ID: 950117602

View in Genome Browser
Species Human (GRCh38)
Location 3:10461623-10461645
Sequence CTCATTCATCTCTGCAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950117602_950117611 -10 Left 950117602 3:10461623-10461645 CCCACCCTGCAGAGATGAATGAG 0: 1
1: 0
2: 0
3: 14
4: 192
Right 950117611 3:10461636-10461658 GATGAATGAGCGGATGGTGGGGG 0: 1
1: 0
2: 2
3: 13
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950117602 Original CRISPR CTCATTCATCTCTGCAGGGT GGG (reversed) Intronic
900893603 1:5467275-5467297 CTTATTTATCTCTGGAGGCTGGG - Intergenic
903015674 1:20360201-20360223 CTCAATCATTTGTGCAGGGGAGG - Intergenic
904957811 1:34300955-34300977 CTCTTTTATCTCTGTAAGGTTGG + Intergenic
905227318 1:36487803-36487825 CTTATTCATCCCTGAAAGGTTGG + Intergenic
905500901 1:38435510-38435532 CTCCTTAATCTGTGCAGGGTGGG - Intergenic
905607135 1:39311928-39311950 CTCACTCTTCTCTTCAGGTTTGG - Intronic
906003776 1:42450350-42450372 CTCTTTTATTTCTGCAAGGTTGG + Intronic
906548645 1:46641796-46641818 CTTCTTCATCTCTCCAGGGATGG + Intronic
906812653 1:48844846-48844868 CTGATTCATCTCTGTATGGTAGG + Intronic
907933228 1:59019281-59019303 CTCAATCATTGCTGAAGGGTAGG - Intergenic
910307688 1:85785072-85785094 CTGAATCATCTCTGGATGGTAGG - Intronic
911672715 1:100625143-100625165 CTCATTCATCACAGCACGGAAGG - Intergenic
911866512 1:103031762-103031784 CTCATTCATCTTTGTAGGTAGGG - Intronic
914746486 1:150505165-150505187 TTCATACATCTCTACAAGGTAGG - Intronic
916471537 1:165128040-165128062 ATCATACATATCTGCAGGCTTGG - Intergenic
920432762 1:205929204-205929226 CACAATCATCTCTGTAGGGATGG + Exonic
921181514 1:212635518-212635540 CTCATCCATCTCTGAAGACTGGG - Intergenic
924631260 1:245743004-245743026 CTCTTTCATCCCTGCAGCGAAGG + Intergenic
1064146473 10:12830044-12830066 GTCCTGCATCTCTGCAGTGTGGG - Exonic
1065021068 10:21501792-21501814 CCCATTCCTCTCTTCAGGTTGGG - Intergenic
1065450593 10:25852521-25852543 CTCTTTGTTCTCTGCAGGGAAGG - Intergenic
1067412595 10:46078035-46078057 CTCACTCATTACTGCAGGGAAGG - Intergenic
1070162706 10:73875193-73875215 CTCTTTCATCTCTGCAGTTATGG - Intergenic
1070589375 10:77790482-77790504 CACATTCAATTCTGCAGGCTTGG - Intergenic
1070985426 10:80685901-80685923 CTCATTCAACTCTGCTGCCTTGG - Intergenic
1071028532 10:81144046-81144068 CTTATTTCTCTCTGCAGGTTGGG + Intergenic
1071574341 10:86714995-86715017 CTCACCCAGCTCTGAAGGGTGGG + Intronic
1072558781 10:96548982-96549004 CTTATTCATCTCTCCAAGATGGG + Intronic
1074438168 10:113452252-113452274 CTTCTTCAGCTCAGCAGGGTTGG + Intergenic
1074654498 10:115569868-115569890 CTCATACAGCTCTGGAGGCTGGG + Intronic
1077239547 11:1503365-1503387 CTCATTTCTGTCTCCAGGGTGGG - Intergenic
1079970225 11:27027476-27027498 CTCATTCATTGCTGCAGAGATGG - Intergenic
1080174480 11:29345351-29345373 TTCATACATTTCTGCAGGCTAGG - Intergenic
1084572270 11:69966798-69966820 CTCAATCAACTGGGCAGGGTGGG - Intergenic
1084677030 11:70641517-70641539 GTCATTCCTCCCTGCAGGGGAGG - Intronic
1084793763 11:71490963-71490985 CACACTCACCTCTGCAGGGCAGG - Exonic
1088013065 11:105026599-105026621 TTCATTTGTCTCTGCAGGGCAGG + Intronic
1088016236 11:105063676-105063698 CTCATTTGTCTCTGCAGGTCAGG + Intronic
1089722185 11:120436290-120436312 GTCATTCATTTCTCCAAGGTGGG + Intronic
1090190112 11:124761764-124761786 CTCATCCGGCTCTGCTGGGTGGG + Intronic
1090724602 11:129512786-129512808 CTTTTTGATATCTGCAGGGTTGG + Intergenic
1091546661 12:1505563-1505585 CTCATTCAGCTTTGCATGGAAGG - Intergenic
1096865339 12:54559319-54559341 CTTATTCTTCACTGCAGGCTGGG + Intronic
1097383358 12:58920916-58920938 CTCTTTCATCTGTGGATGGTAGG - Intergenic
1097831939 12:64234323-64234345 ATCATTCAGGTCTCCAGGGTTGG + Intergenic
1098442668 12:70534784-70534806 CTCATTCATCTCCCCAAGCTCGG + Intronic
1100047767 12:90404668-90404690 CTCACTCATCTCTGTTGGGCAGG + Intergenic
1100773313 12:97947970-97947992 CTCTGTGATCTCTCCAGGGTGGG - Intergenic
1104759436 12:131288134-131288156 CTCAGTCATCTGTGCAGAGCTGG + Intergenic
1106861386 13:33912605-33912627 TTCATTCATCTCTGGAGAGGAGG + Intronic
1108965408 13:56292754-56292776 CTGATTTATCTCTTCTGGGTGGG + Intergenic
1110149307 13:72230257-72230279 CTCTTTCATCTCTTCACAGTGGG - Intergenic
1111469945 13:88667152-88667174 CTCATTTAACTCTTCAGGATAGG + Intergenic
1112872147 13:103985988-103986010 CTCCTGCTTCTCTGCAGGGATGG + Intergenic
1113911883 13:113845827-113845849 TTCATTCACCCCTGCAGGGGCGG + Intronic
1116960234 14:50961368-50961390 CTCAGTCATCTCTGCTGAGCTGG + Intergenic
1117225248 14:53651737-53651759 TTCAGTCATCTCGGCAGGTTGGG + Intergenic
1117571292 14:57051658-57051680 ATCTGTCTTCTCTGCAGGGTTGG + Intergenic
1117760108 14:59018337-59018359 CTCCGTTGTCTCTGCAGGGTGGG + Intergenic
1118761253 14:68881457-68881479 CCCATTCATCCCTGCAGGCCAGG + Intronic
1118774762 14:68966888-68966910 CCCCTTCCTCTCTGGAGGGTGGG - Intronic
1119425559 14:74532538-74532560 CTCGTTGATATCTGCAGGGTTGG + Exonic
1119463020 14:74827021-74827043 CAGATTCATCTCTTCAGAGTTGG + Intronic
1120166375 14:81205828-81205850 CTGATTCATCTCTGTAAAGTAGG + Intronic
1121019854 14:90573274-90573296 CTCCTTCCCCACTGCAGGGTGGG + Intronic
1122138751 14:99649833-99649855 TTCTTTCATCTCTGCAAGGTAGG - Intronic
1123002909 14:105305871-105305893 CTCATTCAGCCCTGCAAGGCAGG + Exonic
1123775556 15:23575630-23575652 CTCACTCATCTCTGCAAGAATGG - Intronic
1124491727 15:30162097-30162119 CTCACTCTCCACTGCAGGGTGGG + Intergenic
1124648975 15:31461073-31461095 CTCATTCTCCACTGCAGGCTTGG + Intergenic
1124751809 15:32376212-32376234 CTCACTCTCCACTGCAGGGTGGG - Intergenic
1125049669 15:35282555-35282577 CTCATTGAGATCTGAAGGGTTGG - Intronic
1125299425 15:38238648-38238670 CACATTCTTCCCTGCAGGGTAGG - Intergenic
1125611302 15:40972928-40972950 CTCATTGATCTCTGCAGGTGTGG + Intergenic
1129000213 15:72327036-72327058 CACATTCTTCACTGAAGGGTTGG - Intronic
1132993206 16:2808102-2808124 CTCACTCATTACTGCAGGGAGGG + Intergenic
1140340464 16:74154146-74154168 CAGAATCAGCTCTGCAGGGTGGG - Intergenic
1140900300 16:79360814-79360836 CTGAGTCATCCCTGCTGGGTGGG - Intergenic
1143012250 17:3872442-3872464 CACCTTCATATCTGCAGGCTGGG + Intronic
1147164025 17:38584047-38584069 CGCATTGATCTGTGCAGGGCTGG - Intronic
1148109793 17:45137896-45137918 CTGACTCATCTCAGCAGGTTTGG + Exonic
1148995387 17:51705020-51705042 TTCATTCATCCCTGCAGTGGTGG + Intronic
1150410403 17:64936935-64936957 CTCCCTCATCTCAGCATGGTTGG - Intergenic
1150917971 17:69455804-69455826 CCCAGGCATATCTGCAGGGTTGG - Intronic
1151102422 17:71571342-71571364 CTCACTCATTATTGCAGGGTGGG - Intergenic
1152267946 17:79307055-79307077 CTCATTCTTCTCCCCAGGGATGG - Intronic
1155769278 18:29676361-29676383 ATCATTCGTCTGTTCAGGGTTGG - Intergenic
1163486487 19:17590289-17590311 CTTAATCATATCTGCAGGGCTGG + Intergenic
1163517277 19:17772631-17772653 CTCATGCACCTGTGCCGGGTGGG - Exonic
1164146083 19:22513381-22513403 CTGATTCATCTCTGGAGTATAGG + Intronic
1164580268 19:29430406-29430428 CTCACTCATCACTGAGGGGTTGG - Intergenic
1167623961 19:50574627-50574649 CTCATTCATTGCTGCAGGAATGG - Intergenic
1168490094 19:56802071-56802093 CTCCTTCATGTCTGAAGGGAGGG + Intronic
925025280 2:602243-602265 CTCCCTCAGCACTGCAGGGTCGG - Intergenic
925290883 2:2748080-2748102 CACACTCATCTCAGCAGGGCAGG + Intergenic
927462128 2:23308320-23308342 CTCCCTCATCCCTCCAGGGTAGG - Intergenic
928390097 2:30902922-30902944 CTCATTCTTCTTTGCAGGCCTGG + Intergenic
929289211 2:40170054-40170076 ATCAGTCTTCTCTGCAGGCTGGG + Intronic
932851682 2:75193736-75193758 ATCATTCATCACTGCTGGGCAGG + Intronic
932916057 2:75859417-75859439 CTCACTCATCACTGCAGGGAGGG + Intergenic
935452148 2:103222105-103222127 CACATTCATCCCGGCAGGTTGGG + Intergenic
936481953 2:112892504-112892526 CTTCTCCACCTCTGCAGGGTTGG + Intergenic
937495838 2:122418232-122418254 CTCTTTCCTCTCTGGAGGGAGGG - Intergenic
938218735 2:129546734-129546756 CTCACTCATTACTGCAGGGAGGG + Intergenic
938709467 2:133963608-133963630 CTCATGCTCCTCTGCAGGTTAGG - Intergenic
938790844 2:134674282-134674304 CACACTCATCTCTGGAGGGTAGG + Intronic
940913012 2:159225414-159225436 CTCATTCCTCCCTTCCGGGTGGG - Intronic
940982069 2:160014848-160014870 TTCATGCATCCCTCCAGGGTAGG + Intronic
944110234 2:196124154-196124176 CTCATTCCTCTCTTCAGGAGAGG + Intergenic
945174186 2:207025125-207025147 GTCCTTCATCTCTGAAGGATAGG - Intergenic
947309905 2:228790282-228790304 CTCATGGATCTTTGCAGGGAAGG - Intergenic
948624944 2:239263148-239263170 CTCCTTCATGTCTGCTGTGTCGG + Intronic
1168785867 20:539794-539816 CTCATTCATCTATTCAGGTGTGG + Intronic
1168925214 20:1573802-1573824 CTCACTCATCTTCCCAGGGTGGG - Intronic
1168929092 20:1606830-1606852 CTCACTCATCTTCCCAGGGTGGG - Intronic
1170929633 20:20757430-20757452 CTAATTCAGCTCTGCTGGGTGGG - Intergenic
1172102905 20:32496240-32496262 CCACTTCATCTCTGCAGGGCTGG + Intronic
1175773747 20:61640350-61640372 CACATTCATCTCTGCAGCTGGGG - Intronic
1175920740 20:62449530-62449552 CTCATTCATTTGTGTGGGGTCGG - Intergenic
1178142175 21:29696801-29696823 ACCATTAATCTGTGCAGGGTAGG + Intronic
1178462913 21:32819086-32819108 CTCTGTCATCTCTGCAGCCTGGG + Intergenic
1178978662 21:37242826-37242848 CTCCTTAATCCCTGCAGCGTAGG + Intronic
1180697872 22:17764843-17764865 CTTATTTCTCTCTGCAGGTTGGG - Intronic
1182521387 22:30886479-30886501 TTACTTCATCTCTTCAGGGTTGG + Intronic
1183858287 22:40651622-40651644 CTCTTTCTTTTCCGCAGGGTTGG + Intergenic
950117602 3:10461623-10461645 CTCATTCATCTCTGCAGGGTGGG - Intronic
957448804 3:80349062-80349084 CTCATTCAATTATGCAGGCTGGG - Intergenic
958483375 3:94673974-94673996 CTTATTAATCTCTGCAAGGAGGG + Intergenic
958827729 3:99051917-99051939 CTCATTTATCTCTGCTTGGTTGG + Intergenic
965746841 3:171935185-171935207 CTCACTAATCCCTTCAGGGTGGG - Intronic
968921724 4:3525695-3525717 CTCATCCCTCTCCGCAGGGCAGG + Intronic
971189384 4:24412937-24412959 CTGATTCTTCTGTGCAGGGTTGG - Intergenic
971539740 4:27801012-27801034 CTCCTTCATCTATGCTTGGTGGG - Intergenic
972034545 4:34504898-34504920 TTAATTCATCTCTTCAGGATTGG + Intergenic
974953840 4:68614949-68614971 CTCATGAATCTCTGGAGGCTGGG - Intronic
978412748 4:108443000-108443022 CTCAGGAATCTCTCCAGGGTTGG + Intergenic
979538100 4:121847501-121847523 GTAATTCATCTCTACAGGCTGGG - Exonic
980838233 4:138224240-138224262 CTCAGTCATCCCAGCAGAGTAGG - Intronic
985181401 4:187268162-187268184 CTCACTCATTACTGCAGGGAAGG - Intergenic
986517050 5:8574978-8575000 CTTATTCATTACTGCAGGGAGGG + Intergenic
986959579 5:13197208-13197230 CTTATTCATCTCAGCTGGGAGGG + Intergenic
987667073 5:20957334-20957356 CTCATTTGTCTTTCCAGGGTAGG + Intergenic
988222633 5:28368800-28368822 CTATTTCATCTCTGCAGTCTCGG + Intergenic
988450359 5:31336212-31336234 GTCATCCAGCTGTGCAGGGTAGG + Intergenic
990040909 5:51378149-51378171 CTTGTTCATCTCTGCGGAGTTGG + Intergenic
990544977 5:56814490-56814512 GTCCTTCTTCCCTGCAGGGTCGG - Intergenic
991548373 5:67808727-67808749 CTCAAACATCTTTGCAAGGTAGG - Intergenic
991954012 5:71974059-71974081 CTCATTCTCCCCTGCAGGGCTGG - Intergenic
992424172 5:76638677-76638699 CTCATTCCTCTATGTAGGGAGGG - Intronic
993583586 5:89695268-89695290 CTCATTCACCCCTGCATGATAGG - Intergenic
994715776 5:103320144-103320166 CTAATTCCTCTGTTCAGGGTTGG + Intergenic
998447605 5:142210845-142210867 CTCAATCAGCTCTGCGGGCTGGG - Intergenic
999303849 5:150507561-150507583 TTCTTCCTTCTCTGCAGGGTGGG + Intronic
1000424963 5:161079816-161079838 CTCACTCATTACTGCAGGGACGG - Intergenic
1003670127 6:8149289-8149311 CTCATTCTTTGCTGCAGGGATGG + Intergenic
1005491835 6:26354331-26354353 CTCACTCATATCCGCAGGGTTGG + Intergenic
1007378675 6:41472810-41472832 CTCATTCATCTCTTCTGAGGGGG - Intergenic
1008480091 6:51977247-51977269 CTCATTGCTCTGTGAAGGGTGGG + Intronic
1009841320 6:69078850-69078872 CTTATTCATCACTGCACTGTTGG + Intronic
1010917492 6:81638525-81638547 ATCAGTCATCACTGCAGGGCAGG - Intronic
1014528435 6:122529664-122529686 CTCATTCATTTTTGAAGGATGGG + Intronic
1015190314 6:130465087-130465109 CTCACTCATCACTGCAGGGAGGG + Intergenic
1018411590 6:163554292-163554314 CTCATCCAGCTCTTCAGGGTCGG + Intronic
1018474384 6:164125190-164125212 CTCATTTATATTTGCAAGGTGGG - Intergenic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1019599691 7:1875004-1875026 CTCCTTCCCCTCTGCAGGGCAGG + Intronic
1019753934 7:2754077-2754099 CTCATTCATCACTGGTGGGGAGG - Intronic
1020785667 7:12570283-12570305 CTGACTCAACTCTGCAGGGCTGG + Intergenic
1020842804 7:13241670-13241692 TTCATTCACCCCTGCAGGGGAGG + Intergenic
1021420822 7:20443110-20443132 CTCTTTCATCTCTGCCGTCTGGG - Intergenic
1026655194 7:72250633-72250655 CTCACTCATTACTGCAGGGAGGG - Intronic
1028120700 7:87053596-87053618 CTCATTCATCTATATGGGGTGGG + Intronic
1029934003 7:104403412-104403434 CTTATTCATCTCTGCATCCTTGG + Intronic
1030417808 7:109267436-109267458 CTATTTCATCTCTGCAGCCTTGG - Intergenic
1030493280 7:110265649-110265671 CTCATTAATCTCTCCAGGAAAGG - Intergenic
1031550219 7:123101456-123101478 CTCACTCATTACTGCAGGGAGGG + Intergenic
1032748520 7:134812519-134812541 GTCTCTCATCTCTGAAGGGTGGG - Intronic
1034761589 7:153677582-153677604 CTCATTCTTTCCTCCAGGGTGGG - Intergenic
1035072927 7:156158009-156158031 CTCCCTCGTCTCTGCCGGGTGGG - Intergenic
1036012313 8:4740132-4740154 CACAGTCATCCCTGCAGGGAGGG - Intronic
1037833876 8:22204931-22204953 CTCACTCAGCTCTGCAGCCTCGG - Intronic
1038123310 8:24642517-24642539 CTGACTCTTCTCTGCATGGTGGG - Intergenic
1039520586 8:38167725-38167747 CTGACCCATCTCTGCATGGTGGG - Intronic
1041421988 8:57677377-57677399 CTCATTCATCACTGGAAAGTTGG + Intergenic
1042012373 8:64261724-64261746 AGCATTCATCTCTGTAGGGATGG - Intergenic
1042373043 8:68014533-68014555 CACAATAATCTCTGAAGGGTAGG - Intronic
1045368469 8:101497624-101497646 CTGATTCAACACTGCTGGGTTGG - Intronic
1046717467 8:117583535-117583557 CTCATTTATCTTAACAGGGTGGG - Intergenic
1047407536 8:124597869-124597891 CTCAGGCATCTCTGCAGGAGAGG + Intronic
1049188019 8:141269225-141269247 ATCATTCATCTCTGAAGTGCTGG - Intronic
1050657498 9:7845094-7845116 CTCACTCATTACTGCAGGGAGGG + Intronic
1051710482 9:19926211-19926233 CTCCTTTCTCCCTGCAGGGTGGG + Intergenic
1052587829 9:30451728-30451750 ATCATTAATCTCAGCAGGTTGGG + Intergenic
1053122576 9:35557897-35557919 CACATTCTTCCCTGCAGGGCTGG + Exonic
1055156158 9:73065597-73065619 CTCTTTCAGCTCTGCAGTCTGGG - Intronic
1056157515 9:83853232-83853254 TTCCTTCATTGCTGCAGGGTAGG - Intronic
1056353029 9:85770865-85770887 TTCCTTCATTGCTGCAGGGTAGG + Intergenic
1058422583 9:104846707-104846729 CTCATTCATCTCTTCTGGAACGG + Intronic
1187279082 X:17843418-17843440 CACATTCATTGCTGAAGGGTTGG - Intronic
1188309179 X:28596467-28596489 ATCAGTCATCTCTGTAGGGAGGG - Intronic
1189254762 X:39629337-39629359 CTCATCCATCTGTGCAGGACTGG - Intergenic
1190114087 X:47614355-47614377 CTCAGGGATCTCTGCAGGATGGG + Intronic
1190605866 X:52141207-52141229 CTCCTTCATTTCTGGAGGATAGG - Intergenic
1192172869 X:68867676-68867698 CTCCTTCCTCTGTGGAGGGTGGG - Intergenic
1192848911 X:74932985-74933007 CTCATTCTTCTTGGAAGGGTAGG - Intergenic
1195300978 X:103529696-103529718 CTCACTCATCACAGCAAGGTTGG - Intergenic