ID: 950117847

View in Genome Browser
Species Human (GRCh38)
Location 3:10462990-10463012
Sequence ACATATATGCAAAAGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 268}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950117847_950117850 -5 Left 950117847 3:10462990-10463012 CCTTCCAACTTTTGCATATATGT 0: 1
1: 0
2: 2
3: 25
4: 268
Right 950117850 3:10463008-10463030 TATGTTCCTTGGATCCAGAATGG 0: 1
1: 0
2: 0
3: 20
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950117847 Original CRISPR ACATATATGCAAAAGTTGGA AGG (reversed) Intronic
904342090 1:29842873-29842895 ACATACAAACAAAATTTGGAAGG + Intergenic
905526560 1:38644518-38644540 ACATGTCTGCAAAGGTTGGTTGG - Intergenic
905997540 1:42394359-42394381 ACATGCATGCACAGGTTGGAGGG + Intronic
906037776 1:42763262-42763284 ACATTTAGGGAAAAGGTGGATGG + Intronic
906620899 1:47277810-47277832 ACATGTATGGCAAAGTTGTATGG - Intronic
907183215 1:52588863-52588885 GTATGTATGCAAAAGTTGGAGGG + Intergenic
907625822 1:56028312-56028334 ACATATATGTACAGGTGGGATGG + Intergenic
907779262 1:57550622-57550644 AGATATATGGTAAAGTTGGATGG - Intronic
908306281 1:62821751-62821773 ACATACATGCAAATATTGAAAGG - Intronic
908609574 1:65842325-65842347 TCATATATGAAAGAGTTGCATGG + Intronic
908630046 1:66093863-66093885 ACAAATATGGAAAAGTAGAAGGG + Intronic
909135297 1:71791519-71791541 ATATATAGGTAAAAGTTGGTAGG - Intronic
910240317 1:85079510-85079532 ACATCTATTGAGAAGTTGGAGGG + Intronic
910490269 1:87761653-87761675 AAACATCTGCAATAGTTGGAGGG + Intergenic
911889047 1:103343585-103343607 GCAGATATGGAAAAGTTGGATGG + Intergenic
912253195 1:108032053-108032075 ACATTTATGAAAAATTAGGAAGG - Intergenic
913363804 1:118013061-118013083 ACATATATGTGAAAGGAGGAGGG - Intronic
913571723 1:120126989-120127011 GCACATATGCTAAAATTGGAAGG + Intergenic
914292643 1:146288611-146288633 GCACATATGCTAAAATTGGAAGG + Intergenic
914408297 1:147399908-147399930 ACATATATGCTAAAATTTTATGG - Intergenic
914553687 1:148739394-148739416 GCACATATGCTAAAATTGGAAGG + Intergenic
915197852 1:154203419-154203441 ATATATATGCAAAAGTTACCTGG - Intronic
915383512 1:155466804-155466826 ACACCTATGCAACAGTTAGAAGG - Intronic
915784281 1:158591250-158591272 AAATATATGGATAAGTTTGAGGG + Intergenic
915866924 1:159511159-159511181 TGATATATGCAAAACTTGGATGG + Intergenic
915955660 1:160218080-160218102 TCATAAAGGCAAAAGCTGGAGGG - Intronic
916270336 1:162934523-162934545 ACATATCTGGAAAAGTTAAAGGG + Intergenic
917005622 1:170414065-170414087 GCATATATGCAAGAGTTACAGGG + Intergenic
917314676 1:173711902-173711924 ACAGATATACAAAAATAGGAGGG + Intergenic
919051892 1:192521896-192521918 ACATTTATGCCAAAATTGGAAGG + Intergenic
920344477 1:205297309-205297331 AAAAAAATGCAAAAGTTAGACGG - Intergenic
921290256 1:213650535-213650557 ACATAGATGCAAATGCTGAAAGG - Intergenic
922394230 1:225179520-225179542 AGAGATATCCACAAGTTGGAAGG - Intronic
922737155 1:227993038-227993060 ACATATATACAAATGTTGGCTGG + Intergenic
922895638 1:229097846-229097868 ACACGTATGCAAAAGTTGTTCGG - Intergenic
1065182997 10:23145521-23145543 ATATATATGCAAAAATTAGCTGG - Intergenic
1065725919 10:28667934-28667956 GCACATATGCTAAAATTGGAAGG + Intergenic
1066392043 10:34985284-34985306 ACATTTATGGCAGAGTTGGAAGG - Intergenic
1067466883 10:46507220-46507242 ATATATATGTAATAGGTGGATGG + Intergenic
1067620303 10:47877385-47877407 ATATATATGTAATAGGTGGATGG - Intergenic
1069261830 10:66407873-66407895 AAAAATATGTAAAAGTTGGCCGG - Intronic
1071033794 10:81217453-81217475 CCATATTTGCAATAATTGGAAGG + Intergenic
1071392178 10:85186885-85186907 ACATATTGGCTAAAGTTGAAAGG - Intergenic
1071702015 10:87949183-87949205 ACAAATATTAAAAAGTTGGGAGG - Intronic
1073741341 10:106410740-106410762 AGATTTAAGCAAAAGTTGTACGG + Intergenic
1075110434 10:119576282-119576304 AGATATATTCAAAAGTTTGATGG - Intronic
1075394353 10:122115843-122115865 TCATCTGTGCAAAAGTTGCAAGG - Intronic
1075438988 10:122464437-122464459 AAATATTTGCAAAAGAAGGAGGG - Intronic
1082282889 11:50289346-50289368 ACATATATACTAAAATTGGGGGG + Intergenic
1084246791 11:67863208-67863230 ATATCTATGGAAAAGTTGAAGGG + Intergenic
1085834502 11:79937897-79937919 CTATATATGCAAAAGATGGATGG - Intergenic
1088641813 11:111879935-111879957 CAATATATGCAAAAGCTTGATGG + Intronic
1089100255 11:115957095-115957117 ACATAAAAGCAAAAAATGGATGG + Intergenic
1089632002 11:119789661-119789683 ACATGAATGGAAAAGTAGGATGG + Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090742796 11:129681275-129681297 ACAGATATGGAAAAGTCTGAAGG - Intergenic
1091485231 12:880297-880319 CCATATATGTAAAAGTTGCCAGG - Intronic
1093558603 12:20509543-20509565 ACAGATATGAATAAGTTGGTAGG + Intronic
1093594227 12:20942270-20942292 ACATATTAGCTAAAGTTGAAGGG - Intergenic
1093903640 12:24663895-24663917 ACATATATTTTAGAGTTGGAAGG - Intergenic
1095169499 12:39017870-39017892 ACATATATTTAAAATTTGGGAGG + Intergenic
1095503886 12:42871306-42871328 ACATATATGTGAAAGGGGGAGGG - Intergenic
1095576101 12:43741184-43741206 ACATTTAAGCAAAAGCTGGATGG - Intronic
1095579906 12:43785537-43785559 ACATAGATATAAAAATTGGAAGG + Intronic
1095588661 12:43877665-43877687 ACATATATGTAATATTTTGAGGG + Intronic
1096175317 12:49511901-49511923 AGATATATAGAAAAGTTGAAAGG + Intronic
1096299644 12:50415586-50415608 ACATATAACAAAAAATTGGAAGG - Intronic
1097538023 12:60898524-60898546 ATATATATGAATAAGTAGGATGG + Intergenic
1098376945 12:69826080-69826102 ATATATATTTAAAAGTTGAATGG + Intronic
1098950477 12:76635644-76635666 AAATATATTAAAAAGTTGAAAGG + Intergenic
1100942368 12:99738382-99738404 ACAAATATGGAGAAGTTAGATGG - Intronic
1106015039 13:25861138-25861160 ACATATATGGAAAATATAGAAGG + Intronic
1106839068 13:33666909-33666931 ACATATATTTAAAAAGTGGATGG + Intergenic
1109164870 13:59021234-59021256 ACATATATGGAAATGCTGGGAGG + Intergenic
1109548674 13:63862438-63862460 CCAGATAAGCAAAAGTTGAAGGG + Intergenic
1110104372 13:71652683-71652705 AGATATCTGCAAAATTTAGAAGG - Intronic
1110801042 13:79695196-79695218 GCATATATCCAGAAGTGGGATGG + Intergenic
1111430332 13:88141397-88141419 ACATTTATTCAAAAGTTACAAGG - Intergenic
1112125696 13:96465256-96465278 ACAAATATGCAAAAGTTCTCTGG - Intronic
1113110953 13:106822938-106822960 ACATAAATGCAAGAGTTCTATGG - Intergenic
1113831906 13:113302344-113302366 AAATATATACAAAAATTAGACGG - Intronic
1114761069 14:25315120-25315142 ACATATTTGCACAATTTTGATGG - Intergenic
1114777557 14:25501809-25501831 AAATATATGCAAAAGTAAAAAGG - Intergenic
1114937396 14:27558142-27558164 ACATATATGCAAATATCAGATGG - Intergenic
1115113125 14:29848252-29848274 AAAAAGATGCAAAAGGTGGATGG + Intronic
1115983682 14:39081673-39081695 ACAAATATGGAAAAGTGGGAAGG + Intronic
1117580535 14:57146950-57146972 AGATATATGCAAAATTGGCAAGG + Intergenic
1117629703 14:57677711-57677733 ACATATATGCATAAAATGAAAGG + Intronic
1118207945 14:63740730-63740752 ACACATATGTATAATTTGGAGGG + Intergenic
1119081159 14:71695327-71695349 ATATAAATGCAAAAGAGGGATGG + Intronic
1120238116 14:81916634-81916656 ACATATATGCCAAAGTCAGTGGG + Intergenic
1120670226 14:87354480-87354502 ACATACATGCCAAAGATGGCTGG + Intergenic
1124154699 15:27215629-27215651 ACACATTTGCAAAACTTGCATGG + Intronic
1124889746 15:33721800-33721822 ACATATATTCAAAAGTGGGTTGG - Intronic
1125184153 15:36911395-36911417 ACAGACATGCTAAAGTTAGATGG - Intronic
1125418750 15:39481076-39481098 ACATGTATGTAAAAGTAGCATGG - Intergenic
1129067189 15:72915264-72915286 ACATATATACAAAAATTAGCTGG + Intergenic
1129449791 15:75644775-75644797 ACAAAAATACAAAAGTTGGCTGG + Intronic
1131034503 15:89212654-89212676 ACATGTATGAAAAGATTGGAAGG + Intronic
1140253087 16:73311806-73311828 ACCTATATGTAAATGTTGCACGG - Intergenic
1140959022 16:79894929-79894951 ACATATAACCAAAAATGGGAGGG + Intergenic
1140980889 16:80108335-80108357 AGATTTATGAAAAAGTTGCAAGG - Intergenic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1142294997 16:89215516-89215538 ATATATATGCAAAAGTGGAATGG - Intergenic
1143570079 17:7752325-7752347 ACATATTTGTAAAAGTTGCTAGG - Intronic
1143928659 17:10397236-10397258 ACATATATACAAAAATTAGCTGG - Intronic
1148632737 17:49124889-49124911 ACATATTGGCTAAAGTTGAAGGG - Intergenic
1149250487 17:54762931-54762953 TCATTTATGCAAAAGTAGGGTGG - Intergenic
1153406539 18:4747265-4747287 ACCTAAATGCAAAAGTTAGGAGG + Intergenic
1153512035 18:5865569-5865591 ACATATTTGCTAAAGTTAAAGGG + Intergenic
1155055630 18:22180181-22180203 ACACATATACTAAAATTGGAAGG - Intronic
1156198268 18:34800885-34800907 ATTTATATGGAAAAGTTGCAGGG - Intronic
1156831466 18:41497204-41497226 TCATATCTGCAAAAATTGTAAGG + Intergenic
1157954401 18:52081145-52081167 AAACATATGCAAAACTAGGAGGG + Intergenic
1158183324 18:54742876-54742898 ACATAGATGCAAAATTTGCAAGG - Intronic
1158864230 18:61622001-61622023 ACATATTGGCTAAAGTTGAAGGG + Intergenic
1159326478 18:66926201-66926223 ACAGCTATGAAAAACTTGGAGGG + Intergenic
1159683363 18:71384194-71384216 ACATATTTCCAATATTTGGAAGG - Intergenic
1162667639 19:12228085-12228107 ACATATTGGCTAAAGTTGAAGGG - Intronic
1166500146 19:43334312-43334334 ACATACATGAAAAAATAGGATGG - Intergenic
925568473 2:5283123-5283145 TCCTATATGCAGAAGCTGGAAGG + Intergenic
926014898 2:9442404-9442426 AAATATATGCAGAACTTGGGAGG + Intronic
926540888 2:14179916-14179938 TGATATATGTAAAAATTGGAAGG + Intergenic
926931529 2:18046199-18046221 AGAATTATGCAAAATTTGGAGGG + Intronic
927795287 2:26042690-26042712 GCATATATACTAAAATTGGAAGG + Intronic
928292309 2:30050211-30050233 ACATATATGCAAAGCATGGGTGG + Intergenic
929349202 2:40928062-40928084 ACATATATGGAAACACTGGAGGG - Intergenic
930927684 2:56839200-56839222 ACATATCTACAAAATTTGGGGGG + Intergenic
931113709 2:59141517-59141539 ACATATATAAAAAAGATGTATGG - Intergenic
931723949 2:65090685-65090707 ACATATAGGCAAGAGTTTGTAGG - Intronic
931914585 2:66939737-66939759 ACTTATGTGCAAAATGTGGAAGG + Intergenic
933066040 2:77797620-77797642 ACATAAATGCAGAATTTTGAGGG - Intergenic
934075473 2:88424782-88424804 ACGTATATAAAAAAGTTGCATGG - Intergenic
934931839 2:98432620-98432642 ATATATATTCCAAAGTTGTATGG + Intergenic
936615087 2:114040333-114040355 AGACAGATGTAAAAGTTGGAGGG - Intergenic
936676235 2:114718733-114718755 ACATGTATGCTAAATTTGTAAGG + Intronic
937638335 2:124183023-124183045 ATAAATAAGCAAAAGGTGGAGGG - Intronic
939467248 2:142573987-142574009 ACATATATGTAAAAGTAAAAGGG + Intergenic
939492537 2:142893896-142893918 AAAAATATGGAAAAGTTGGTTGG - Intronic
939682856 2:145160224-145160246 ACATAGATGCAAATGATGGCAGG + Intergenic
939723243 2:145681221-145681243 ACATATATACAAAAGTAGCCAGG + Intergenic
940015032 2:149095316-149095338 AAATAAAGGCAAAAGTTGGAAGG + Intronic
940935094 2:159483925-159483947 AAATATGTGCAAAAGATGAAGGG + Intronic
941394545 2:164957927-164957949 ATATATATGCAAAAATTCCAAGG + Intergenic
942237762 2:173928836-173928858 TCAAATATGTAAAAATTGGAGGG - Intronic
942253954 2:174073149-174073171 ACATATATACAAAAATTAGCTGG - Exonic
943525869 2:189016693-189016715 ACAGATATTCAAAACTTTGATGG - Intergenic
943608385 2:190003405-190003427 ATATAAATGCAAAAGTTTGTTGG - Intronic
943804464 2:192105723-192105745 ACATATATGCAGAAAATGGAAGG + Intronic
945342710 2:208676285-208676307 ACAAAAATGCAAAAATTAGATGG - Intronic
945969472 2:216221763-216221785 ACATATTAGCAAGAGTAGGAGGG - Intergenic
946814039 2:223557690-223557712 ATATATATGCAAAAGTGGGATGG - Intergenic
946850055 2:223897337-223897359 ATATATATGCGAAATTTAGAGGG - Intronic
947677756 2:231999515-231999537 ACAAATATGGAAAAGTGGAAAGG - Intronic
1169256635 20:4104905-4104927 ACAAATATGGCAAAGATGGAGGG - Intergenic
1169686046 20:8273240-8273262 ACATACATGCAAGATTTGGTAGG - Intronic
1173403096 20:42741951-42741973 ATATATCTGAAAAAGTTGGTTGG + Intronic
1173850354 20:46214042-46214064 ACATTTCTGCAAAAGTCAGAAGG + Intronic
1177474286 21:21598464-21598486 ACATAGAATCAAAATTTGGATGG - Intergenic
1177743289 21:25179558-25179580 ACTTATAAGTAAAAGTTGAAAGG - Intergenic
1178265506 21:31138983-31139005 AGAAATGTGCAAAAGATGGAAGG - Intronic
1180578340 22:16803157-16803179 AAGTATATGCAAAAGTGGAAAGG - Intronic
1181997790 22:26896644-26896666 ACATATATGCATAAGCTAAATGG + Intergenic
1182862070 22:33568821-33568843 ACATATCTGGAACAGATGGATGG + Intronic
949180578 3:1125346-1125368 ATACATAAGCAAAATTTGGAAGG + Intronic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
951040394 3:17982892-17982914 ACACATAAGCAAAAGTTTGGTGG + Intronic
951079397 3:18434022-18434044 ACATTTATGAAAAATTTTGATGG + Intronic
951274946 3:20673647-20673669 ACATATATACATAATTTTGAAGG + Intergenic
953220386 3:40965434-40965456 ACATATATGCAAAAATTCTCAGG - Intergenic
954559970 3:51548482-51548504 ATATATATGAAAATGTTGGCTGG - Intronic
955456613 3:59128624-59128646 ACATAAAAGGAAAAGTTTGAGGG - Intergenic
956112950 3:65889535-65889557 ACAGATGTTCAAAAGTTGGTTGG - Intronic
956442196 3:69291464-69291486 TCACATATGCAAAAGTCGTAAGG + Intronic
956896135 3:73662103-73662125 ACATATCTCCAAATGATGGAAGG - Intergenic
957288573 3:78248344-78248366 ACATATATTCTAAAATTGTATGG + Intergenic
957501993 3:81069183-81069205 ACATATTGGCTAAAGTTGAAGGG + Intergenic
959180001 3:102966882-102966904 ACAAATATACAAAGATTGGAAGG - Intergenic
959196359 3:103187891-103187913 ACATTTATGCAAAATATTGAAGG + Intergenic
959931646 3:111990379-111990401 ACATATAGACAAATATTGGAAGG + Intronic
960203212 3:114863195-114863217 ACATATATCCATAAAGTGGAGGG + Intronic
960307275 3:116076830-116076852 ACATAAATGCAAAAATTGAAAGG - Intronic
960616835 3:119603601-119603623 ACTTACATGCAAATGTTGGTGGG - Intronic
962709966 3:138077972-138077994 TGATATATGCTAAAGTTAGAGGG - Intronic
963327958 3:143882644-143882666 AAATTTATGCAAGATTTGGAGGG + Intergenic
963719704 3:148848087-148848109 CAATATAAGAAAAAGTTGGAAGG - Intronic
964209779 3:154214065-154214087 ACACACATGCAAAAGAGGGAAGG + Intronic
965503746 3:169487766-169487788 AGATATATGCAAAAAAGGGAGGG + Intronic
966090605 3:176130860-176130882 ACATATATTCAAAAATCTGAAGG + Intergenic
966511144 3:180765042-180765064 ACAAATATGCAAAAATTGTCAGG + Intronic
967770294 3:193326876-193326898 AAATATATACAATAGTTGGCTGG - Intronic
969068405 4:4509794-4509816 ACATATAAGAAAATGTTTGAAGG + Intronic
970328478 4:14953957-14953979 AAATATTTTCAAAACTTGGAGGG - Intergenic
970865057 4:20748549-20748571 ATATATATATAAAATTTGGAAGG - Intronic
971089330 4:23322133-23322155 ACATATATTCAAAAGTTCACAGG + Intergenic
972921278 4:43945441-43945463 ACATTTATTCAAAGGTTGAAAGG + Intergenic
972998307 4:44911686-44911708 ACACATATGATAAAGTTGTATGG + Intergenic
975688294 4:76939747-76939769 AAATCTAAGCAAAAGTTTGATGG + Intergenic
975756392 4:77575863-77575885 ACATATATTCCAAAATTGTATGG + Intronic
975765278 4:77661143-77661165 ACATACATCCAAAAGTAGGTGGG + Intergenic
976242678 4:82974879-82974901 ACGTAGATACAAAAGTGGGATGG + Intronic
977043668 4:92043502-92043524 ACATATTAGCTAAAGTTAGAGGG - Intergenic
977372883 4:96162610-96162632 ACCTAGATGAAAAAGTTAGATGG - Intergenic
977831837 4:101603359-101603381 ACATATATAAAATAGTTGGAGGG + Intronic
977980778 4:103318938-103318960 AGATATAAGCAAAAGTTGTAGGG - Intergenic
979969757 4:127119826-127119848 ATATATATTCAAAAATTGGCTGG - Intergenic
980280269 4:130709027-130709049 ACATATATGCCAAGATTGCAAGG - Intergenic
981232649 4:142375713-142375735 AGATAAATGCAAAAGTTCTAAGG - Intronic
982044200 4:151425886-151425908 ACACATATACTAAAATTGGAGGG + Intronic
982046940 4:151457571-151457593 ACATATATGTGACAGGTGGAGGG - Intronic
983346254 4:166528665-166528687 ACATTTAAGCAAAGATTGGAAGG + Intergenic
983855259 4:172635521-172635543 TCAAATATGCAAAATTTGAAAGG - Intronic
984985644 4:185326938-185326960 ACATATTGGCTAAAGTTGAAGGG - Intronic
985135842 4:186785338-186785360 ACATATCTCCAGAAGTGGGATGG + Intergenic
987968758 5:24913615-24913637 AAATATATGCAATAGGTGAAAGG + Intergenic
989059557 5:37396978-37397000 ACAAAAATGCAAAAATTAGACGG + Intronic
989427581 5:41314588-41314610 ACATTTGTGCAAAGGTTTGAAGG + Intronic
989524476 5:42437707-42437729 ACATATATACAAAAATTAGCTGG - Intronic
989692063 5:44156409-44156431 ACATATCTGCCAAAATTGTATGG + Intergenic
990261766 5:54030395-54030417 ACATTAATGGAAATGTTGGAAGG + Intronic
992560465 5:77947480-77947502 AAATATAAGCAAAAATTGGGTGG + Intergenic
994584183 5:101684576-101684598 ACAGAAATGCAAAAGTAGGAGGG - Intergenic
996409793 5:123145230-123145252 ACAAATATCCAAAGGTTGGATGG + Intronic
996740460 5:126794094-126794116 ACAAAAATACAAAAGTTGGCTGG - Intronic
998771697 5:145553000-145553022 AAATATCTGCAAAAGGTAGAAGG - Intronic
999221233 5:149979538-149979560 ACAAAAAGGCAAAAGTTGGTTGG - Intronic
1001671653 5:173478692-173478714 CCCTAGATGCAAAAGATGGAAGG - Intergenic
1004619192 6:17318613-17318635 ACATCTACGCAAGAGTTGAAGGG - Intergenic
1005532892 6:26725335-26725357 ACATAAAAGCAAAAATTGCAAGG + Intergenic
1005537903 6:26776329-26776351 ACATAAAAGCAAAAATTGCAAGG - Intergenic
1007486147 6:42182077-42182099 ACATACATTCAGAAGTGGGAGGG + Intergenic
1008132585 6:47735738-47735760 ATATATACCCAGAAGTTGGATGG - Intergenic
1009006598 6:57796283-57796305 ACATAGAAGCAAAAATTGCATGG - Intergenic
1009008771 6:57818735-57818757 ACATAGAAGCAAAAATTGCATGG - Intergenic
1009491956 6:64302500-64302522 CCATAAATGCAAAAGTTGAAAGG - Intronic
1009726892 6:67546666-67546688 ACATACATACTAAAATTGGACGG + Intergenic
1012403051 6:98860453-98860475 ACATATATGGGAAAGGTGTATGG - Intergenic
1012822704 6:104107166-104107188 GCATAAATGCAAAAATAGGATGG + Intergenic
1014207897 6:118676693-118676715 ATATATACCCAAAAGTGGGATGG + Intronic
1015125952 6:129754864-129754886 ACACATATGCAACAGTTGGAAGG + Intergenic
1015449817 6:133353388-133353410 ACCTAGAAGCAAAATTTGGAAGG - Intronic
1015861825 6:137689467-137689489 TTATATGTGCAAAATTTGGAAGG + Intergenic
1017294373 6:152776920-152776942 ACATTTATGAAGAATTTGGAGGG + Intergenic
1017885028 6:158591843-158591865 ACATAGATACAAAAGATGGAAGG - Intronic
1020688314 7:11323298-11323320 TCATTTATGCTAAAGTTTGAGGG + Intergenic
1022003607 7:26247636-26247658 ACATATATGCAAATCTTGGCCGG + Intergenic
1022018140 7:26371171-26371193 ATATATATGGTAAAGTTGGCTGG + Intronic
1023590476 7:41776194-41776216 ACATATATTCAGAAGTAGGATGG + Intergenic
1024662117 7:51507004-51507026 ACATTTATACAAAAGTTAGCTGG - Intergenic
1024780633 7:52843893-52843915 ACACAGATGCAGAAGTTGAAAGG + Intergenic
1027608983 7:80335689-80335711 ACATAAATGCAAACATTGTAAGG - Intergenic
1029864653 7:103614382-103614404 AGATATAAGTAAAAGGTGGAAGG + Intronic
1031046176 7:116890612-116890634 ACATATATACAAAAATTAGCAGG + Intronic
1031156650 7:118118927-118118949 CCATACATGCAAAAGTTAAAAGG - Intergenic
1031483123 7:122301765-122301787 ACAATTATGAAAAATTTGGAGGG - Exonic
1032662414 7:133999600-133999622 AAATATTTGCAATAGATGGAAGG + Intronic
1036999579 8:13702559-13702581 ACGTATATGCAAATGATAGAAGG + Intergenic
1038449733 8:27632491-27632513 ACATATATGCAGAAAATGGCAGG - Intergenic
1038711758 8:29953425-29953447 TCACATATGCATAAGCTGGAAGG - Intergenic
1039032147 8:33322169-33322191 ACATTTAGGGAAAAGTTGAAGGG - Intergenic
1042760494 8:72267084-72267106 ACCTATATGCCAAAGATGAAGGG - Intergenic
1043591606 8:81840363-81840385 TCATGTATGTAAAAGTTGGTAGG + Exonic
1047969744 8:130074591-130074613 ACAGCAATGCAAAAGATGGAGGG + Intronic
1048746767 8:137623273-137623295 ACATTTGTGCAAAAGTCGTATGG + Intergenic
1051180047 9:14401893-14401915 TCATATAAGCAAAAGGTGTAGGG - Intergenic
1051570364 9:18550202-18550224 ACATATATTCACAAGTTTCAGGG - Intronic
1051788518 9:20773202-20773224 AAATATATGCTAAAGGTGGGGGG - Intronic
1052295257 9:26890647-26890669 ACATATACATAAAAGTTGGCCGG + Intronic
1052892620 9:33718288-33718310 ACAGATATGGAAAAGTCTGAAGG - Intergenic
1055984042 9:82037392-82037414 CCATTTATGCAGAAGTGGGAAGG - Intergenic
1057288505 9:93781557-93781579 CAATATATGCTAAAGATGGATGG - Intergenic
1058720938 9:107763004-107763026 AAATATAGGCAAAAGTTGCATGG - Intergenic
1058852785 9:109028569-109028591 ACATGTATGGCAAAGGTGGATGG + Intronic
1059631772 9:116132213-116132235 ATATATATCCAGAAGTGGGATGG - Intergenic
1060752821 9:126184945-126184967 AAATATATTTAACAGTTGGAGGG + Intergenic
1185859958 X:3568613-3568635 ACATATATTCAATAGGTAGATGG - Intergenic
1187396800 X:18926448-18926470 ACATATATGCCAAGCTTGGTAGG - Exonic
1190278309 X:48913344-48913366 AAGAATCTGCAAAAGTTGGAGGG + Exonic
1190458756 X:50650194-50650216 ACAGATATGCAAATATTGAAAGG + Intronic
1190735784 X:53255402-53255424 ACATATAGGAAAAAACTGGAAGG - Intronic
1193341745 X:80356161-80356183 AGAAATATGCAAATGTTTGAGGG + Intronic
1193646538 X:84076386-84076408 ACACAGATGCAAAAATTGTAAGG + Intronic
1193648463 X:84098809-84098831 ACATATGTGCAAAATTAAGAGGG + Intronic
1193654371 X:84181875-84181897 AGATATATGAAAAGGGTGGAGGG - Intronic
1194737221 X:97526855-97526877 AGATAGATGGAAAAGTTGAATGG - Intronic
1195053447 X:101120083-101120105 ACATACATGCAAATATTGAAAGG + Intronic
1195672519 X:107481924-107481946 ACTTATGTGCAAAATTAGGAAGG - Intergenic
1197052761 X:122079664-122079686 TATTATATGCAAAAGTTAGATGG + Intergenic
1197231893 X:124014335-124014357 ACATATATATAAAGGATGGAAGG - Intronic
1197308247 X:124870533-124870555 ACATTTAAGCAAAAGCTTGATGG + Intronic
1198755937 X:139982601-139982623 ACATATATACAAAAATTAGCCGG - Intergenic
1198879884 X:141268578-141268600 AATTATATGCAAAATTTAGAAGG + Intergenic
1201783880 Y:17752252-17752274 ACATATATGCAACAGAAGGGAGG - Intergenic
1201817673 Y:18153735-18153757 ACATATATGCAACAGAAGGGAGG + Intergenic
1201898321 Y:19018082-19018104 ACATACATGAAAAAGGTGAAAGG + Intergenic
1201987122 Y:19980740-19980762 ATATATAGGCTAAAGTTAGAGGG - Intergenic