661581 11:70549550-70549572 CAGTGTGGCCAGGGGCAGGCGGG + Intronic
1084941476 11:72615519-72615541 GAGTGTGGGGAGGGGGAGGATGG + Intronic
1084950060 11:72659909-72659931 CAGTGCAGCCAGGCAGGGGAAGG - Intronic
1087845049 11:102963212-102963234 GATTGGAGCCAGGGTGAGGAGGG + Intergenic
1088738370 11:112746984-112747006 CAGTGTAGCCTGGGAGGGAAAGG - Intergenic
1088906319 11:114157887-114157909 CAGTGGAGCCAGGGGCAGGGTGG - Intronic
1089090909 11:115874309-115874331 GAGAGTAGTGAGGGGGAGGAGGG - Intergenic
1089386055 11:118068773-118068795 CAGTGCCGCCAGGTGGTGGAAGG - Intergenic
1089606542 11:119644730-119644752 CATTGTAGGCAGAGTGAGGAGGG + Intronic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090344769 11:126061532-126061554 CAGTGTCTCCAAGGAGAGGAAGG - Intronic
1091111268 11:132970986-132971008 CACTGTAGCCAAGGAGATGATGG - Intronic
1091203827 11:133803941-133803963 CGGTGTTGCCAGGGGCTGGAGGG + Intergenic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1092914519 12:13177967-13177989 CAGTGTAGCCAGGCTGAGGTTGG + Intergenic
1092928312 12:13291965-13291987 CAGAGTACCCAGGGTGAAGAAGG - Intergenic
1093465253 12:19441719-19441741 CTGTGTAGGCATGGGTAGGAAGG + Intronic
1095427264 12:42089828-42089850 AAGTGTAGCCAGGTTGAAGAAGG + Intronic
1095797665 12:46237967-46237989 CATTATAACCAGAGGGAGGAGGG + Intronic
1095989716 12:48026359-48026381 CAGTGTACTCAGGGCCAGGACGG + Intergenic
1096280857 12:50252200-50252222 AAGTGAAGGCAGGAGGAGGAAGG + Intronic
1097957910 12:65505632-65505654 CAGTGTAGGGCTGGGGAGGAGGG - Intergenic
1098563927 12:71909730-71909752 CAGTGTAGGCAGTGGGGGGCAGG - Intronic
1100224907 12:92546644-92546666 GAGTGTAGATAGGTGGAGGAAGG - Intergenic
1100619104 12:96254859-96254881 CAGGGTAGACAGGGAGAGGAAGG + Intronic
1102207617 12:111101195-111101217 CAGTGCGGCCCGGGGGAGGCTGG + Intronic
1102726047 12:115066097-115066119 TAGTGAAGCCTGGGAGAGGAAGG + Intergenic
1104255478 12:127133376-127133398 CACTGTAGCCTGGGCGAAGACGG - Intergenic
1104536341 12:129621381-129621403 CAGTGGGGGCAGGGGGAGGGTGG - Intronic
1104984177 12:132587341-132587363 CAGTGCAGCTGGAGGGAGGACGG + Intergenic
1104984188 12:132587387-132587409 CAGTGCAGCTGGAGGGAGGACGG + Intergenic
1106083467 13:26519734-26519756 CAGAGCAGCCACTGGGAGGAAGG - Intergenic
1106115771 13:26816316-26816338 CAGAGTAGCCAGAGGCAGAAGGG + Intergenic
1106158966 13:27183680-27183702 AAGTGTGGCCTGTGGGAGGAGGG - Intergenic
1107776678 13:43851512-43851534 CAGTGTAGTTAGGGGGAGACAGG - Intronic
1108326484 13:49337450-49337472 CCATGTGGCCAGGGGGAGGTGGG - Intronic
1114656682 14:24319959-24319981 GAGTGTGGACATGGGGAGGAGGG - Intronic
1118356148 14:65015516-65015538 CAGCCTGGCAAGGGGGAGGAGGG - Intronic
1118655552 14:67944082-67944104 CAGTACAGCCAGGGGGAGTGGGG + Intronic
1122079218 14:99255436-99255458 CAGGGGGGCCAGGGGGTGGAAGG + Intronic
1122168752 14:99853343-99853365 CAGTGGAAACAGGGGCAGGAGGG + Intronic
1122464049 14:101918454-101918476 CAGAGGAGCGAGGGGGATGAAGG - Intronic
1122575426 14:102738839-102738861 CAATGTAGGCTGGGGCAGGAAGG - Intergenic
1122893577 14:104744212-104744234 AAGTGGAGCCTGGGGGAGCAGGG + Intronic
1124201402 15:27681461-27681483 CAGTGCAGCGGGTGGGAGGAGGG - Intergenic
1124594821 15:31083658-31083680 CAGTGGAGCGAGGGGGTGGGAGG - Intronic
1125311203 15:38379807-38379829 CAGTGATGTCAGTGGGAGGAAGG - Intergenic
1126047206 15:44653242-44653264 CAGAGTAGCTAGGGGAAGAAGGG + Intronic
1126133091 15:45362949-45362971 TGGTATAGCCAGGGAGAGGAAGG + Intronic
1126679985 15:51193109-51193131 CAGTGGGGCTTGGGGGAGGACGG + Intergenic
1127404385 15:58625974-58625996 CAGGGTAGCAGGGGGGAGGAAGG + Intronic
1128300639 15:66564511-66564533 CAGTGCAGCCAGAGGGGGCAGGG - Intronic
1128701938 15:69811103-69811125 CAGAGGAGGCAGGGGAAGGAAGG - Intergenic
1129039173 15:72670884-72670906 CAGTGCAGACAGGAGAAGGAGGG - Intergenic
1129183909 15:73894239-73894261 CAGTGTGGGCTGCGGGAGGATGG - Intergenic
1129265956 15:74393180-74393202 CAGTGCAGCCAGAGAGAGGAGGG - Intergenic
1129358975 15:75012593-75012615 CAGCACAGCCAGGGGAAGGATGG + Intronic
1129769079 15:78192290-78192312 CAGTGTGGCCTTGGGGAGGATGG - Intronic
1129828262 15:78650034-78650056 GAGTGTGCCCAGGAGGAGGATGG + Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130520309 15:84656840-84656862 CTGTGTAGACTGGGGGAGAAAGG + Intronic
1130538427 15:84803232-84803254 GAGTGTAGCCAAGAGGAGTAGGG - Exonic
1130910923 15:88270286-88270308 CAGTGCAGAGATGGGGAGGAGGG + Intergenic
1130970036 15:88725202-88725224 CAGAGAAGCCAGGGAGAGCAAGG + Intergenic
1130988489 15:88860399-88860421 CAGTGTAGCCAGGGGGGCACAGG - Exonic
1131536179 15:93239874-93239896 CAGTCCAGGCAGGGGGAGGCAGG - Intergenic
1134215895 16:12316733-12316755 CAGAGAAGCCAGGGGCAGGAAGG - Intronic
1135597407 16:23754946-23754968 CAGTGGCCCCAGGGGGACGAAGG - Exonic
1137023228 16:35450897-35450919 CAGTGTAGGCAGGGACAGGCAGG + Intergenic
1137402115 16:48162415-48162437 CAGTGGAGCAAAGGAGAGGATGG + Intergenic
1137506222 16:49056223-49056245 AAGTGTTGCCAGGTGGAAGAAGG - Intergenic
1137603931 16:49774724-49774746 CAGTCTGGGCAAGGGGAGGAGGG + Intronic
1139020710 16:62745401-62745423 CAGAGTAGCCAGGTGAAGGGGGG + Intergenic
1139852547 16:69959809-69959831 CCGTGTAGCCAGGGGGACAGTGG - Exonic
1139881518 16:70182717-70182739 CCGTGTAGCCAGGGGGACAGTGG - Exonic
1140370991 16:74412788-74412810 CCGTGTAGCCAGGGGGACAGTGG + Exonic
1141022292 16:80508674-80508696 CATTGTAGCAAGGAGAAGGAGGG - Intergenic
1141643980 16:85357601-85357623 CAGAGCAGCCGGGAGGAGGACGG + Exonic
1141758505 16:86011121-86011143 CAGTGGAGCTCGGGGGAGGCAGG - Intergenic
1141870063 16:86779152-86779174 CTGTGCAGCCAGGGTGAGGTGGG - Intergenic
1141992506 16:87618574-87618596 CAGTGTGGCCAGGTGGAAAAAGG - Intronic
1142869317 17:2809921-2809943 CAGAGGAGCCAGCGGGAGGAAGG - Intronic
1143214822 17:5216951-5216973 CAGTGTACCTAGGGGGATGGAGG - Intronic
1143316688 17:6038264-6038286 CAGTGTGGCCAGAGCGGGGAGGG + Intronic
1143586476 17:7853172-7853194 CAGTGCAGTCAGGGGGAGGGAGG - Intronic
1144182028 17:12761491-12761513 CATTGTAGCAAGAGGGAAGAAGG + Intronic
1144523282 17:15968568-15968590 CTGTGTGGTCAGGCGGAGGAGGG + Intronic
1144702323 17:17347751-17347773 CATTGAAGACAGGCGGAGGAAGG + Intergenic
1145990382 17:29075761-29075783 CAGTGGAGGCAGGAGGAGTACGG - Exonic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1146812999 17:35918400-35918422 CAGTATGGCCAAGAGGAGGAAGG - Exonic
1147129105 17:38395616-38395638 TATTGCAGCCAGAGGGAGGAAGG + Intronic
1147418665 17:40311223-40311245 GAGGGAAGCCAGTGGGAGGATGG + Intronic
1147486151 17:40816722-40816744 GATTGTGGCCTGGGGGAGGAGGG + Intergenic
1147955734 17:44133298-44133320 CAGAGGAGTCAGGGGAAGGAGGG - Intergenic
1147976609 17:44251536-44251558 CAGTACAGCCAGGGGGATGCGGG + Exonic
1149297492 17:55273772-55273794 AAGGGAAGCGAGGGGGAGGAGGG - Intronic
1149540296 17:57463441-57463463 CAGTGGGGCCATGGGGAGGGAGG - Intronic
1149560590 17:57605412-57605434 CAGTGTAGGCAGGGCCAGGGAGG + Intronic
1151169713 17:72236528-72236550 CACTGAAGCCTGGGGAAGGAAGG + Intergenic
1151194926 17:72424636-72424658 CAGGGCGGCCAGTGGGAGGAGGG - Intergenic
1152636262 17:81431677-81431699 CAGCATTGCCAGGGGGAGGCAGG - Intronic
1152642490 17:81454990-81455012 CAGTATAGCCAAGTGGGGGATGG + Intronic
1152695541 17:81742003-81742025 CAGTGCAGCGAGGTGGGGGAAGG - Intergenic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1153299663 18:3581597-3581619 GAGTGTAGCCAAGAGGAGTAGGG - Intronic
1153749818 18:8217621-8217643 CAGTGTAGCCAGCCTGCGGAAGG - Intronic
1153806461 18:8712435-8712457 CAGTGTGGCCTGGGGGTGGAGGG + Intronic
1153823166 18:8849853-8849875 TAGTGTGGCCAGGGGAAGTATGG + Intergenic
1155502512 18:26500974-26500996 CAGTGTAGCCTCGTGGAGGCAGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1157680726 18:49603363-49603385 GAGTGTGGCCAGAGGGCGGATGG - Intergenic
1157701735 18:49765121-49765143 CAGTGTAGACAGGGAGCAGATGG + Intergenic
1159232017 18:65620377-65620399 CAGTGGTGGCATGGGGAGGACGG + Intergenic
1160623526 18:80187609-80187631 CAGGGGAGCCAGGAGGTGGATGG - Intronic
1160905980 19:1451935-1451957 GTGTGTGGCCAGGTGGAGGAGGG + Exonic
1161589326 19:5121975-5121997 CAGCGTGGACAGGGGGAGGGAGG - Intronic
1161652968 19:5496551-5496573 CAGTGTAGTCAGGTGGAGCATGG - Intergenic
1162303714 19:9858682-9858704 CACCGTAGCCAGGTGGAGGTGGG - Intronic
1162418542 19:10552742-10552764 CACTGTGGCCAGGGGATGGAAGG + Intronic
1162500788 19:11052473-11052495 CAGTATGGCCAGGTGGAGGAAGG - Intronic
1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG + Intronic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1163625288 19:18386068-18386090 CTCTGCAGGCAGGGGGAGGAGGG + Intronic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1165906203 19:39196361-39196383 CAGAGTGGGGAGGGGGAGGAGGG + Intergenic
1166091490 19:40512383-40512405 CAGAGTAGTCAGGGCTAGGATGG + Intronic
1166699176 19:44872272-44872294 CAGTGTAGACAATGGCAGGAAGG - Intronic
1168193476 19:54756592-54756614 CAGGGTAGACATGGGGTGGAGGG - Intronic
1168195539 19:54771330-54771352 CAGGGTAGACATGGGGTGGAGGG - Intronic
1168527878 19:57103327-57103349 CAGTGTAACCAGGTGGATAATGG - Intergenic
925180118 2:1812049-1812071 CAGTGTGTCCAGTGGCAGGAAGG - Intronic
925574063 2:5341845-5341867 CAATGCAGCCAGAGGAAGGAGGG - Intergenic
926142662 2:10377604-10377626 CACGGGAGCCAGGGGGAGGAGGG - Intronic
926633851 2:15160576-15160598 CAGTGTGGGCGGGGGGAGGGGGG + Intergenic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
927600539 2:24436569-24436591 GAGTGGAGCCAGGGGAAGAAGGG - Intergenic
928135506 2:28684758-28684780 CAGTGGAGCCCGGGTGAGGCGGG - Intergenic
929300252 2:40295935-40295957 CAGTGTACCCAAGGAAAGGAGGG + Intronic
929609277 2:43257917-43257939 CAGAGAAGCCAGTGGGAGGAAGG + Intronic
931508147 2:62955697-62955719 CATTGTAATCATGGGGAGGAGGG + Intronic
932702454 2:74001138-74001160 CTGTGTTCCCAGGGGGAGGCAGG + Intronic
934818188 2:97348472-97348494 CAGTGCAGACAGGAGGAGGCAGG + Intergenic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935296671 2:101655988-101656010 AAGTGGGGCCAGGGGGAGGGGGG - Intergenic
936488323 2:112946579-112946601 CAGTGTAGCAAGAGGGAGGGAGG - Intergenic
937098005 2:119248222-119248244 CTGAGTTGCCAGAGGGAGGAAGG - Intronic
937470141 2:122167617-122167639 AAGAGCAGCCAGGGGGAGGTGGG - Intergenic
938576099 2:132606046-132606068 CAGAGCAGCAAGCGGGAGGAGGG + Intronic
938727772 2:134121991-134122013 CAGTGAGGACGGGGGGAGGAGGG - Intronic
939219167 2:139280216-139280238 CTGTGAAGACAGGGAGAGGATGG + Intergenic
939418730 2:141937293-141937315 CTGTGAAGCCAGGAGGTGGAAGG + Intronic
941794221 2:169582553-169582575 GAGTGTAGACAGTGGGAGGAGGG - Intergenic
942386233 2:175446364-175446386 CAGGACAGCCAGGGGAAGGAGGG - Intergenic
946391543 2:219419408-219419430 CAGTGTAGCCAGAGGGAGAAGGG + Intronic
946973382 2:225120515-225120537 CAGGGTAGGCAGGCAGAGGAAGG - Intergenic
948176653 2:235948790-235948812 CTGTGTGGCAAGTGGGAGGATGG - Intronic
948594928 2:239073790-239073812 CAGTCTAGTCAGTGGCAGGATGG + Intronic
948786413 2:240355089-240355111 AAGTGCAGCCAGGGGCATGAGGG - Intergenic
948826954 2:240577496-240577518 CTGGGAAGCCAGGGGCAGGAGGG + Intronic
1169091707 20:2864906-2864928 GACTGTAGCCTGGGTGAGGAGGG + Intronic
1169224240 20:3846513-3846535 CAAAGTTCCCAGGGGGAGGAGGG + Intergenic
1170458621 20:16556045-16556067 CAGTGTTGGAAGGGGGAGGATGG - Intronic
1170787778 20:19482327-19482349 CAGAGAAGCCTGGGGGAGGGAGG - Intronic
1171305536 20:24102646-24102668 CTGTGTGGCCATGGGCAGGATGG - Intergenic
1172180607 20:33001184-33001206 CAGGGAAGGCAGGGGGAGGGTGG - Intronic
1172906519 20:38374124-38374146 AAGTCTGGCCAGGGGCAGGACGG + Intronic
1173347545 20:42214784-42214806 CCATGTACCCAGAGGGAGGAGGG - Intronic
1173872431 20:46350440-46350462 CGGAGCAGCCAGCGGGAGGAAGG - Exonic
1174402924 20:50285539-50285561 AAGTGAGGCCAGGGTGAGGAAGG - Intergenic
1174551986 20:51368790-51368812 CAGTGTTGCCATGGGGCGGGTGG + Intergenic
1175171378 20:57083884-57083906 CAGAGCAGCCAGAGTGAGGATGG - Intergenic
1175399074 20:58689778-58689800 GTGTGTGGCCAGGAGGAGGAAGG - Intronic
1176305234 21:5119696-5119718 GACTGTAGACAGCGGGAGGAGGG - Intronic
1178300114 21:31445791-31445813 GAGTACAGCCAGGGGGAGGAGGG + Intronic
1178431500 21:32522196-32522218 GAGTGTGGCCAGGGGACGGAAGG - Intergenic
1178561181 21:33641583-33641605 CCGTGCAGCCCTGGGGAGGATGG - Intronic
1178668481 21:34569545-34569567 CAGGGTAGGCAGGTGGAGGAAGG - Intronic
1179851820 21:44142334-44142356 GACTGTAGACAGCGGGAGGAGGG + Intronic
1179898407 21:44376335-44376357 CATTTTAGCCAGTGGGAGGGCGG + Intronic
1180228870 21:46414455-46414477 CTGTGTGTCCAGGAGGAGGAGGG - Intronic
1180581565 22:16844179-16844201 CTCTGTAGGCAGAGGGAGGAGGG + Intergenic
1182753371 22:32659123-32659145 CAGTGTAACCAAGGTGAGTAAGG + Intronic
1182787058 22:32916935-32916957 CTGTGTTGCCTGGGTGAGGAGGG + Intronic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1184389230 22:44193373-44193395 CAGCGTAGGGAGGGAGAGGATGG + Intronic
1185249223 22:49791011-49791033 CAGTGCAGTCAGGAGGAGCAGGG - Intronic
950114379 3:10441155-10441177 CAGTGTAGCCAGGGGGAGGAAGG - Intronic
950149795 3:10678078-10678100 CAGTGTAGCAACTGGGAGCATGG - Intronic
950151707 3:10692662-10692684 CAGTGTTGCCCTGGGGAGGCCGG - Intronic
950893280 3:16424100-16424122 CAGTGTAGCCATGGGGACTGGGG + Intronic
952312624 3:32203874-32203896 CAGTGAAACCAGGGAAAGGAAGG - Intergenic
952673676 3:36000796-36000818 CAGAGTGCCCAGGGGAAGGAGGG - Intergenic
952846433 3:37691410-37691432 CAGTGAAGACAGTGGGAAGATGG + Intronic
952968607 3:38636774-38636796 CGGTGCTGCCAGGGTGAGGAGGG + Intronic
953218374 3:40944323-40944345 AAGTGAAGCCAGGGGTAGGGAGG + Intergenic
953439973 3:42908699-42908721 CAGTGTCTTCAGGGGTAGGAGGG - Intronic
954553674 3:51502363-51502385 CAGTGGAGCAAGGGTGAGGGTGG - Intergenic
955112339 3:55961197-55961219 CAGTGTAGCTTGGGGGAGTAGGG - Intronic
956700233 3:71952332-71952354 CAGTGATGGCAGAGGGAGGAAGG - Intergenic
957012206 3:75020125-75020147 CAGTGTTGCCCTGGGGAAGATGG + Intergenic
957430634 3:80101172-80101194 CATTGTAGGCAGGAGGAAGAAGG + Intergenic
961335274 3:126172835-126172857 CAGTGAAGCCAGGGAGAGGCAGG + Intronic
962644262 3:137420386-137420408 CAGTGTGTCCAGGAGGAGAAGGG - Intergenic
962646937 3:137449421-137449443 AAATGTAGCCAGGGGAAGGGAGG + Intergenic
963039168 3:141056087-141056109 CATTGGAGCCAGGAGGAGGCAGG + Intronic
963043287 3:141084478-141084500 CAGGGCAGGCAGGGGGAGGGGGG - Intronic
963209167 3:142669451-142669473 CCTTGTAGCCAGGCAGAGGAAGG - Exonic
964060652 3:152518311-152518333 CAGAGTTGCCAGGAGGAGCAGGG - Intergenic
964276080 3:155010461-155010483 CAGTGAAGGAAGGGTGAGGAAGG - Intergenic
964546014 3:157834658-157834680 GAGCTTAGCCAGGGAGAGGATGG - Intergenic
966301769 3:178486877-178486899 GAGCCAAGCCAGGGGGAGGAGGG + Intronic
969282721 4:6181938-6181960 CTGTGCAGACAGGAGGAGGAGGG + Intronic
969484844 4:7466555-7466577 CACTGCAGCCAGAGGGAGAATGG - Intronic
969607157 4:8208084-8208106 GAGGGTTGCCAGGTGGAGGATGG - Intronic
970640078 4:18054271-18054293 CAAGGCAGCCAGTGGGAGGAAGG - Intergenic
970683811 4:18542500-18542522 CAGTGTAGCAGGGGAGCGGAGGG - Intergenic
972628453 4:40822952-40822974 CAGTGTGGCCAGCTGGAGGCAGG + Intronic
973736253 4:53874334-53874356 CAGGGTAGCAAGGGGCAGGGGGG + Intronic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
978998419 4:115184793-115184815 CAGTTTTGGTAGGGGGAGGAGGG + Intergenic
982275332 4:153631828-153631850 CAGTGTAGCCAGGAAGGAGAGGG - Intronic
985487126 5:158192-158214 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487145 5:158233-158255 CAGGATGGGCAGGGGGAGGAGGG - Intronic
986363570 5:7006301-7006323 CAGTGGAGCCCAGGTGAGGAGGG + Intergenic
989973701 5:50555819-50555841 CAATGAAGCCAGGGGAAGAAAGG - Intergenic
990786031 5:59420883-59420905 CAGGGTAGCAGGGGGCAGGAGGG + Intronic
991194534 5:63917165-63917187 GAGAGTAGGAAGGGGGAGGATGG - Intergenic
991227827 5:64293023-64293045 CAGAGTAGACAGGGTGAGGAGGG - Intronic
995453731 5:112330882-112330904 GAGTGTGGACAGGGTGAGGAGGG + Intronic
996431994 5:123391072-123391094 TAGTGAAGCCAGGGGAATGAAGG + Intronic
997293550 5:132755045-132755067 CCAGGAAGCCAGGGGGAGGAGGG - Intronic
997882921 5:137606301-137606323 CACTGCAGTCAGGAGGAGGATGG + Intergenic
998394718 5:141811439-141811461 GAATGAGGCCAGGGGGAGGAAGG - Intergenic
998416006 5:141946500-141946522 TGGAGTATCCAGGGGGAGGAAGG - Intronic
999099043 5:149007031-149007053 CACTGTAGCCAGGCGGTGAAAGG + Exonic
999380510 5:151117930-151117952 CAGTATTGGCAGGGGGAGGTGGG + Intronic
1002058283 5:176610741-176610763 GAGGGTATCCAGGGGGAGGGGGG - Intergenic
1002426697 5:179180943-179180965 CAGGGGAGCCAGGGAGAGGCAGG + Intronic
1002697419 5:181100246-181100268 CAGTCTAGCCAGGGGGGTGCCGG - Intergenic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1003016013 6:2468122-2468144 GAGGGTAGACAGGGAGAGGAAGG + Intergenic
1004866294 6:19856566-19856588 CAGTGGTGCCAGGAGGAGGGGGG + Intergenic
1006294508 6:33164168-33164190 CAGGGCACCCAGGGGGAGCAGGG - Intronic
1006502707 6:34468538-34468560 CAGGGCAGCCAGGGGGCAGAGGG - Intronic
1007731713 6:43951491-43951513 CAGTGCAGCCAGAGACAGGAGGG + Intergenic
1007747387 6:44051453-44051475 CAGTGGGGCCTGGGGTAGGAGGG + Intergenic
1007865944 6:44971020-44971042 CTGTGTATCCTTGGGGAGGATGG - Intronic
1008304599 6:49886180-49886202 CAGGGTAGCCAAGGGAAGAAAGG - Intergenic
1008598744 6:53068087-53068109 CAGGGCGGCCAGGGGGGGGAGGG - Intronic
1010680399 6:78792470-78792492 GAGTGTGGACAGTGGGAGGAGGG + Intergenic
1015096843 6:129425575-129425597 GAGGGTAGCTAGTGGGAGGAGGG - Intronic
1015195266 6:130518615-130518637 CAGTGTAGCCAGGAGCAGAAAGG - Intergenic
1015325502 6:131918937-131918959 CAGTGTGGGGAGGGGGTGGATGG - Intergenic
1015827865 6:137335113-137335135 GGGTGTAGCCAGGGGCAGCAAGG - Intergenic
1017127598 6:151080383-151080405 CAGGGCAGCCAGTGAGAGGATGG + Intronic
1017834491 6:158164915-158164937 CATTCTAGCAAGAGGGAGGAGGG - Intronic
1018539019 6:164856537-164856559 CAGTGGAGCCAGGGGCCGTAAGG - Intergenic
1018787454 6:167119167-167119189 CCAGGTAGGCAGGGGGAGGAAGG - Intergenic
1018923007 6:168188786-168188808 CAGTGTCCTCAGTGGGAGGATGG + Intergenic
1018998203 6:168726036-168726058 CAGAGGAGGCAGTGGGAGGAGGG + Intergenic
1019494712 7:1332380-1332402 CAGTGCAGCCTGGGCGTGGAGGG - Intergenic
1019716728 7:2542629-2542651 GAGAGTAGACCGGGGGAGGATGG - Intronic
1019788878 7:2997424-2997446 CAGGGGAGGCAGGGCGAGGATGG + Intronic
1020188079 7:5974036-5974058 CAGTGCAGCTGGGGTGAGGAAGG - Intronic
1020294839 7:6750733-6750755 CAGTGCAGCTGGGGTGAGGAAGG + Intergenic
1020334371 7:7051342-7051364 AAGTGTGGCAAGAGGGAGGAGGG + Intergenic
1020790857 7:12626839-12626861 CAGTGTATGTAGGGGGAGGGTGG + Intronic
1023728039 7:43164227-43164249 CAGAGAAGGCAGGAGGAGGAAGG + Intronic
1024921657 7:54563509-54563531 CAGTGTCCCCAGCAGGAGGAAGG + Intronic
1025227562 7:57178176-57178198 CAGTGCAGCCAGGAGCAGGCAGG - Intergenic
1025230676 7:57201620-57201642 CAGTGTGGCCAGGAGGAGGCAGG - Intergenic
1025730313 7:64102136-64102158 CAGTGCAGCCAGGAGCAGGCAGG + Intronic
1028450586 7:90977758-90977780 CAGAATAGCCAGGGGGAAGGAGG + Intronic
1030170610 7:106599156-106599178 CAGGGTAGGCAGGGAGAGGAAGG - Intergenic
1030211070 7:106996295-106996317 GAGTGCAGCCAGGGCCAGGAGGG - Intergenic
1030860653 7:114621772-114621794 CAGTGTACCCAGCGGCAGGAGGG + Intronic
1031460928 7:122047730-122047752 CAGTTAAGCCAGGGAGAGGAAGG - Intronic
1032108799 7:129057082-129057104 CAGTGTAAGAAGGGAGAGGATGG - Intergenic
1032327820 7:130948405-130948427 CAGGGGAGCTGGGGGGAGGAGGG + Intergenic
1032750340 7:134833547-134833569 CAGTGTAGCCCTGGGAAGAAGGG + Intronic
1032765923 7:134993511-134993533 CTGTGTAGTCCGGGGGAAGAAGG - Exonic
1032805352 7:135348688-135348710 CAATGTGGCCTGGGGGAGGGTGG + Intergenic
1033399948 7:141013203-141013225 CAAGATAGCCAGGAGGAGGAAGG + Intronic
1033818593 7:145106240-145106262 TGGAGTAGCCAGGGGGAGGTAGG + Intergenic
1035120271 7:156560936-156560958 CACCGGAGCCATGGGGAGGAGGG + Intergenic
1035339473 7:158151217-158151239 CAGTGTGGGCAGGGAGAGGCAGG - Intronic
1035771736 8:2153076-2153098 CAGTGTGGCCTGGGGCAGGTGGG + Intronic
1036090239 8:5657278-5657300 CAGAGAAGCCAGGTGAAGGAAGG - Intergenic
1036561751 8:9904678-9904700 CAGTGTGGAGAGGTGGAGGAGGG - Intergenic
1037383804 8:18316293-18316315 CACTGTGGCCTGGCGGAGGATGG - Intergenic
1037754691 8:21703275-21703297 CAGGGGAGCCTAGGGGAGGAGGG + Intronic
1037773153 8:21814922-21814944 GAGAGGAGCCAGGGGCAGGAAGG - Intergenic
1037796273 8:21997836-21997858 CAGTGTGGTGGGGGGGAGGAAGG + Intronic
1037803752 8:22048636-22048658 CAGTCTAGCCAGGAGGAGTTTGG - Exonic
1037959921 8:23089211-23089233 CAGGGTAGAAAGTGGGAGGAGGG + Intronic
1039407544 8:37326286-37326308 GAGGGAAGCCAGTGGGAGGAAGG - Intergenic
1042420662 8:68584881-68584903 CTGTGGAGCCAGAGGGAGAAGGG - Intronic
1043740242 8:83801890-83801912 CTGTGTAGCCTGGGGTTGGAGGG + Intergenic
1043778195 8:84297198-84297220 GAGGGTAGACAGTGGGAGGAGGG - Intronic
1045378639 8:101600786-101600808 CAGTGTGACCAGGGAGAGGCAGG + Intronic
1045622377 8:103995461-103995483 CAGTGGAGACAGAGGGAGAATGG + Intronic
1046195603 8:110859991-110860013 CAGTGGAGCCAGGGGGAGCCAGG + Intergenic
1046899433 8:119508151-119508173 CTGTGTAACAAGGGGTAGGAAGG + Intergenic
1047531811 8:125683904-125683926 AAGAGTAGCCATGGGGAAGAGGG - Intergenic
1049337418 8:142093804-142093826 CGGGGTAGACAGGGAGAGGAAGG + Intergenic
1049565322 8:143335039-143335061 CAGGGAAACCAGGGGGAGGCCGG - Intronic
1049822124 8:144641831-144641853 CAGTGCAGCCACGAGGAGGAGGG + Intergenic
1050567382 9:6900480-6900502 CAGTGGAGCCAGGGGCATGGTGG + Intronic
1051278342 9:15418056-15418078 CAGTAGAGACAGGGGGAGGGGGG - Intergenic
1052652512 9:31321930-31321952 CAGTGGAGCCAGTGGGAGCCGGG - Intergenic
1052903425 9:33814905-33814927 CAGTATAGAAAAGGGGAGGAAGG + Intergenic
1055021555 9:71675541-71675563 CAGTGGAGCCATGGGGGGCATGG + Intergenic
1059812733 9:117874033-117874055 CAGCGTAGGCAGGGGGAGCAGGG + Intergenic
1060660480 9:125402402-125402424 CTCAGTTGCCAGGGGGAGGATGG + Intergenic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061224756 9:129274703-129274725 GAGTGTTGCCAGGGGCTGGAGGG + Intergenic
1061975548 9:134066663-134066685 CAGGGTAGGGCGGGGGAGGACGG + Intronic
1062098044 9:134712685-134712707 CAGAAAAGCCAGGGGCAGGATGG - Intronic
1062111662 9:134785338-134785360 CTTTGTAGCCACCGGGAGGAAGG - Intronic
1187213681 X:17254141-17254163 CACTGTTCCCAGGGGGATGAAGG - Intergenic
1188580314 X:31703593-31703615 CAGTTTAGGCATGGGTAGGAAGG - Intronic
1189824092 X:44899184-44899206 CTGTGGAGGGAGGGGGAGGAAGG + Intronic
1190619076 X:52266989-52267011 AAGGGGAGCCAGAGGGAGGAAGG + Intergenic
1190637099 X:52446146-52446168 AAGGGGAGCCAGAGGGAGGAAGG - Intergenic
1194680131 X:96842165-96842187 TAGTGTAGCTTGGGGAAGGAGGG - Intronic
1196058017 X:111377096-111377118 AAGTGGAGGCAGGAGGAGGAGGG - Intronic
1198166785 X:134065419-134065441 CAGTGTGGGGAGGGGTAGGATGG - Intergenic
1199571277 X:149269540-149269562 CAGCTTAGCCAAGGGAAGGATGG + Intergenic
1200069542 X:153521195-153521217 CAGCTTAGCCAGGGTGGGGAAGG - Intronic
1201670611 Y:16516162-16516184 CACTGTAGCCTGGCGGGGGAAGG - Intergenic