ID: 950116007

View in Genome Browser
Species Human (GRCh38)
Location 3:10450683-10450705
Sequence GGTCCCTATGGACCAGCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 134}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950116002_950116007 -1 Left 950116002 3:10450661-10450683 CCTCACCTGGCAGGGGGAGGGGG 0: 1
1: 0
2: 5
3: 78
4: 763
Right 950116007 3:10450683-10450705 GGTCCCTATGGACCAGCACCAGG 0: 1
1: 0
2: 0
3: 9
4: 134
950115990_950116007 25 Left 950115990 3:10450635-10450657 CCAGTATGAGTTCAGGTCCATGG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 950116007 3:10450683-10450705 GGTCCCTATGGACCAGCACCAGG 0: 1
1: 0
2: 0
3: 9
4: 134
950116005_950116007 -6 Left 950116005 3:10450666-10450688 CCTGGCAGGGGGAGGGGGGTCCC 0: 1
1: 2
2: 46
3: 213
4: 949
Right 950116007 3:10450683-10450705 GGTCCCTATGGACCAGCACCAGG 0: 1
1: 0
2: 0
3: 9
4: 134
950116000_950116007 0 Left 950116000 3:10450660-10450682 CCCTCACCTGGCAGGGGGAGGGG 0: 1
1: 0
2: 4
3: 45
4: 466
Right 950116007 3:10450683-10450705 GGTCCCTATGGACCAGCACCAGG 0: 1
1: 0
2: 0
3: 9
4: 134
950115993_950116007 8 Left 950115993 3:10450652-10450674 CCATGGAGCCCTCACCTGGCAGG 0: 1
1: 0
2: 4
3: 33
4: 312
Right 950116007 3:10450683-10450705 GGTCCCTATGGACCAGCACCAGG 0: 1
1: 0
2: 0
3: 9
4: 134
950115989_950116007 26 Left 950115989 3:10450634-10450656 CCCAGTATGAGTTCAGGTCCATG 0: 1
1: 0
2: 1
3: 4
4: 112
Right 950116007 3:10450683-10450705 GGTCCCTATGGACCAGCACCAGG 0: 1
1: 0
2: 0
3: 9
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950116007 Original CRISPR GGTCCCTATGGACCAGCACC AGG Intronic
900098139 1:948685-948707 GGTCCCTTTGGCCCTGCACCTGG + Intronic
902043544 1:13509485-13509507 TCTCCCTATGGCCCAGGACCAGG + Intronic
903276949 1:22228460-22228482 TGTCCCCATGGACCAGCCCAGGG - Intergenic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
904610143 1:31721339-31721361 CTTCCCTATGGACCTGCTCCAGG - Intergenic
904832177 1:33312264-33312286 GGTCCCTAGGGCTCAGCACTGGG - Intronic
907253673 1:53161298-53161320 GTTCCCTGTGGACCAGCCACAGG - Intergenic
908385824 1:63640652-63640674 GTTCCCTGTGGGTCAGCACCAGG - Intronic
917973801 1:180225929-180225951 TGTCCCTTTGGGCCAGGACCTGG - Intergenic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
920378412 1:205521904-205521926 GTTACCCATGCACCAGCACCAGG - Intronic
920977720 1:210801478-210801500 CTTCCATCTGGACCAGCACCTGG + Intronic
1062978498 10:1702452-1702474 GGTCTCTCTGTCCCAGCACCTGG + Intronic
1063856210 10:10257002-10257024 GGTTCCTATCTACCAGCTCCTGG - Intergenic
1071458453 10:85869138-85869160 GGGCACTATGGACCAGATCCAGG + Exonic
1074782245 10:116810323-116810345 AGTGCCTGTGGACCAGGACCAGG - Intergenic
1076799272 10:132813185-132813207 TTTCCCAATGGCCCAGCACCTGG + Intronic
1076803347 10:132843275-132843297 TGTCCCTAAGGCCCAGGACCTGG + Intronic
1077631471 11:3813964-3813986 GGTCCCTCTGGAGCAGTACTAGG + Intronic
1078294772 11:10057006-10057028 GGTGCCTTTGGGCCAGCAACAGG + Intronic
1078561999 11:12380285-12380307 GGTCCCTAGGGGCTAGCAACAGG + Intronic
1081474102 11:43408469-43408491 GTTCCCACTGTACCAGCACCTGG - Intronic
1081532203 11:43969720-43969742 GGGCCCTGGGGACCAGCACCAGG - Intergenic
1081912035 11:46705791-46705813 TGTCCTTATGGATTAGCACCAGG - Exonic
1084113247 11:67026886-67026908 GGTCTGTATGGGCCATCACCAGG + Intronic
1084544924 11:69810463-69810485 GGTCCCTGTGGTCCAGCACGCGG + Exonic
1085451147 11:76634373-76634395 GGTCCCTAGTGCCCAGCACAGGG + Intergenic
1090860850 11:130651171-130651193 AGTCCCAATGCACAAGCACCTGG - Intergenic
1092956321 12:13553585-13553607 GGTCCTGTTGGACCACCACCTGG + Exonic
1093051472 12:14509675-14509697 GGACCCTAGGGATCAGGACCTGG - Intronic
1096238246 12:49944098-49944120 GGTCCCTGAGGACCACCACGTGG + Intergenic
1097712186 12:62929113-62929135 GGTTCAAAGGGACCAGCACCAGG - Intronic
1102521046 12:113477582-113477604 GGTCCCTCTGGAGCTGCAGCAGG + Intergenic
1112342726 13:98565966-98565988 GCTCCCTCTGCTCCAGCACCAGG + Intronic
1113453482 13:110430527-110430549 GGTCCCTATGGATAGGCAGCGGG - Exonic
1119411657 14:74435286-74435308 GGTGCCAATGGACAAGCATCAGG + Intergenic
1119445697 14:74661726-74661748 GGTGCCTAAGGACCACCACAGGG + Exonic
1119717174 14:76867364-76867386 GGTCCCCCTGAACCAGTACCAGG + Exonic
1125171589 15:36771583-36771605 GGTCTCTGTAGACCAGCATCTGG + Intronic
1128516909 15:68348133-68348155 CCTCCTTATGAACCAGCACCAGG + Intronic
1128606800 15:69042609-69042631 GGTCCATAGTGACCGGCACCAGG - Intronic
1130620112 15:85453524-85453546 GGTGCCTTTGGACCAGCAACAGG - Intronic
1133218587 16:4308027-4308049 GATCCCTAAGGACCTGCCCCGGG - Intergenic
1139648982 16:68352325-68352347 GACCGCTGTGGACCAGCACCTGG + Exonic
1139946705 16:70646989-70647011 GGTCCCTAGGGACCTGCATTGGG + Intronic
1143918557 17:10312946-10312968 GGTCCCTAAGGAGCACCTCCAGG + Intronic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1151514012 17:74580564-74580586 TCTTCCTGTGGACCAGCACCTGG + Intronic
1152476031 17:80518768-80518790 GGTCCCTATTAACCAGTCCCAGG + Intergenic
1152768845 17:82155432-82155454 GGTCCCCAAGGACCAGAACTAGG - Intronic
1152881851 17:82821778-82821800 GGTCCCTGTGAACCTGCATCAGG + Intronic
1153545511 18:6201036-6201058 AGTGCCTATGGAATAGCACCTGG - Intronic
1155236652 18:23826707-23826729 AGTCCCTGGGGAGCAGCACCAGG - Exonic
1158417135 18:57258419-57258441 GGTGCCCATGGACCAGAACAGGG - Intergenic
1159104853 18:63994175-63994197 TTTCCCCATGGAACAGCACCAGG - Intronic
1160390446 18:78527502-78527524 GGTCTCTAGGGTCCAGCACGGGG - Intergenic
1161206562 19:3044338-3044360 GCTCCCTATGCCCCAGCTCCTGG + Intronic
1166123576 19:40700336-40700358 GGTCCCCCTGGACCAGTGCCAGG - Exonic
1167618061 19:50547065-50547087 GGTCCCCATGCACCTGCCCCCGG - Intronic
1168228988 19:55016724-55016746 GGTTCCCATGGCCCAGCACATGG - Intronic
927841958 2:26450383-26450405 GATCCATATGGAGCAGCTCCTGG + Intronic
928077833 2:28281228-28281250 GGTCCCTATGGAGGAGGACAAGG + Intronic
932023606 2:68112693-68112715 CCTCCCTAAGGATCAGCACCAGG + Intergenic
938849686 2:135247999-135248021 GGTGCCTTTGGACCAGCAACAGG + Intronic
948047020 2:234952398-234952420 GGTCCCTGCCCACCAGCACCAGG - Intronic
1169205554 20:3738299-3738321 GGTCACTATCTCCCAGCACCTGG + Intronic
1170032365 20:11956548-11956570 GGTCCCCAAGGACCTGCACGGGG + Intergenic
1175240359 20:57543086-57543108 GGCCACTATGAACAAGCACCTGG + Intergenic
1175991699 20:62793122-62793144 AGTCCCTGTGGACCCTCACCTGG - Intergenic
1176048634 20:63105179-63105201 GGTCTCTCTGGGCCAGCCCCTGG + Intergenic
1176706035 21:10120491-10120513 GGTCCCTGGGGACCAGCGCAAGG - Intergenic
1176707044 21:10124891-10124913 GGTCCCTGGGGCCTAGCACCGGG - Intergenic
1179438185 21:41376188-41376210 GGTCTCTGTGGCTCAGCACCAGG - Intronic
1183587829 22:38763100-38763122 GGTGCCCATGAACCAGCCCCTGG + Intronic
1183618562 22:38959647-38959669 GGTCAAGATGGACCAGCACAGGG + Exonic
1183623765 22:38989571-38989593 GGTCCTGATGGACCAGCACATGG + Exonic
950116007 3:10450683-10450705 GGTCCCTATGGACCAGCACCAGG + Intronic
953688235 3:45094860-45094882 CGTCCCTTTGGACCAGCCTCAGG - Intronic
954076801 3:48187788-48187810 CGTCACTATGGACCAGCTGCAGG - Exonic
957997933 3:87714913-87714935 GGGCTCTATGGACTAGCATCAGG - Intergenic
958012352 3:87896140-87896162 GGTCCCTGTTGAGCAGCACTGGG - Intergenic
960126568 3:114005153-114005175 GGTCCACATGGAGCAGCCCCTGG - Intronic
960685207 3:120288032-120288054 GGTGCCTTTGGGCCAGCAACAGG + Intergenic
961449219 3:126994955-126994977 GGTCCCCAGGGCCCAGCTCCAGG - Intronic
962444736 3:135454475-135454497 GGTGCCTGTGGACCCACACCTGG + Intergenic
962760973 3:138513560-138513582 TTTCCCTATGGAATAGCACCAGG - Intronic
966759907 3:183408468-183408490 GGTCCCTAGGGGCCAGAACCAGG - Intronic
969440218 4:7212592-7212614 GTTTCCCATGGACCAGGACCTGG - Intronic
973374645 4:49278379-49278401 GGTCCCTGAGGCCCAGCACGAGG - Intergenic
973382766 4:49331862-49331884 GGTCCCTGAGGCCCAGCACGAGG + Intergenic
986093332 5:4532687-4532709 GGTACCTCTGGAGCAGCGCCTGG + Intergenic
990557266 5:56949912-56949934 GGTCCTTATGGACCTGCTACAGG + Intronic
991616583 5:68503045-68503067 AGTCCATATGGACCAGCTCCTGG + Intergenic
992140364 5:73790503-73790525 GGTCCCTACTGAGCAGCAGCTGG - Intronic
993768863 5:91899087-91899109 GGACCCTATGGAGCAGCAGATGG - Intergenic
995428611 5:112050252-112050274 GGTTCCTTTGGGCCAGCAACAGG + Intergenic
998260981 5:140631870-140631892 GGGCCCCTTGGAGCAGCACCAGG + Exonic
998285980 5:140861365-140861387 GGTCCCTATTGCGCAGGACCTGG + Intronic
999136441 5:149323014-149323036 GATCCCTATGCAGCAGTACCAGG + Intronic
1001801841 5:174551262-174551284 GGTGCCTGTGGACAAACACCAGG - Intergenic
1002044065 5:176532323-176532345 GGCCCCCATGCCCCAGCACCAGG + Intronic
1005831291 6:29673078-29673100 GGGTCCTATGGCCCAGAACCAGG - Exonic
1006444744 6:34073935-34073957 GGGGCCTATGGTCCAGCAACTGG + Intronic
1018868995 6:167767305-167767327 GGTGCCTTTGGACCAGCTGCTGG - Intergenic
1019196726 6:170287477-170287499 GGTCCCCATGAGCCAGAACCAGG + Intronic
1021175887 7:17449471-17449493 GGTGCCTTTGGGCCAGCAGCAGG - Intergenic
1023843533 7:44109210-44109232 GGTCCCTGTGGGGCAGCATCTGG + Intronic
1024924968 7:54602666-54602688 GGGTCCTATGGACTAGCAACTGG + Intergenic
1027185045 7:75965984-75966006 GGGCCCAGTGGCCCAGCACCCGG - Intronic
1028177007 7:87671623-87671645 GGTGCCTTTGGGCCAGCAACAGG - Intronic
1033186580 7:139231868-139231890 GGTCCTTAAGCACCAGCTCCAGG - Exonic
1033609790 7:142954183-142954205 GGTCACTATCGACCAGCTCAAGG - Exonic
1037819883 8:22130492-22130514 GCTCCCCATGGGCCAGCTCCGGG + Exonic
1039867442 8:41517765-41517787 GGTCCCACTGAGCCAGCACCAGG - Intergenic
1044162403 8:88935825-88935847 GGTGCCTCTGGACCAGTAACAGG + Intergenic
1047497169 8:125416701-125416723 GCCCCCCATGGACCAGCCCCTGG - Intergenic
1049046314 8:140154816-140154838 TGTCCCTATTGTCCAGCACATGG + Intronic
1051188881 9:14489614-14489636 TGTCCCTATGGAGGAGAACCAGG - Intergenic
1053643308 9:40107608-40107630 GGTCCCTGGGGACCAGCGCAAGG - Intergenic
1053644074 9:40110995-40111017 GGTCCCTGTGGCCCAGCGCAAGG - Intergenic
1053644346 9:40112046-40112068 GGTCCCTGGGGCCTAGCACCGGG - Intergenic
1053761812 9:41353441-41353463 GGTCCCTGGGGCCTAGCACCGGG + Intergenic
1053762080 9:41354490-41354512 GGTCCCTGTGGCCCAGCGCAAGG + Intergenic
1053762844 9:41357882-41357904 GGTCCCTGGGGACCAGCGCAAGG + Intergenic
1054324166 9:63704836-63704858 GGTCCCTAGGAACCAGCGCAAGG - Intergenic
1054325195 9:63709289-63709311 GGTCCCTGGGGCCTAGCACCGGG - Intergenic
1054540405 9:66264561-66264583 GGTCCCTGGGGCCTAGCACCGGG + Intergenic
1054540674 9:66265606-66265628 GGTCCCTGTGGCCCAGCGCAAGG + Intergenic
1054541447 9:66268995-66269017 GGTCCCTGGGGACCAGCGCAAGG + Intergenic
1055871530 9:80886319-80886341 TCTGTCTATGGACCAGCACCTGG + Intergenic
1057415329 9:94856946-94856968 CGTCCCCAAGGACAAGCACCTGG - Intronic
1057872703 9:98730376-98730398 GGTCCCCACGCACCAGTACCAGG - Intergenic
1059023676 9:110602330-110602352 GGTCCCTATGGGCAGACACCTGG + Intergenic
1060018353 9:120106916-120106938 GGTTCCAATGGACCAGCAAAGGG + Intergenic
1062508985 9:136894510-136894532 GATCCATAGGGACCAGCACCGGG + Intronic
1202791068 9_KI270719v1_random:90579-90601 GGTCCCTGGGGACCAGCGCAAGG - Intergenic
1202791789 9_KI270719v1_random:93764-93786 GGTCCCTGGGGCCTAGCACCGGG - Intergenic
1192891849 X:75398954-75398976 GGTGCCTTTGGGCCAGCAACAGG + Intronic
1193498071 X:82238280-82238302 AGTGCCTTTGGACCAGCAACAGG - Intergenic
1193739739 X:85203218-85203240 GGTGCCTTTGGTCCAGCAACAGG - Intergenic
1193984107 X:88219478-88219500 GGTCCAAATGGAACAGCAGCCGG - Intergenic
1194213119 X:91092906-91092928 GGTGCCTTTGGGCCAGCAACAGG - Intergenic
1196932575 X:120696137-120696159 GGTGCCTTTGGGCCAGCAACAGG + Intergenic
1200145310 X:153923320-153923342 GGTCCCCATGCAACAGCCCCTGG - Intronic