ID: 950116386

View in Genome Browser
Species Human (GRCh38)
Location 3:10452803-10452825
Sequence CCTTCTGTCCAGAAGGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 215}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950116380_950116386 30 Left 950116380 3:10452750-10452772 CCAGAACAGGCTTTGCTTACTCA 0: 1
1: 0
2: 1
3: 14
4: 126
Right 950116386 3:10452803-10452825 CCTTCTGTCCAGAAGGAACTTGG 0: 1
1: 0
2: 2
3: 21
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950116386 Original CRISPR CCTTCTGTCCAGAAGGAACT TGG Intronic
900366120 1:2312640-2312662 CTTCCTGGCCAGAAGGAAGTGGG - Intergenic
901019323 1:6247987-6248009 CCTGAGGGCCAGAAGGAACTGGG + Exonic
902050424 1:13560054-13560076 CCTTCTATAGAGAAGTAACTTGG + Intergenic
902659244 1:17889976-17889998 CCTTCTGGGCAGAAAGAAGTGGG + Intergenic
906670728 1:47652522-47652544 TCTTCTGTCCAGTGGGAACTCGG + Intergenic
910108743 1:83659390-83659412 CCTTCTAAGCAGAAGGCACTGGG + Intergenic
910519691 1:88105824-88105846 CCTCCTGCCCAGAAGGAAAATGG + Intergenic
911103597 1:94112899-94112921 CCTTTTGTCTAGAAAGATCTTGG - Intronic
913377897 1:118174783-118174805 CCTGCAGGCCAGAAGGCACTGGG + Intronic
915878583 1:159641488-159641510 AGTTATGTCCAGAAGGAACCAGG - Intergenic
916100342 1:161388837-161388859 CCTTGTGGCCAGAAGAAGCTAGG + Intergenic
916351939 1:163860446-163860468 CCTTCTGAGCATGAGGAACTAGG + Intergenic
917312255 1:173690126-173690148 TCTTAGGTACAGAAGGAACTGGG + Intergenic
920256981 1:204662106-204662128 CCTTCTGTCCAACAGGAAGAAGG + Intronic
920276388 1:204808092-204808114 GCTTCAGTGCAAAAGGAACTTGG - Intergenic
920310331 1:205044548-205044570 CCCTCTGCTCAGAAGGAGCTGGG + Intronic
922391038 1:225141645-225141667 CCCTCTGTCTAGATGGAAATGGG - Intronic
923306939 1:232697135-232697157 GCTGCAGTCCATAAGGAACTTGG - Intergenic
923439903 1:234007402-234007424 CCTTCTCCGCAGGAGGAACTTGG - Intronic
924459661 1:244247769-244247791 CCTTCAGGCCACAATGAACTGGG - Intergenic
1064074391 10:12257302-12257324 CCTTCTGTCCTGATGACACTGGG + Intergenic
1067082797 10:43221136-43221158 CCCTCTGCTCTGAAGGAACTTGG + Intronic
1067174251 10:43931291-43931313 CCCCCTTTCCAGAAGGCACTGGG - Intergenic
1069526850 10:69180197-69180219 CCTGCTGTCCAGAAAGACCCAGG - Intergenic
1073339803 10:102735973-102735995 CCTGCTGTCCAGAAGGAGACAGG + Intronic
1074950513 10:118329747-118329769 TCTTCTATGTAGAAGGAACTGGG - Intronic
1075189629 10:120294968-120294990 CCTTCTAACCAGAAGGAATCAGG - Intergenic
1075219194 10:120569691-120569713 CTTTCTGTCCCCAAGGACCTTGG + Intronic
1076010560 10:126984908-126984930 CCTTCTGTCTAACAGAAACTCGG + Intronic
1076383428 10:130040205-130040227 CCTTCAGCCCAGCAGGGACTGGG - Intergenic
1076586193 10:131549273-131549295 CCTTCTGTGCAGCAGGTCCTGGG - Intergenic
1079455268 11:20630933-20630955 CCCTCTGTAAAGAAGGACCTGGG - Intronic
1079939577 11:26662135-26662157 CTTTCTCTCCAGAAGAAACATGG + Exonic
1083404513 11:62447329-62447351 CCTTCTGCCCAGTGGGATCTAGG + Intronic
1084418834 11:69050027-69050049 TCCTCTGTCTGGAAGGAACTGGG + Intronic
1086501107 11:87454678-87454700 TCCTCTGTCCAGAAGAAAATTGG + Intergenic
1088157801 11:106829883-106829905 CCTTCAGTCCTGAAGGATCTGGG - Intronic
1088344728 11:108810105-108810127 CCATCTATTCAGATGGAACTCGG - Intronic
1088741431 11:112770537-112770559 TCTTCTGTAGATAAGGAACTAGG - Intergenic
1088923080 11:114275954-114275976 CCTTCTTTCCAGAGAGAAGTGGG + Intronic
1089988456 11:122835616-122835638 CCTTATGTCTAGAAGCCACTGGG - Intergenic
1092405303 12:8217817-8217839 CCTTAGGTCCAGGAGGCACTAGG - Intergenic
1094183099 12:27613056-27613078 CCATCTCTCCAGAAGAAATTAGG + Intronic
1095987655 12:48010381-48010403 CCTTTTTTCCAGTAGGAATTGGG + Intergenic
1097200214 12:57272094-57272116 CATTCTGTATAGAAGAAACTAGG + Intronic
1099366179 12:81767269-81767291 CCTTCATTCCTGAAGGATCTAGG - Intergenic
1100027131 12:90144412-90144434 ACTTCATTCAAGAAGGAACTCGG - Intergenic
1102613146 12:114130212-114130234 CTTGCTGTCCAGAAGGTTCTGGG - Intergenic
1103167837 12:118785461-118785483 CATACTATCCAGAAGGAAATGGG + Intergenic
1104185156 12:126423497-126423519 CCTTCATTCCTGAAGGATCTGGG + Intergenic
1105624948 13:22103720-22103742 CCTTCTGTCCAGAATGTTTTTGG + Intergenic
1106487378 13:30184475-30184497 TCATCTGGCCAGAAGGAACTGGG - Intergenic
1111183217 13:84695387-84695409 CCTTCAATCCAGAAGAGACTGGG + Intergenic
1111954961 13:94746746-94746768 CCTTCTATCCACAAGGACTTAGG + Intergenic
1112711901 13:102138712-102138734 CCTCCTGAACAGAAGGAGCTGGG + Intronic
1113020081 13:105875298-105875320 ACTTCTGTCCAGAAGGTACCTGG - Intergenic
1115130939 14:30051147-30051169 CCTTCTTTCCCGAAGGGTCTGGG - Intronic
1117160893 14:52988445-52988467 ACATCTGCCCAGAAGGAAATTGG - Intergenic
1117385943 14:55212891-55212913 CCTTCTGTGCACAATGAGCTTGG + Intergenic
1120130458 14:80800593-80800615 CCTCTTGTCTAGAAGGAACATGG - Intronic
1122179758 14:99946611-99946633 CCTTCCTTCAAGAGGGAACTTGG - Intergenic
1125002378 15:34784967-34784989 CCTTCTTTCCTGAAGAAGCTAGG + Intergenic
1125378019 15:39054306-39054328 CCTTCTCTCCTGGAAGAACTTGG - Intergenic
1126769423 15:52040262-52040284 CCTTCTGTCCAAAAGCAACTGGG + Intronic
1127358405 15:58223804-58223826 CCTTTTGTCCAGAAGAACCTGGG - Intronic
1127374755 15:58374279-58374301 CCTTCTGTCCAGCAGAATGTTGG + Intronic
1128089140 15:64907117-64907139 CCCTCTCTCCATAAGGAAATAGG - Intronic
1128762974 15:70230453-70230475 CCTTCTCTCCAGAACCCACTGGG + Intergenic
1129303889 15:74644256-74644278 TCTTGAGGCCAGAAGGAACTTGG - Intronic
1129776171 15:78237811-78237833 ACTTCTGACCTGAAGGAGCTGGG - Intronic
1130386566 15:83417183-83417205 CCTTCTGAGAAGAAGAAACTTGG - Intergenic
1131918679 15:97300128-97300150 CCTTCTGTACAAAAGCTACTTGG - Intergenic
1135334945 16:21593355-21593377 CCTGTAGTCCAGGAGGAACTTGG + Intergenic
1137652423 16:50131928-50131950 CCTTCATTCCTGAAGGACCTGGG + Intergenic
1138623334 16:58229895-58229917 CCTACTGTGCATAAGGCACTGGG + Intergenic
1138664801 16:58556897-58556919 CCTTTTGTACAGAGGAAACTGGG - Exonic
1138803863 16:60069571-60069593 TGTTCTGTGCAGAAGGAAGTTGG + Intergenic
1139850813 16:69950876-69950898 CCTTCTGGTGAGCAGGAACTGGG - Intronic
1140372727 16:74421760-74421782 CCTTCTGGTGAGCAGGAACTGGG + Intronic
1141711030 16:85699097-85699119 CCTTATCTCCTAAAGGAACTGGG - Intronic
1141915056 16:87090122-87090144 CCATCTGTCCAGAAGCAGCATGG - Intronic
1142511340 17:395635-395657 CTTTCTGACCTCAAGGAACTTGG + Intergenic
1143413543 17:6728050-6728072 CCTGCTGTCCAGAAGGCAGCAGG - Intergenic
1144117526 17:12113245-12113267 ACTTCTGTCCAGAAGAATATTGG - Exonic
1144879043 17:18421516-18421538 CCTCCTTTCCAGAAGGTTCTAGG + Intergenic
1145153194 17:20522878-20522900 CCTCCTTTCCAGAAGGTTCTAGG - Intergenic
1145823934 17:27862341-27862363 CCTTATGTCCGTAAGAAACTGGG + Intronic
1146686565 17:34845228-34845250 CCTTCTTCCCAGAAGGTCCTAGG - Intergenic
1148044874 17:44737281-44737303 CCTGCTGTCCAAGAGGAACCAGG - Intronic
1149679575 17:58495917-58495939 CCTTCTGCCCAGGATGAGCTGGG - Exonic
1150363089 17:64555129-64555151 TTTTCTGTCCAGAAAGAACTAGG - Intronic
1151152093 17:72097106-72097128 CCTCCTCTCCTGCAGGAACTGGG - Intergenic
1151285153 17:73105595-73105617 CCCCATGTGCAGAAGGAACTGGG - Intergenic
1151976590 17:77487111-77487133 CCTCCTGTCCAGAAAGCACAAGG + Intronic
1152883420 17:82833590-82833612 CCTCCTGGCCAGCAGGAACCGGG - Intronic
1155320830 18:24617336-24617358 CCTAATGCCCAGAAGGCACTTGG - Intergenic
1155642561 18:28037004-28037026 CTTTCTCTAAAGAAGGAACTTGG + Intronic
1156396294 18:36703128-36703150 CCTTCAGGCCTGAAGAAACTTGG + Intronic
1157574173 18:48732647-48732669 CCTCATGTCCAGAAGGAGCTGGG - Intronic
1160077072 18:75687961-75687983 CCTGCTACCAAGAAGGAACTTGG + Intergenic
1160113570 18:76056668-76056690 CCTCCTGTCCAAATGGAATTCGG - Intergenic
1161797373 19:6394905-6394927 AGTTGTGGCCAGAAGGAACTGGG + Intergenic
1163132045 19:15280368-15280390 CCTTCTCTGCAGAAGCAGCTGGG + Exonic
1164874081 19:31670990-31671012 CCTGCTCTCCGGATGGAACTCGG + Intergenic
1166538581 19:43591498-43591520 CCTTCTGTCCTGAAGGGAGTTGG - Exonic
1166713041 19:44949216-44949238 CCTTCAGCACAGAAAGAACTTGG - Exonic
925880485 2:8348424-8348446 CTTTCTGTCCAGGAGAACCTGGG - Intergenic
926043118 2:9690586-9690608 CATGCTGGCCAGAAGGAGCTGGG + Intergenic
926398273 2:12468174-12468196 CCTTCTATCCAGAAGGTGCTAGG + Intergenic
927946577 2:27138332-27138354 CCTTGAATCCAGAAGGAACTGGG + Exonic
928667052 2:33559929-33559951 CCTTCAGTGAGGAAGGAACTAGG - Intronic
929031328 2:37652295-37652317 CGTTCTGCCCAGAAGGAAGAAGG + Intronic
929269565 2:39958927-39958949 CCTTCATTCCTGAAGGATCTGGG + Intergenic
932343845 2:70983048-70983070 CCTTCCTTCCAGCAGGCACTGGG + Intronic
935826494 2:106956579-106956601 TGTTCTCTCCAGCAGGAACTAGG - Intergenic
936044258 2:109174098-109174120 CCTGCTGTCCTGAAGCCACTGGG - Intronic
936084716 2:109459429-109459451 CCTTCATTCCTGAAGGGACTGGG + Intronic
938297598 2:130188113-130188135 CCTTGTTTCCAGAAGGGACTGGG + Intronic
938459173 2:131486551-131486573 CCTTGTTTCCAGAAGGGACTGGG - Intronic
938583937 2:132670769-132670791 CCTTCTGTCAAGAACCAGCTCGG + Intronic
938851878 2:135268592-135268614 CCTTCTGTCCAAAATTAGCTTGG + Intronic
938986784 2:136584232-136584254 CCTTGTGTCCTCATGGAACTGGG + Intergenic
940537357 2:154962048-154962070 CCTTATGTCTAGATGGGACTGGG + Intergenic
942946735 2:181681352-181681374 TTTTCTGTACTGAAGGAACTGGG - Intergenic
943239019 2:185361104-185361126 ACTTCATTCCAGAAGGGACTGGG + Intergenic
945925865 2:215804018-215804040 CATCCTGTACAGCAGGAACTCGG - Intergenic
946485596 2:220098027-220098049 CCATGTTTGCAGAAGGAACTGGG + Intergenic
946527568 2:220537800-220537822 CCTTCGTTCCTGAAGGATCTGGG + Intergenic
947890775 2:233617264-233617286 CTCTCTGTCCAGAAAGAAATTGG - Intergenic
947892387 2:233636095-233636117 CTCTCTGTCCAGAAAGAAATTGG - Intronic
948278154 2:236725828-236725850 CCTTCTGTCCACAAGGGTCACGG - Intergenic
948600389 2:239104600-239104622 CCGTCTGTCCAGAGGGAACTTGG - Intronic
1168959236 20:1857452-1857474 TCTGCTCTCCAGAGGGAACTTGG - Intergenic
1170595510 20:17802551-17802573 CTTACTGTCCATAAGGAATTAGG + Intergenic
1173051940 20:39571739-39571761 CCTTCTTTGCAGAGGGATCTGGG + Intergenic
1173212784 20:41049775-41049797 TCTTCTGTCCTTAAGGAAGTTGG - Intronic
1174087250 20:48018180-48018202 CCTCCTGTCCAGAAGGCCCTTGG + Intergenic
1174129033 20:48328788-48328810 CCTCCTATCCAGAAGGCCCTTGG - Intergenic
1174249415 20:49207330-49207352 CCTTCTGTCCTGGAGGAGCCAGG + Intergenic
1174701879 20:52617329-52617351 TCTTTTGACCAGAAGGCACTTGG - Intergenic
1175383182 20:58577522-58577544 TCTTCTGGCCAGAAGGCACAGGG + Intergenic
1176108936 20:63402472-63402494 CCTTCTCTCTAGAAAGAGCTGGG - Intergenic
1178330624 21:31687683-31687705 CTTTGTGTCCTGAAGAAACTTGG - Intronic
1178678470 21:34651488-34651510 CATTCTGACCATATGGAACTTGG - Intergenic
1178736476 21:35157127-35157149 CCTTCATTCCAGAAGGGTCTGGG + Intronic
1179345712 21:40554970-40554992 CCTTCTGTGCACTAGGTACTGGG - Intronic
1181011039 22:20040777-20040799 ACTTCTGCCCAGAAGGGACATGG + Intronic
1181991836 22:26842707-26842729 CCTTCTGTCCATACAGAACAGGG + Intergenic
1182713941 22:32340317-32340339 CCTTCTGTGCACAAGGCACTGGG + Intergenic
1183759144 22:39799768-39799790 CCTCCTGTCCACAATGACCTGGG + Intronic
1184401253 22:44275901-44275923 CCTTCTGTGCACAAGGCACGGGG + Intronic
1185101855 22:48844806-48844828 CCTTCTGTCCACAAGTATTTGGG + Intronic
950116386 3:10452803-10452825 CCTTCTGTCCAGAAGGAACTTGG + Intronic
951586762 3:24222632-24222654 CCTTCTGCCCTCAAGGAATTTGG + Intronic
954133952 3:48573512-48573534 CCTTCAGGCCAGAAGGTCCTTGG + Exonic
954989235 3:54825255-54825277 CCTTCTGTGTAGAAGGAAGAAGG - Intronic
956933924 3:74078106-74078128 CCTTCTGTCAGAACGGAACTTGG - Intergenic
957816220 3:85300981-85301003 ATTTCTTTCCAGTAGGAACTTGG - Intronic
963765682 3:149333753-149333775 CCTTGTGTTAAGAAGGAAGTTGG + Exonic
966498656 3:180611417-180611439 TGTTCAGTCCAGAAGGCACTAGG + Intronic
966745532 3:183272257-183272279 CCTTCACTACAGAAAGAACTAGG + Exonic
969116529 4:4873784-4873806 CCTTCATTCCAGGAGGAACAGGG + Intergenic
969302087 4:6303066-6303088 CCTCCTGTCCAGCAGGTAGTGGG + Exonic
969760811 4:9180154-9180176 CCTTAGGTCCAGGAGGCACTAGG + Intergenic
971306419 4:25486153-25486175 TCTTCAGTCCTGAATGAACTAGG + Intergenic
975623391 4:76316774-76316796 CCTACAAGCCAGAAGGAACTGGG + Intronic
976392675 4:84521981-84522003 CCATCTGTCCACAAGGCAGTAGG + Intergenic
978485679 4:109251354-109251376 CCTTCATTCCTGAAGGATCTAGG + Intronic
979380519 4:120000773-120000795 CCTTTTGTTCAGAAAGCACTGGG - Intergenic
979456407 4:120930392-120930414 CCTTCTGGCCACCAGAAACTGGG + Intergenic
980718004 4:136653375-136653397 ACGTCTGTTCAGAAGAAACTTGG + Intergenic
983095109 4:163552285-163552307 CCATGTGTCCAGATGGACCTGGG + Intronic
983741508 4:171140022-171140044 ACTTCTGTCAATAAGGATCTAGG + Intergenic
984463092 4:180059606-180059628 CCTTCCGTGCAGAAGGAGCAAGG - Intergenic
985828137 5:2207905-2207927 CCTTCTTTCCAGAGTGAACTTGG + Intergenic
986500154 5:8390305-8390327 CCTTCTGCACAGTAAGAACTGGG - Intergenic
986861140 5:11927880-11927902 CCTTCTTGCCCAAAGGAACTGGG + Intergenic
988524432 5:31974688-31974710 CATACTGCCCTGAAGGAACTGGG - Intronic
992467400 5:77020397-77020419 ACATCTGTCCATAAGTAACTCGG + Intergenic
993398480 5:87420068-87420090 CCTTCATTCCTGAAGGATCTGGG + Intergenic
995073875 5:107958462-107958484 CTTTCTTTTCAGAAGGAAGTAGG - Intronic
998290072 5:140906672-140906694 CCTTCATTCCTGAAGGATCTGGG + Intronic
998353486 5:141515983-141516005 CCCTCTGTCTACAAGGAAATGGG - Exonic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
999624176 5:153502644-153502666 CCTGCTGTCCAGAAAGCACAGGG + Intronic
999629117 5:153551920-153551942 CCTTCTTTCTTGAAGGAATTAGG - Intronic
1002056038 5:176598324-176598346 CCTGCTGTCCCCAAGGACCTGGG + Exonic
1002645768 5:180653186-180653208 CCATCTGTGGAAAAGGAACTTGG + Intergenic
1006414528 6:33895618-33895640 CCTTCTGCCCAGAGGGAATTTGG - Intergenic
1007744049 6:44031299-44031321 CCTCCTGTCCCGAAGGAATGAGG - Intergenic
1008296685 6:49786770-49786792 TCTTCTTTCCAGAGGGATCTTGG + Exonic
1009278662 6:61719053-61719075 CCTTCTGTGGAGAATGTACTAGG - Intronic
1009296133 6:61950334-61950356 GCATCTGTTCAGAAGGAAGTTGG - Intronic
1009650253 6:66467087-66467109 CCATATGTCCACAAGGAACTTGG + Intergenic
1014538615 6:122647896-122647918 CCTTCATTCCTGAAGGGACTGGG + Intronic
1015214641 6:130735566-130735588 CCTTCTGTCTATAAAGAACCAGG + Intergenic
1015511835 6:134045417-134045439 GCTTCTTTCCAGGAGGAACCTGG + Intronic
1015673983 6:135724249-135724271 CCTTGTATCCAGAAGCAACCAGG + Intergenic
1016530468 6:145053658-145053680 CCTACTGTCCAGTTGGAACATGG + Intergenic
1018055816 6:160051381-160051403 GCTTCTTTCCAAAAGAAACTCGG - Intronic
1018904000 6:168064702-168064724 CCTTCTGTCCTGAAGGCCCAAGG - Intronic
1019900751 7:4019067-4019089 CCTGTTGTACAGAAGGCACTGGG - Intronic
1023399302 7:39780244-39780266 GCTTCTGTAGAGAAGGAACCAGG + Intergenic
1023759326 7:43449280-43449302 CAGTCTGTCCACAATGAACTGGG + Intronic
1024651148 7:51404464-51404486 GCTTCTGTAGAGAAGGAACCAGG - Intergenic
1026093759 7:67324113-67324135 CCTTCTGTCTACACGGTACTAGG - Intergenic
1029115769 7:98236369-98236391 CCTTCTGTCCAGGGGAAACAAGG - Intronic
1030376415 7:108757540-108757562 CCTACAATCCAGAAGAAACTGGG + Intergenic
1033608109 7:142942169-142942191 CCTCCTCTCCTGGAGGAACTTGG + Intronic
1035478340 7:159159502-159159524 CTGTCTTTCCAGATGGAACTGGG - Intergenic
1036845695 8:12168764-12168786 CCTTAGGTCCAGAAGGCACTAGG - Intergenic
1036867063 8:12411083-12411105 CCTTAGGTCCAGAAGGCACTAGG - Intergenic
1037478445 8:19280228-19280250 CCTGCTGACCAGAAGGAATTTGG - Intergenic
1037881732 8:22576837-22576859 CCCTCTGTCCTGACAGAACTGGG - Intergenic
1038813126 8:30871986-30872008 CCTTCTGTAAAGAAGTAGCTGGG + Intronic
1040003507 8:42598977-42598999 TCTCCTGTCCTGAAGGAGCTTGG - Intergenic
1040481314 8:47830680-47830702 GCTTCTGTACAGAACGACCTGGG + Exonic
1041758745 8:61341237-61341259 CATTCTGTCTGGAGGGAACTGGG + Intronic
1043640730 8:82447218-82447240 CCCTCTGTCCAGAATAACCTAGG + Intergenic
1044500754 8:92952760-92952782 CCTTCTATCCAGAGGGAAAGGGG - Intronic
1046500478 8:115070087-115070109 CCTTCAGTCCTGAAGGGTCTGGG - Intergenic
1047771135 8:128031051-128031073 CCCTCAGTCCAGGAGCAACTTGG + Intergenic
1049375808 8:142288534-142288556 CCTTCTGCCCAGGAGGACCCGGG - Intronic
1051878628 9:21817339-21817361 ACTTCTGACCAACAGGAACTAGG - Intronic
1052388674 9:27852475-27852497 CCTTCTGTCAGGCAGGTACTAGG + Intergenic
1052561319 9:30088117-30088139 CCTTCATTCCTGAAGGATCTGGG + Intergenic
1053303627 9:36969059-36969081 CCTTCTGACAAGGAGGAACTTGG - Intronic
1056462835 9:86824821-86824843 CCTGTTGTCCATAAGGAAGTGGG + Intergenic
1056884785 9:90430891-90430913 CCTTTTGTTCAGAAGGCCCTGGG - Intergenic
1057100343 9:92353378-92353400 CCTTCATTCCTGAAGGATCTGGG + Intronic
1059994658 9:119897058-119897080 CCTTATGGACAGAAGGGACTGGG - Intergenic
1186991066 X:15068552-15068574 TGTTTTGTCCAGTAGGAACTTGG + Intergenic
1187448604 X:19378085-19378107 CCTCTTGGGCAGAAGGAACTTGG - Intronic
1187479583 X:19643027-19643049 TCTTCTGGCCAGAAGGAAGAGGG + Intronic
1190414395 X:50166993-50167015 ACTTTTCTCCAGAAGGATCTGGG - Intergenic
1192705485 X:73525436-73525458 ACTTCTGTCCAGAAGAATATTGG + Intergenic
1194016414 X:88626459-88626481 CCTACAGGCCAGAAGAAACTGGG + Intergenic
1194233105 X:91348163-91348185 CCTTCATTCCTGAAGGATCTGGG - Intergenic
1200838346 Y:7754631-7754653 CCTTCTGTCCAGGAGAAGTTTGG - Intergenic