ID: 950117001

View in Genome Browser
Species Human (GRCh38)
Location 3:10457434-10457456
Sequence TCTTTCCCACACACAAAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 273}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950117001_950117006 12 Left 950117001 3:10457434-10457456 CCGTGCTTTGTGTGTGGGAAAGA 0: 1
1: 0
2: 3
3: 20
4: 273
Right 950117006 3:10457469-10457491 TGTATCAGTGGACATGTGGTTGG 0: 1
1: 0
2: 0
3: 16
4: 200
950117001_950117005 8 Left 950117001 3:10457434-10457456 CCGTGCTTTGTGTGTGGGAAAGA 0: 1
1: 0
2: 3
3: 20
4: 273
Right 950117005 3:10457465-10457487 ATGATGTATCAGTGGACATGTGG 0: 1
1: 0
2: 0
3: 14
4: 167
950117001_950117004 0 Left 950117001 3:10457434-10457456 CCGTGCTTTGTGTGTGGGAAAGA 0: 1
1: 0
2: 3
3: 20
4: 273
Right 950117004 3:10457457-10457479 GGGTCTCTATGATGTATCAGTGG 0: 1
1: 0
2: 0
3: 6
4: 113
950117001_950117007 30 Left 950117001 3:10457434-10457456 CCGTGCTTTGTGTGTGGGAAAGA 0: 1
1: 0
2: 3
3: 20
4: 273
Right 950117007 3:10457487-10457509 GTTGGTGTGAGTGACCCCAAAGG 0: 1
1: 0
2: 0
3: 5
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950117001 Original CRISPR TCTTTCCCACACACAAAGCA CGG (reversed) Intronic
901078058 1:6567878-6567900 TCTTTGCCGCACTTAAAGCAGGG + Intronic
903415231 1:23177811-23177833 CCTTTCCCACCCACCAGGCAGGG + Intergenic
904051907 1:27645068-27645090 GCTTTGCCAAACACAAAGCAGGG + Intergenic
904694420 1:32320509-32320531 ACTTTCCCAGTCACACAGCAAGG + Intronic
905293445 1:36939157-36939179 TCCTTCCACCACACAACGCATGG + Intronic
906867905 1:49442150-49442172 TCTTTCCCACACTGTAAGCTGGG + Intronic
907907278 1:58794532-58794554 GGCTTCCCACACACAAAGGATGG + Intergenic
908758513 1:67490902-67490924 TCTATCAGGCACACAAAGCAAGG + Intergenic
909666182 1:78135413-78135435 TCTCTCACACACACACATCAAGG - Intronic
910821064 1:91347268-91347290 TCTTTTTCACACAAAAAGCTTGG - Intronic
911606810 1:99915399-99915421 TCTTTACTACAGAAAAAGCATGG + Exonic
911659426 1:100484415-100484437 TCTTTCAAAAACACAAAACATGG + Exonic
912454113 1:109786499-109786521 TCTTTCCAACCCACAGATCAAGG + Intergenic
913280109 1:117177577-117177599 CCTTTCCCAAATACAAAGCCTGG - Intronic
913703205 1:121394793-121394815 TCTTGTCCTAACACAAAGCAAGG + Intergenic
913939691 1:125089140-125089162 TCTTGTCCTAACACAAAGCAAGG - Intergenic
913979376 1:143495956-143495978 TCTTGTCCTAACACAAAGCAAGG + Intergenic
914043768 1:144075290-144075312 TCTTGTCCTAACACAAAGCAAGG + Intergenic
914073781 1:144321606-144321628 TCTTGTCCTAACACAAAGCAAGG + Intergenic
914105374 1:144644754-144644776 TCTTGTCCTAACACAAAGCAAGG - Intergenic
914134318 1:144885201-144885223 TCTTGTCCTAACACAAAGCAAGG - Intergenic
914517261 1:148384508-148384530 CCTTTCCCATACAAAGAGCAAGG + Intergenic
915271935 1:154759582-154759604 TCTCTCCTACACACCCAGCATGG + Intronic
915519041 1:156430703-156430725 TCTTTCCCCACCTCAAAGCAGGG + Intergenic
915993246 1:160538790-160538812 TCTTTCCAAAACACAAATAATGG - Intergenic
916584640 1:166139907-166139929 GCTTTCCCACATGCAAAGCCAGG + Intronic
917485678 1:175452550-175452572 GCTCTCACACACCCAAAGCATGG - Intronic
918837690 1:189488587-189488609 TATTTCCCACACCCATAGCCAGG - Intergenic
918881727 1:190132752-190132774 TCTTTTCCACACTCAAGGAAAGG - Intronic
921723497 1:218499578-218499600 TCTTTCCCACAGCCAACACAAGG - Intergenic
921924254 1:220698566-220698588 TCTTTCCCACTCACTATGCTTGG - Exonic
921942080 1:220852504-220852526 TCTTTCCCACACAAACAAAATGG - Intergenic
923074431 1:230597081-230597103 TCATTAACTCACACAAAGCAGGG - Intergenic
923226103 1:231940178-231940200 TCTTTACCACACACAGAGAGAGG - Intronic
923600664 1:235399883-235399905 TTTTCCCCACACACCAAGCAGGG - Intronic
1063891312 10:10631584-10631606 TCTTTCCCTCACATACAGTAAGG - Intergenic
1064240735 10:13626017-13626039 TCTTCCCCACTTACAAAACAGGG - Intronic
1064817898 10:19287613-19287635 GCATTCCCACACACCAAGTAGGG + Intronic
1064903879 10:20323281-20323303 TCCTTGCCACACACATTGCAAGG - Intergenic
1066250787 10:33630846-33630868 GCTTCCCTGCACACAAAGCATGG + Intergenic
1068410353 10:56646388-56646410 TCTCTCCCACTCAGAAGGCATGG + Intergenic
1068644433 10:59450159-59450181 TGTTTCCCTCACAAAAAGGAAGG - Intergenic
1069551069 10:69364689-69364711 TCCCTCCCACACACACAGAAAGG - Intronic
1069810531 10:71156073-71156095 TCTTGCCTACACATAAAGAATGG - Intergenic
1070226817 10:74516433-74516455 TCTAACCCACACACAAAAAAAGG - Intronic
1071178611 10:82956751-82956773 TCATTCGCACACACAAAAAAGGG - Intronic
1073765519 10:106678227-106678249 TCTTTCCAACACCGCAAGCAAGG - Intronic
1074980665 10:118617309-118617331 TGTTTCCCACTCACAAATAAGGG + Intergenic
1076737799 10:132466529-132466551 TCTTTCCCACAGAGACAGCTTGG + Intergenic
1080134587 11:28839920-28839942 TCTTTCCCATATAAGAAGCATGG + Intergenic
1081393755 11:42560770-42560792 TCTTGCCCACACTCAAGGGAAGG + Intergenic
1081592910 11:44437411-44437433 TCCTACCCACACCCAGAGCAGGG - Intergenic
1082788695 11:57332275-57332297 TCTTCCCTACAAAGAAAGCAAGG + Exonic
1083618518 11:64037679-64037701 TCTTTCCCAGACACAGAGACTGG + Intronic
1085796019 11:79540705-79540727 CCTTTCCCACACAGGCAGCATGG - Intergenic
1086662550 11:89438039-89438061 TCTTTCCCAGACACACACTAAGG + Intronic
1093110564 12:15146717-15146739 TCTCTCCCAGGCACAGAGCATGG + Intronic
1093604926 12:21078055-21078077 TTTTTCAGGCACACAAAGCAAGG + Intronic
1094246888 12:28308499-28308521 TCTTTCCCACACTAAAAGCCAGG + Intronic
1094300335 12:28957609-28957631 CCATTCCCACCCAGAAAGCAAGG + Intergenic
1094826146 12:34270662-34270684 CCTTTCCTACACATAAAGCTTGG + Intergenic
1097332457 12:58346531-58346553 TTTTTCACACATAGAAAGCATGG - Intergenic
1098002359 12:65958911-65958933 TCCGTACCACACACAAAGGAGGG + Intronic
1098997830 12:77142036-77142058 TGTTTCCCACACAATAAGGATGG + Intergenic
1099654393 12:85470103-85470125 TCTTTCCCAGAGACAGAGCTTGG + Intergenic
1101245933 12:102884485-102884507 TCTTTCCCACCCACACAACATGG + Intronic
1101886930 12:108672535-108672557 TCTTTCACACAGAGAATGCAGGG - Intronic
1103929141 12:124440025-124440047 GGTCTCCAACACACAAAGCAGGG + Intronic
1105534267 13:21249295-21249317 TCTTTGCCAGAAACACAGCATGG + Intergenic
1105586841 13:21753191-21753213 TCTTTCCTACTCTCAAATCAGGG + Intergenic
1105854098 13:24360398-24360420 CCTTTCATACCCACAAAGCAGGG + Intergenic
1106318773 13:28618925-28618947 TCTCTCACACACACAGAGGATGG + Intergenic
1107686641 13:42907208-42907230 TATTTCCTACACAAAATGCAAGG + Intronic
1108131508 13:47306481-47306503 GCTTTACCACACACACAGCCAGG - Intergenic
1109842600 13:67939308-67939330 TCTTTCCCAAACACAACTCTAGG - Intergenic
1110191942 13:72740150-72740172 ACTTTCTCATACAAAAAGCAGGG - Intronic
1110563973 13:76939549-76939571 ACTTACCCACTCACAAAACAAGG + Intergenic
1112610291 13:100948701-100948723 TCATTCCCACAGAAGAAGCAGGG - Intergenic
1112906414 13:104428296-104428318 TCTTTCTAACACAGAAAGGAAGG - Intergenic
1113702391 13:112397053-112397075 TCTTTCTCACTCACAGAGCTGGG - Intronic
1113894341 13:113754264-113754286 TATTTCCCACACACAAGGAGAGG + Intergenic
1115361414 14:32507575-32507597 TCCTTCCTACACACGCAGCAAGG + Intronic
1116814982 14:49575440-49575462 TCTGTCCCACAAACAAATAATGG + Exonic
1117354021 14:54906248-54906270 TTTCTCCCACACACCAAGCAGGG - Intergenic
1117459764 14:55933767-55933789 TCCTGCCCACACTCAAAGGAAGG - Intergenic
1118230232 14:63940860-63940882 TCTTTCTCACACAGAAAAAAAGG + Intronic
1119366938 14:74100986-74101008 TCTTAAACACACACAAATCAGGG - Intronic
1120538537 14:85727095-85727117 TCTTTCCCATCCACAAGCCAAGG - Intergenic
1120581305 14:86254021-86254043 TCCTTACCAGACTCAAAGCATGG + Intergenic
1120642932 14:87037478-87037500 TCTTTACCACAGTAAAAGCATGG - Intergenic
1120673390 14:87390080-87390102 TCTTTGCCACGCACAATGCTGGG + Intergenic
1121024435 14:90604494-90604516 GCTCTCACACACACAAAGCCAGG - Intronic
1121872882 14:97425756-97425778 TCTTTCCCACTCTCAAGGCTTGG - Intergenic
1122065112 14:99167601-99167623 TCTTTCCCACCCAGAAAACTAGG - Intergenic
1122506661 14:102235998-102236020 TCTTTGCCACACTTAAAACAAGG - Intronic
1122617324 14:103028548-103028570 CCTTTCCCACAGAAACAGCATGG + Intronic
1124504009 15:30256276-30256298 TCAGCCCCACACACAAAACATGG - Intergenic
1124739545 15:32282370-32282392 TCAGCCCCACACACAAAACATGG + Intergenic
1125953311 15:43772414-43772436 TCTTGGTCACACACAAAGCTTGG + Exonic
1126256494 15:46632804-46632826 TCTTTCCCCCTCAGAGAGCAAGG + Intergenic
1128753236 15:70163712-70163734 TCTTCCCCACCCACACACCAAGG + Intergenic
1130994419 15:88895915-88895937 TCTTTTCCAAATAGAAAGCAAGG + Intergenic
1132224759 15:100131923-100131945 TCGCTGCCTCACACAAAGCAGGG - Intronic
1135270812 16:21068057-21068079 TCACTCCCACAAACAAAGCAGGG + Intronic
1136398168 16:30004309-30004331 TTGTGCCCACAGACAAAGCACGG + Intronic
1136487477 16:30582735-30582757 CCTTTCCCACACTCCACGCAGGG + Exonic
1136579182 16:31141725-31141747 TGTCCCCCACACACAGAGCATGG - Exonic
1137373317 16:47928983-47929005 TCATTTCCTCACACAAACCAAGG - Intergenic
1138614992 16:58158118-58158140 TCTTCCCGACCCAGAAAGCATGG - Exonic
1139691827 16:68646167-68646189 TCTGTCGGAGACACAAAGCACGG - Intronic
1141932025 16:87211909-87211931 TGTTTGCCATACACCAAGCAAGG + Intronic
1145831351 17:27919027-27919049 CCCTCCCCACACACAAAGAATGG + Intergenic
1145877609 17:28331549-28331571 TATTTCCCACACCCAAGCCATGG + Intronic
1147354832 17:39886653-39886675 TCTGTCACACACACAAAAAAAGG + Intergenic
1147518160 17:41141900-41141922 TCTTGGCCTCACACAAAGCAAGG + Intergenic
1147518374 17:41143660-41143682 TCTTGTTCTCACACAAAGCAAGG + Intergenic
1149494485 17:57108691-57108713 ACTTCCTCACAAACAAAGCAGGG - Intronic
1150950200 17:69795080-69795102 TCTTTCCCACTCCCTTAGCAGGG - Intergenic
1153980200 18:10302424-10302446 TCTTTCTCACAAACAAATGATGG + Intergenic
1154218708 18:12433977-12433999 CATTTCCCAAACACAAAGCCCGG + Intergenic
1155851237 18:30777149-30777171 TGTTTACCAAACACCAAGCATGG + Intergenic
1156126109 18:33906880-33906902 ACTTTCACACACAAAAAGCAGGG + Intronic
1157881313 18:51323461-51323483 TATTTACCACACACCAACCATGG - Intergenic
1158246003 18:55432497-55432519 TCCATCCCACACACACAGAAAGG + Intronic
1159017701 18:63115076-63115098 TTTTCCCCACACACCAAGCAGGG - Intergenic
1159444072 18:68518562-68518584 TCTTTCCCAGACAAATATCAAGG - Intergenic
1162574554 19:11491416-11491438 TGTTTCCCACATACAAAGCCTGG - Intronic
1162836734 19:13324442-13324464 CCTTCCCCACACACAAAAAACGG + Intronic
1163908499 19:20168351-20168373 TCCTTCACACACACAAAAGAAGG + Intronic
1164393431 19:27844667-27844689 TCTTTGCCACACTTAAAACAGGG + Intergenic
1164826775 19:31289823-31289845 TCTTTCCCTGACACAGAGGAAGG - Intronic
1166229862 19:41420346-41420368 TCTCACACACACACAAAACACGG - Intronic
1167036114 19:46995883-46995905 TCTGGCCCACACTAAAAGCAAGG - Intronic
1167255431 19:48425035-48425057 TCTCTCTCTCACACAAAACAGGG + Intronic
1167722316 19:51187048-51187070 GCTTTCCCAGACACAAAGAGCGG - Intergenic
1202683013 1_KI270712v1_random:27623-27645 TCTTGTCCTAACACAAAGCAAGG + Intergenic
926724574 2:15987288-15987310 TGTCTACCACACACTAAGCATGG + Intergenic
928264278 2:29798217-29798239 TCTCTCACACACACAAAGAGAGG - Intronic
928302347 2:30137010-30137032 TTTTTCCCCAACACAAAACATGG - Intergenic
930876963 2:56229814-56229836 TCTTTGCCTCAGACAAAACACGG - Intronic
931352171 2:61501228-61501250 TTTTTCCCCCACACATACCAGGG + Intronic
933330194 2:80883670-80883692 TCTTTCACACACACCAAACATGG + Intergenic
933483148 2:82882558-82882580 TATTTCTCACACACACAGCCTGG - Intergenic
933762553 2:85682469-85682491 TCTGTCCAAGACACAAAGCCTGG + Intergenic
934656505 2:96119193-96119215 GCTTTCCCAGACACATAGCAGGG + Intergenic
934974153 2:98788630-98788652 TCTGTCCCACACTCAAGGGAAGG + Intergenic
935849331 2:107201363-107201385 TCTTTCCCAAACTCAATGAAGGG + Intergenic
935895684 2:107734765-107734787 TCTCTCCCACACACACATCCTGG + Intergenic
936247184 2:110838577-110838599 TCATTCCTACAGAGAAAGCAGGG - Intronic
936665764 2:114593744-114593766 CCAATCCCCCACACAAAGCAAGG - Intronic
937519486 2:122694323-122694345 TCTTGGCCACACACAATACATGG - Intergenic
938061844 2:128261100-128261122 TCTTTCTCAAACAAAAAGCCAGG - Intronic
938657221 2:133446886-133446908 TCTTTCCCACCCACTAAATATGG - Intronic
938721388 2:134070168-134070190 TCCTTCCCGCACACATACCAAGG + Intergenic
942216087 2:173720228-173720250 TCTATCCCAACCACAAAACATGG + Intergenic
942973034 2:181980259-181980281 TCTCTCCAAAACAAAAAGCAGGG + Intronic
944475424 2:200099253-200099275 TCTAGCCCACACACAAGGGAAGG - Intergenic
945535555 2:211013344-211013366 TCTTTCCAAAAAACAGAGCAGGG + Intergenic
945644254 2:212468750-212468772 TCTTGCCCACAAAAAAAGTACGG - Intronic
946323459 2:218968338-218968360 GCATGCCCACACACAGAGCATGG + Intergenic
946445073 2:219731647-219731669 TCTTGCCCACAGTCAAAGGAAGG + Intergenic
946661623 2:222007154-222007176 TTTTTCCCCCACACAGACCAAGG - Intergenic
947645557 2:231736524-231736546 TCTTTCCCACAGACAATGGGAGG + Intronic
948147663 2:235720116-235720138 TCTTTCCCAAACAACAAGTATGG - Intronic
1170591519 20:17775392-17775414 TCTTTCCAACACACGAATCTGGG + Intergenic
1170646557 20:18201595-18201617 TCTTTCCCACACAAGAAAAATGG - Intergenic
1170846345 20:19965057-19965079 TATATCCCACACACCAAACAGGG - Intronic
1172319049 20:33982127-33982149 TGTTTCACATACACAAACCATGG + Intergenic
1173068993 20:39743343-39743365 TCTTCCCCATTCATAAAGCATGG - Intergenic
1178476527 21:32942249-32942271 TCTTTTCTAAACACAAAGCAAGG - Intergenic
1179022843 21:37655929-37655951 TCTTTCCCACACACAGCCCTGGG + Intronic
1179323732 21:40318925-40318947 TCCTTCCCACCCAGAAGGCAGGG - Intronic
1180124866 21:45783898-45783920 ACTTTCACACACACAAAGCACGG + Intronic
1181581011 22:23828013-23828035 TCTCTGCCACACAGAAAGCTTGG + Intronic
1182308205 22:29386153-29386175 TCTAACCCTCACACAAACCAGGG + Intronic
1183096559 22:35555466-35555488 GTTTTCATACACACAAAGCATGG + Intergenic
1184505319 22:44897329-44897351 TCCTGCCCACACTCAAGGCAGGG - Intronic
1185419454 22:50727415-50727437 TCATTGCCACACACAGAGCCTGG - Intergenic
950013721 3:9741908-9741930 TCTTTCCCACCCTCACAGCTGGG - Intronic
950117001 3:10457434-10457456 TCTTTCCCACACACAAAGCACGG - Intronic
951754871 3:26079274-26079296 TCTTTCTCTGACACAAATCATGG + Intergenic
951847246 3:27097740-27097762 TCCTTCCCACTCTCAAACCATGG + Intergenic
953667384 3:44935275-44935297 TCTAACACACACACAAAGAAAGG - Intronic
956930518 3:74037916-74037938 TCCCTCCCCCACCCAAAGCACGG - Intergenic
958676436 3:97273961-97273983 CCTTTCCTACACATAAAGCTCGG - Intronic
960266154 3:115623527-115623549 TCTCTCCCTCACACACACCAGGG - Exonic
961358744 3:126354788-126354810 CCTTTCCCACCCTCCAAGCAGGG + Intronic
962255593 3:133868014-133868036 ACTTCCCCAGAGACAAAGCATGG - Intronic
962780862 3:138715109-138715131 TCTTTCCTACACATAGAGAAGGG - Intronic
963623627 3:147643594-147643616 TCTGTCAGACACACAAAACATGG - Intergenic
965080232 3:164023888-164023910 TCTTTGCCACACTTAAAACAAGG + Intergenic
965982998 3:174715774-174715796 TCTATCCCAGATACAAAGTAAGG - Intronic
966809194 3:183828195-183828217 TTTTTCCCAGTCACAAAGCAGGG + Intergenic
967099102 3:186201280-186201302 ACTTTCCTGCAGACAAAGCAGGG + Intronic
969351472 4:6600446-6600468 TGTTTCCCACAGACACAGCGTGG - Intronic
972542570 4:40052455-40052477 TCTTTACCACACTCAACCCAGGG - Intergenic
972814632 4:42630429-42630451 TCATCCCCTCACAGAAAGCAAGG + Intronic
973251634 4:48066445-48066467 TATTTCCCCCACTCAAAGAATGG - Exonic
974963533 4:68732351-68732373 TCTTACACAAAAACAAAGCATGG - Intergenic
975412282 4:74067470-74067492 TTTTTACCAAACACAAATCATGG + Intergenic
979670001 4:123351922-123351944 TCACTCCCACCCGCAAAGCAGGG + Intergenic
980145325 4:128976131-128976153 ACTTTCGTACACACAAAGTATGG - Intronic
981426417 4:144608574-144608596 TCTTTCCCTCACCCATTGCAAGG - Intergenic
982481336 4:155915008-155915030 ACTCACCCACACACAAAGGAGGG - Intronic
982604663 4:157499223-157499245 CCTTTCCCCCAGAGAAAGCATGG - Intergenic
982938603 4:161519134-161519156 TCTCTATCACACATAAAGCAGGG - Intronic
984492773 4:180456788-180456810 TAATTCCCAGAGACAAAGCAGGG + Intergenic
984498114 4:180524404-180524426 TCTGTCTCACACACAAAAAAGGG - Intergenic
988312156 5:29574081-29574103 TTTTTCCCACACACATGGCCAGG - Intergenic
988712129 5:33789177-33789199 TCTCTCACACACACTCAGCAAGG + Intronic
989610981 5:43291258-43291280 TCTTTCCCCCACAAGAATCATGG + Intronic
989641631 5:43588681-43588703 ACTTTCACTCACACAAAGCCGGG - Intergenic
989747411 5:44846619-44846641 TCTTTCTAACACACAAACCTTGG + Intergenic
990970555 5:61501229-61501251 TCTTTTCCACCCCCACAGCAGGG - Intronic
991239506 5:64441382-64441404 TCTTTCATTCACTCAAAGCAGGG - Intergenic
991591915 5:68260631-68260653 TCTTTCCCACATACAAAATGAGG + Intronic
993339126 5:86700863-86700885 TCTGTTCCACACACAAAAAAGGG - Intergenic
993478118 5:88389712-88389734 CCTTTGCCAAACACAAAGAATGG - Intergenic
993979472 5:94527732-94527754 CCTTTCGAACACAAAAAGCACGG - Intronic
994042271 5:95272743-95272765 TGATTCCCACAGAGAAAGCAAGG + Intronic
995290832 5:110450788-110450810 TCTTTCCTGGACACAAAGCTGGG + Intronic
997835862 5:137193098-137193120 TCTTTGCCACACAAACATCAGGG - Intronic
999273294 5:150311170-150311192 TCTTATCCACACAGAAATCAAGG + Intronic
999340177 5:150763444-150763466 TTGTTCCAACTCACAAAGCACGG + Intergenic
999788946 5:154919324-154919346 TCTGTCACACACACAAAAAAGGG + Intronic
999844353 5:155462150-155462172 TTTCTCTCACACACAAAGAAAGG - Intergenic
1000083120 5:157865861-157865883 TCTTTCCCACCAACAGAGTATGG - Intergenic
1002258763 5:177979896-177979918 TCTTTCACACACACACACCCAGG - Intergenic
1003063909 6:2885902-2885924 ACATTCCCACACACAAGGTAAGG + Intergenic
1003077127 6:2992398-2992420 ACTTTCCCACACCAAAATCAAGG + Intronic
1004913431 6:20308471-20308493 TTGTTCAAACACACAAAGCAAGG + Intergenic
1007688305 6:43680600-43680622 TCTTACCAACAGACAAACCAGGG + Intronic
1008471686 6:51891820-51891842 TCTTTCTGTCACACAAGGCAGGG - Intronic
1009456743 6:63865731-63865753 TCTTTCCTACACACAAATTTTGG - Intronic
1010130683 6:72489858-72489880 ATTTTCCCCCACCCAAAGCAAGG + Intergenic
1010734992 6:79434116-79434138 TCTTTCTTAAACACAAAGTAAGG - Intergenic
1011032350 6:82937513-82937535 TCTTTCCCACACACTGAGCATGG - Intronic
1012369323 6:98483563-98483585 TCATTCCCACACTCATAGCCAGG + Intergenic
1013514643 6:110874904-110874926 ACTTTCGCTCACACAAAGCCGGG + Exonic
1014444334 6:121509453-121509475 TCTTTACCACAAACATTGCAAGG - Intergenic
1015352009 6:132231119-132231141 TCTTTCCCACAGAAAAAGTGGGG - Intergenic
1016721953 6:147308838-147308860 TTTTTCCCACACACCATGAAGGG + Intronic
1018976382 6:168570520-168570542 TATATCCCACACACAACACAGGG - Intronic
1019051917 6:169190171-169190193 ACCCTCCCACACACACAGCAAGG + Intergenic
1020506805 7:9000828-9000850 TCTGTCCTAGACACAAAGCCCGG - Intergenic
1020565830 7:9794390-9794412 TCTTGCCCACACTCAAGGAATGG - Intergenic
1021293519 7:18875243-18875265 TTTTTCCCACTCAGAGAGCAAGG - Intronic
1021843811 7:24744887-24744909 TCTTGCCCACACACACAGCATGG - Intronic
1022134133 7:27431579-27431601 TCTGTCCAACACACCAAGAAGGG - Intergenic
1022171344 7:27834867-27834889 TCTCTCACACACACAATACATGG - Intronic
1022799898 7:33766388-33766410 GTTTTCTCACACACAAAGCCTGG - Intergenic
1024538143 7:50455231-50455253 TCCTTCCCAAACTCTAAGCAAGG - Intronic
1025006391 7:55358612-55358634 TGTTACACACACACAAATCAAGG - Intergenic
1025878687 7:65511183-65511205 TCTTGCCCTAACAAAAAGCAAGG - Intergenic
1026307609 7:69155220-69155242 TGTTTCCCAGACACAAAGCCAGG + Intergenic
1028093203 7:86728702-86728724 CATTTGCCACACACAGAGCAGGG + Intronic
1029198540 7:98823430-98823452 TCTTTACTACACACAAGTCAAGG - Intergenic
1030044283 7:105480999-105481021 GCTTTCTCATAAACAAAGCAGGG - Intronic
1031408187 7:121410606-121410628 TCTCTCCCACATATAATGCAAGG + Intergenic
1031610737 7:123824306-123824328 TCTTCCCCACACACCAGGCTTGG + Intergenic
1032060857 7:128723873-128723895 TCTTCTCCACACAGCAAGCATGG + Intronic
1035451792 7:158981452-158981474 TCCTTGCCACACACAAGCCATGG + Intergenic
1036727563 8:11233100-11233122 GTTTTCCCACACCCACAGCAAGG + Intergenic
1038005203 8:23424127-23424149 TCTTTCCCTCTAATAAAGCAAGG + Intronic
1038967786 8:32594836-32594858 TCTATCCCATACACAATGAATGG - Intronic
1040499886 8:47996894-47996916 TCTTTGCCACACTTAAAACAAGG + Intergenic
1042014735 8:64295983-64296005 TGATTCACACACTCAAAGCAGGG - Intergenic
1043676796 8:82966641-82966663 CCTATCCCACACCCAAAGGAAGG + Intergenic
1045536992 8:103039713-103039735 CCCTTCCCACACACACAGAAGGG - Intronic
1047567909 8:126066345-126066367 GCATTCACACACACACAGCATGG - Intergenic
1047997664 8:130352062-130352084 TCTCTCCCACACACAAGTCAAGG - Intronic
1049215441 8:141405737-141405759 TCTGTCCCCCACACACAGTAGGG - Intronic
1051346936 9:16160522-16160544 TCCTTCCCATTCACAAAGCTGGG - Intergenic
1052336834 9:27328960-27328982 CCTTTACGAGACACAAAGCAAGG + Exonic
1054739952 9:68795132-68795154 TCTCACACACACACAAAGTAAGG - Intronic
1055085978 9:72314715-72314737 TCTTTACCACACAAAAATCATGG - Intergenic
1055934004 9:81588380-81588402 TCTTTCTAACACAGAAAGCAAGG - Intronic
1056031286 9:82556158-82556180 TCTTTCTCACATTCAAAGCTTGG + Intergenic
1056296685 9:85200369-85200391 TCTTTCCCACAGAGAGAACAGGG - Intergenic
1056408312 9:86298410-86298432 TATTTGCCACACACAAAGTAAGG - Intronic
1056860410 9:90175585-90175607 TATTTCCCCCACTCAAGGCAAGG - Intergenic
1057544147 9:96004547-96004569 ACATTGCCACACACAAAGAAAGG + Intronic
1057867579 9:98693438-98693460 TCTGGCCCCCACTCAAAGCAAGG + Intronic
1058286124 9:103181145-103181167 TCTTTTCCACAGAAATAGCATGG - Intergenic
1059933494 9:119284400-119284422 TCTTTGCCAAACACAGAGCTAGG - Intronic
1061556725 9:131374871-131374893 TATTTCCCACACACATCCCAGGG + Intergenic
1062585939 9:137250079-137250101 TGTTCCCCACACACCAAGCTGGG - Intergenic
1187036522 X:15545958-15545980 TTGTTCCCACACACAAAAAATGG + Intronic
1190853508 X:54269955-54269977 TTTTTCATACACACATAGCATGG + Intronic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1192870712 X:75180446-75180468 TCTTTCCCACTCTCACAGCTTGG + Intergenic
1193055386 X:77144090-77144112 TCTCTCCCAGTCACGAAGCATGG - Intergenic
1194661073 X:96628969-96628991 CCTTTCCCACACATCAAGCTCGG + Intergenic
1195927834 X:110044304-110044326 TGTTTCCCAAACTCAAAGCAGGG - Intronic
1197293863 X:124693066-124693088 TCTTGACAACAGACAAAGCAAGG - Intronic
1199685818 X:150264299-150264321 TTTTTACCACAGAGAAAGCAGGG + Intergenic
1201903753 Y:19068749-19068771 TCTTTCTCCCAGTCAAAGCAGGG + Intergenic