ID: 950119657

View in Genome Browser
Species Human (GRCh38)
Location 3:10473339-10473361
Sequence TATGAAGAGCAGGCCAGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1239
Summary {0: 1, 1: 1, 2: 16, 3: 179, 4: 1042}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950119652_950119657 20 Left 950119652 3:10473296-10473318 CCTCTGCACTTGCTTCTGTTAGG 0: 1
1: 0
2: 0
3: 18
4: 201
Right 950119657 3:10473339-10473361 TATGAAGAGCAGGCCAGGTGTGG 0: 1
1: 1
2: 16
3: 179
4: 1042

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950119657 Original CRISPR TATGAAGAGCAGGCCAGGTG TGG Intronic
900230735 1:1555841-1555863 TAAAAAAATCAGGCCAGGTGGGG + Intronic
900312421 1:2040386-2040408 TCTGAAATGGAGGCCAGGTGTGG + Intergenic
900345987 1:2210472-2210494 TTTGGGGAGGAGGCCAGGTGGGG + Intronic
900352620 1:2243059-2243081 TGAGCAGAGCAGGGCAGGTGGGG - Intronic
900439537 1:2646674-2646696 AATTAAAAACAGGCCAGGTGTGG - Intronic
900782390 1:4626601-4626623 AAGGAAGGGCAGGCCAGGTGTGG + Intergenic
901553687 1:10015055-10015077 TGTTGAGAGTAGGCCAGGTGTGG + Intronic
901594161 1:10371652-10371674 AATAAAGACAAGGCCAGGTGAGG + Intronic
901649996 1:10737827-10737849 CAGGAAGAGCAGGCCTGGAGTGG - Intronic
901669359 1:10846423-10846445 CAAAAAGAGCAGGCCAGGCGCGG - Intergenic
901809394 1:11758666-11758688 CCTAAAGAACAGGCCAGGTGCGG + Intergenic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
902190646 1:14760661-14760683 TATAAAATTCAGGCCAGGTGTGG + Intronic
902258055 1:15203549-15203571 TTTTAAAAACAGGCCAGGTGTGG - Intronic
902423660 1:16302250-16302272 TAAGAAGGGCAGGCCGGGTGCGG + Intronic
902800469 1:18826457-18826479 GGTGAAGAGCAGGCCAGGAGTGG + Intergenic
902899991 1:19508240-19508262 TTTAAAAAGTAGGCCAGGTGCGG + Intergenic
903201274 1:21741684-21741706 TATGAAAAATAGGCCAGGTGTGG + Intronic
903492109 1:23737115-23737137 TATGGAGTGCTGGCCAGGCGTGG + Intergenic
904024440 1:27493425-27493447 GATGAACCCCAGGCCAGGTGTGG - Intergenic
904449193 1:30600230-30600252 AATGGAGAGCAAGACAGGTGTGG - Intergenic
905226938 1:36485149-36485171 AATGACCAGAAGGCCAGGTGCGG - Intergenic
905322938 1:37130552-37130574 TACGAGGAGCAAGCCAGGTAAGG - Intergenic
905565727 1:38963138-38963160 AATGAGGAGCAGGCCAGGCATGG + Intergenic
905646367 1:39627197-39627219 GATGAAGGTCATGCCAGGTGTGG + Intronic
905652328 1:39664777-39664799 CAAGAAAAGCAGGCCAGGTGCGG - Intronic
905687353 1:39918076-39918098 TTTCAAGAACAGGCCAGGAGTGG + Intergenic
906178965 1:43801661-43801683 TGTGATGAACAGGCCAGGTATGG + Intronic
906208731 1:44000654-44000676 TATGGAGCTCCGGCCAGGTGCGG + Intronic
906784960 1:48607325-48607347 TCTATTGAGCAGGCCAGGTGCGG + Intronic
906988695 1:50714059-50714081 TTTGTATATCAGGCCAGGTGCGG - Intronic
907085426 1:51668329-51668351 TAAGAAAAGGGGGCCAGGTGTGG + Intronic
907275500 1:53314633-53314655 CAGGAAGAGCAGTCCAGGGGCGG + Intronic
907319933 1:53595822-53595844 TCTGAAGTGCAGTCCTGGTGGGG + Intronic
907417324 1:54323503-54323525 TCTGATGAGCAGGCCAGGACAGG - Intronic
907993123 1:59601996-59602018 CATGAAGCCCAGGCCATGTGAGG + Intronic
908546629 1:65168580-65168602 TATGGAGAGCAGGCCAGATGTGG - Intronic
908577328 1:65474715-65474737 TAGCAAGAAAAGGCCAGGTGCGG + Intronic
908750388 1:67416969-67416991 AATAAAAAGTAGGCCAGGTGTGG + Intronic
909157729 1:72100920-72100942 CATGAAGAAAAGGCCATGTGAGG - Intronic
909224847 1:73006174-73006196 GAAAAAGAGCAGGCCAGGCGTGG - Intergenic
910264301 1:85322213-85322235 TGTGAAGAGAAGGCCTAGTGTGG - Intronic
910456170 1:87399363-87399385 TTTAAAGAGGAAGCCAGGTGTGG + Intergenic
910909310 1:92216987-92217009 TATAAACAAGAGGCCAGGTGTGG + Intergenic
911207894 1:95110999-95111021 TATGAAAAATTGGCCAGGTGTGG + Intergenic
911611129 1:99960183-99960205 TATATAAAACAGGCCAGGTGAGG - Intergenic
912101319 1:106209657-106209679 TAGGAAGAGCTGGCCAGGAGGGG + Intergenic
912409528 1:109470603-109470625 TATAAAGAGCAGCCAAGGAGAGG - Intronic
912685533 1:111759682-111759704 AATGAAGAGCAGGCCGGGCGCGG + Intronic
912713329 1:111964926-111964948 GATGAAGAGCTTGCCAGGTGTGG - Intronic
912729458 1:112089339-112089361 GATGAATAAGAGGCCAGGTGTGG - Intergenic
912828231 1:112925667-112925689 TAAGAAGAGAAGGCCAGGCACGG - Intronic
913145538 1:115986131-115986153 AATTAAGACTAGGCCAGGTGTGG - Intronic
913298838 1:117349184-117349206 TAAGAAAAGCTGGCCAGGTGCGG + Intergenic
914091090 1:144499641-144499663 TAAGAAAAACTGGCCAGGTGTGG + Intergenic
914345041 1:146791787-146791809 AAATAAGAACAGGCCAGGTGTGG - Intergenic
914780399 1:150780757-150780779 TATGAAGAAAATGTCAGGTGAGG + Intergenic
914829449 1:151160027-151160049 TTTGAAGAGGAAGCCAGTTGTGG - Exonic
915302615 1:154959972-154959994 TATGGACCACAGGCCAGGTGCGG + Intronic
915397082 1:155593202-155593224 TAAGAACAGTAGGCCAGGTGCGG - Intergenic
915496953 1:156288626-156288648 TAACAAGAGCAGGCCAGGTGTGG - Intronic
915502019 1:156325871-156325893 GATCAAGAGAAGGCCAGGCGTGG - Intronic
916071916 1:161175419-161175441 TAAGAAGAGAAGGCTAGGTAAGG - Intronic
916222147 1:162455468-162455490 TATCAAGTGAAGGCCAGGTGTGG + Intergenic
916242071 1:162650303-162650325 TAATAATAACAGGCCAGGTGTGG + Intronic
916520470 1:165559096-165559118 TGTAAAGTGAAGGCCAGGTGTGG + Intronic
916753890 1:167749867-167749889 CATGCAGATCAGGCCAGCTGTGG - Intronic
916797643 1:168181500-168181522 TATGGAGAGGAGGCCGGGTGCGG - Intronic
916943533 1:169700943-169700965 AATTAAGAGCAGGCCAGGCGTGG + Intronic
917124875 1:171678237-171678259 TATGAAGAGCAGCCGTGGGGTGG - Intergenic
917938361 1:179891854-179891876 AATGAAGAAAGGGCCAGGTGTGG - Intronic
918091236 1:181297002-181297024 TTTGAACAGCAGGCCAGGGATGG + Intergenic
918116904 1:181505662-181505684 AAAAAAGAGAAGGCCAGGTGCGG - Intronic
918223031 1:182453488-182453510 GATGGAGAGAAGGCCATGTGAGG + Intronic
918455800 1:184712214-184712236 TATGTTGAGTAGGCCAGGTGCGG - Intronic
918585004 1:186176876-186176898 AGGAAAGAGCAGGCCAGGTGTGG + Intronic
918602844 1:186383881-186383903 TATGAAAAACTAGCCAGGTGTGG + Intronic
919100429 1:193090092-193090114 GATGAAAAGTTGGCCAGGTGCGG - Intronic
919352292 1:196472917-196472939 TCTGAAGAGTAGGCCTGGTCTGG - Intronic
919596397 1:199568752-199568774 TAGAAAAAGCAGGCCAGGTGTGG + Intergenic
919662189 1:200258232-200258254 TTTCAAGAACAGGCCAGGTACGG + Intergenic
919702673 1:200647679-200647701 TCTTAAAAGCAGGCCAGGCGTGG + Intronic
919715422 1:200770702-200770724 TAGAAATAGTAGGCCAGGTGCGG - Intronic
920168711 1:204055450-204055472 TATTATAAGGAGGCCAGGTGTGG - Intergenic
920277258 1:204815820-204815842 TAAGAAAATCTGGCCAGGTGCGG + Intergenic
920325630 1:205161062-205161084 TAACATGACCAGGCCAGGTGTGG - Intronic
920330787 1:205206567-205206589 AAAAAAGAACAGGCCAGGTGCGG - Intronic
921243306 1:213209403-213209425 AATGTAAAGGAGGCCAGGTGTGG + Intronic
921850994 1:219931769-219931791 TATAAAATGCTGGCCAGGTGTGG - Intronic
922022944 1:221722471-221722493 TCTGAAGAGCAGGCCTGGTGTGG + Intronic
922510812 1:226165459-226165481 TAAGAAAAATAGGCCAGGTGCGG - Intronic
922713668 1:227853330-227853352 TAGACAGAGCAGGCCAGGTGTGG - Intergenic
923156449 1:231283514-231283536 TTTGTAGATCTGGCCAGGTGTGG - Intergenic
923477277 1:234345842-234345864 AAGGAAGATCAGGCCAGGAGTGG - Intergenic
923521306 1:234737113-234737135 AATGTATATCAGGCCAGGTGTGG - Intergenic
923788982 1:237094879-237094901 TAGGAAGACAAGGCCGGGTGCGG - Intronic
923902831 1:238347692-238347714 TTTGAAAACTAGGCCAGGTGCGG + Intergenic
924061415 1:240178722-240178744 AATGAAGAAAAGCCCAGGTGCGG - Intronic
924229834 1:241954125-241954147 AATGAAAAGCCGGCCGGGTGCGG - Intergenic
924355479 1:243170501-243170523 TAGTAAGTACAGGCCAGGTGTGG + Intronic
924423287 1:243929255-243929277 TATGAAGGGCAAGCCAGGCTGGG - Intergenic
924473554 1:244364393-244364415 AATAAAAAGCAGGCCGGGTGTGG - Intronic
924671183 1:246127603-246127625 TATGAAAAGGAGGCTGGGTGCGG + Intronic
924743321 1:246810538-246810560 AAAGAAAAGCCGGCCAGGTGCGG - Intergenic
924827913 1:247561242-247561264 TTTTAAAAGTAGGCCAGGTGTGG - Intronic
1063001707 10:1930803-1930825 TAAAAAAATCAGGCCAGGTGTGG + Intergenic
1063092491 10:2879641-2879663 AATGAGGACCAGGCCAGGAGTGG + Intergenic
1063326048 10:5103176-5103198 GATGAAGAGGAGGCCAGGAGCGG - Intronic
1063473522 10:6308220-6308242 AATGCAGGGAAGGCCAGGTGCGG + Intergenic
1063519250 10:6726087-6726109 AAGGAAGATCTGGCCAGGTGTGG + Intergenic
1063741721 10:8829590-8829612 GAAAAAGAACAGGCCAGGTGTGG - Intergenic
1063778519 10:9292857-9292879 TATTTTGAGCAGGCCAGGCGAGG - Intergenic
1064026776 10:11855181-11855203 AAAGAAGATAAGGCCAGGTGCGG + Intronic
1064142543 10:12802808-12802830 AATGAAGAGCAGGCCGGGGGCGG - Intronic
1064957110 10:20923355-20923377 TATGAATACGTGGCCAGGTGTGG - Intronic
1065010930 10:21420035-21420057 AATGAAGACCCGGCCGGGTGTGG + Intergenic
1065029757 10:21573852-21573874 TAAGAAGAATAGGCCAGTTGTGG - Intronic
1065061583 10:21907684-21907706 TATGAGGAAGAAGCCAGGTGTGG + Intronic
1065094118 10:22263818-22263840 TTTAAAAAGCAGCCCAGGTGTGG - Intergenic
1065491207 10:26283610-26283632 TAAGCAGAGCATGGCAGGTGTGG - Intronic
1065781102 10:29168541-29168563 TATCTAAATCAGGCCAGGTGTGG + Intergenic
1065952521 10:30665050-30665072 AATGAAAATTAGGCCAGGTGCGG + Intergenic
1066076902 10:31887945-31887967 TAGGAAGGGCAGGCCGGGCGCGG - Intronic
1066181614 10:32967150-32967172 TATGAAGTCTAGGCCAGGTGTGG - Intronic
1066382594 10:34913850-34913872 AAAGAAATGCAGGCCAGGTGTGG + Intergenic
1066409874 10:35157338-35157360 TAAGGATACCAGGCCAGGTGTGG + Intronic
1067001617 10:42619921-42619943 TATAAAAATCAGGCCAGGTGTGG + Intronic
1067032076 10:42884819-42884841 GAGGAGGGGCAGGCCAGGTGTGG - Intergenic
1067081412 10:43214581-43214603 TAGGAACAACAGGCCAGGAGGGG + Intronic
1067113163 10:43415000-43415022 AAAAAAGAGCTGGCCAGGTGTGG - Intergenic
1067124299 10:43502738-43502760 AAAAAAGGGCAGGCCAGGTGCGG + Intergenic
1067356879 10:45537360-45537382 TATGCTAAGTAGGCCAGGTGTGG + Intronic
1068582609 10:58759248-58759270 TTTAATGATCAGGCCAGGTGTGG - Intronic
1068710464 10:60127985-60128007 TATGAAGAACTGGCCGGGCGCGG - Intronic
1069033290 10:63620221-63620243 TATAAACTGCTGGCCAGGTGAGG - Intronic
1069252639 10:66289296-66289318 TTTAAAGAACAGGCCAGGCGTGG + Intronic
1069480559 10:68777928-68777950 TCTGAAAAGAAGGCCGGGTGCGG + Intronic
1069575069 10:69521217-69521239 AAGGCAGAGGAGGCCAGGTGTGG + Intergenic
1069827872 10:71265406-71265428 TAGACAGGGCAGGCCAGGTGGGG - Intronic
1070273342 10:74979866-74979888 TTTGAAGAGAAGGCCAGGCCCGG + Intronic
1070365274 10:75730635-75730657 TATGAAGAGCAACCCAGGCCAGG - Intronic
1070898027 10:80002203-80002225 TTTAAAAATCAGGCCAGGTGTGG + Intergenic
1071289107 10:84175794-84175816 TGTGCAAAGTAGGCCAGGTGTGG - Intronic
1071577367 10:86738674-86738696 AATAAAGGGAAGGCCAGGTGCGG - Intergenic
1072149340 10:92673111-92673133 TATGGACAGTAGGCCAGGCGCGG - Intergenic
1072250440 10:93578124-93578146 AAAGAAGAGCAGGCCAGGTGTGG + Intronic
1072499381 10:95997676-95997698 TTTAAGAAGCAGGCCAGGTGTGG - Intronic
1072545791 10:96436974-96436996 AATGTATAGCAGGCCAGGTGCGG - Intronic
1073037849 10:100576599-100576621 GATGAAGGGCAGGGCAGGGGAGG - Intergenic
1073042535 10:100617416-100617438 TTTGAAGAGGAGTCCAGGTGGGG - Intergenic
1073168299 10:101477938-101477960 TAGAAAAATCAGGCCAGGTGCGG - Intronic
1073356607 10:102859852-102859874 AAATAAGAGAAGGCCAGGTGCGG - Intronic
1073457044 10:103643819-103643841 TCTGCAGACCAGGCCAGGCGCGG + Intronic
1073858399 10:107705870-107705892 TATGAGATGCAGGCCTGGTGCGG - Intergenic
1074024136 10:109616103-109616125 TAAGAAGTGTGGGCCAGGTGTGG - Intergenic
1074325898 10:112450180-112450202 AATTATGATCAGGCCAGGTGCGG - Intronic
1074407231 10:113189978-113190000 TGGGAAGAGCATGCCAGGAGAGG - Intergenic
1074411067 10:113229106-113229128 AAGAAAGGGCAGGCCAGGTGCGG - Intergenic
1074488617 10:113915918-113915940 AAGGAATAACAGGCCAGGTGTGG - Exonic
1074814935 10:117136396-117136418 GGTGAAGAGCAGGCTAGGTAGGG + Intronic
1075045782 10:119145592-119145614 TAAGAAAATCAGGCCAGGCGCGG - Intronic
1075305017 10:121360080-121360102 TAGGAAGAACGGGCCAGGTGTGG + Intergenic
1075582135 10:123627770-123627792 CAAAAAAAGCAGGCCAGGTGTGG - Intergenic
1075809548 10:125214997-125215019 AAAGAAAATCAGGCCAGGTGTGG + Intergenic
1075984128 10:126768579-126768601 ATGGAAGACCAGGCCAGGTGTGG + Intergenic
1076115673 10:127896849-127896871 TATGAATTGCAAGCCAGTTGGGG - Intergenic
1076212269 10:128658238-128658260 TAAGAAGCACAGGCCAGGTCAGG + Intergenic
1076316279 10:129544244-129544266 TATGCTGTGCAGGCCAGGGGAGG + Intronic
1076977011 11:180917-180939 TATAGATAGCAGGCCAGGTGTGG + Intronic
1077253537 11:1571180-1571202 GATGCGGAGCAGACCAGGTGGGG - Intronic
1077651889 11:3980396-3980418 TATGAAGAGCATGTCTGGGGTGG - Intronic
1077804147 11:5572965-5572987 TAGAAAGTGCTGGCCAGGTGCGG + Intronic
1078219455 11:9339481-9339503 AATAAACAGCAGGCCAGGTGCGG + Intergenic
1080626832 11:34038124-34038146 TATGAAAAACTAGCCAGGTGTGG + Intergenic
1080894249 11:36435915-36435937 TATGATGAGCAAGACAGATGGGG + Intronic
1081466160 11:43319701-43319723 TATGTACAGCGGGCCAGATGAGG - Intronic
1081547994 11:44085446-44085468 AAAATAGAGCAGGCCAGGTGAGG - Intergenic
1081696635 11:45115637-45115659 AAGCTAGAGCAGGCCAGGTGTGG + Intronic
1082795047 11:57372679-57372701 TCTGAAGATCAGGCCTGGAGTGG + Intergenic
1083980321 11:66162410-66162432 TAAGAACATCAGGCCAGGCGCGG - Intronic
1084114700 11:67035288-67035310 GTTAAAAAGCAGGCCAGGTGTGG - Intronic
1084138270 11:67204089-67204111 AATGTAGGGGAGGCCAGGTGTGG - Intronic
1084164488 11:67368827-67368849 TATGAAGAGCAGGGCTAGTTTGG + Intronic
1084207128 11:67601794-67601816 TAGGAAATACAGGCCAGGTGCGG - Intergenic
1084481340 11:69422353-69422375 TAAGAAAGGCAGGCCAGGCGTGG - Intergenic
1085004953 11:73079007-73079029 CATTACCAGCAGGCCAGGTGCGG - Intronic
1085070081 11:73535849-73535871 TTTTAAGTGCAGGCCAGATGTGG - Intronic
1085234526 11:75003597-75003619 TATGAAAATCAGGCCAGGCTCGG + Intronic
1085498448 11:76994418-76994440 TATGAAAATTAGGCCAGGTGCGG - Intronic
1085592052 11:77772462-77772484 TATGAGAAACAGGCCAGGCGTGG - Intronic
1085658790 11:78342696-78342718 CAAGAAGTGCAGGCCAGGCGCGG - Intronic
1085668925 11:78443033-78443055 TAGGACAAGCTGGCCAGGTGCGG + Intronic
1086116311 11:83254709-83254731 TTTAAAGATGAGGCCAGGTGCGG - Intronic
1086399300 11:86447553-86447575 TAGAGAGACCAGGCCAGGTGTGG + Intronic
1086526871 11:87738156-87738178 AAATAAGAGCAGGCCAGGCGTGG + Intergenic
1086731813 11:90259379-90259401 AATGAGGAGTAGGCCAGGCGTGG - Intergenic
1087118766 11:94551116-94551138 AAAGAATAGAAGGCCAGGTGCGG + Intronic
1087274655 11:96149121-96149143 ATTGAAAAGTAGGCCAGGTGTGG + Intronic
1087296164 11:96376716-96376738 GAAGAAAAGCAGGCCAGGCGCGG - Intronic
1087752290 11:102020100-102020122 GAAGAAGAAGAGGCCAGGTGTGG + Intergenic
1087769273 11:102190338-102190360 TATTAACAGATGGCCAGGTGCGG + Intronic
1088024033 11:105156123-105156145 TATGCAGAGGAGGTTAGGTGTGG + Intergenic
1088767392 11:112996845-112996867 TATGATGAGCAGGCCAGAAAAGG - Intronic
1089657148 11:119957471-119957493 AATAAAGACCTGGCCAGGTGCGG + Intergenic
1089774103 11:120824289-120824311 TGTGATGAGCAGCCCAGGTGTGG + Intronic
1089885152 11:121813535-121813557 AATGAACTCCAGGCCAGGTGTGG - Intergenic
1090329321 11:125918169-125918191 AATTAAAAACAGGCCAGGTGCGG - Intronic
1090370001 11:126243611-126243633 TCTGCATATCAGGCCAGGTGCGG + Intronic
1090388035 11:126367855-126367877 TATGCATAGCAGGCCGGGTGTGG + Intronic
1090650887 11:128804851-128804873 TCTGAAGAGCAGGCAAGGTCTGG - Intronic
1090981924 11:131730422-131730444 TAGGAAGACAAGGCCAGGTTCGG + Intronic
1091610763 12:2006117-2006139 TTTTAAGAGTGGGCCAGGTGCGG + Intronic
1092346831 12:7722288-7722310 CATATAGATCAGGCCAGGTGAGG - Intergenic
1092369435 12:7904337-7904359 TGTTAATAGCAGGCCGGGTGCGG - Intergenic
1092542508 12:9429010-9429032 TAAGAAGGGTCGGCCAGGTGTGG - Intergenic
1092690114 12:11099434-11099456 AATGAAATCCAGGCCAGGTGTGG + Intronic
1092823144 12:12372499-12372521 AATGAAATCCAGGCCAGGTGTGG - Intronic
1093920638 12:24855916-24855938 TGGGATCAGCAGGCCAGGTGTGG - Intronic
1094213695 12:27919027-27919049 TAAAAATAGCCGGCCAGGTGCGG + Intergenic
1095919933 12:47518753-47518775 TAGGAAGACAAGTCCAGGTGAGG - Intergenic
1095966280 12:47869244-47869266 TAGGAAGAGAAGGCCGGGCGCGG + Intronic
1096061639 12:48705564-48705586 TAAGAAAATCAGGCCAGGTATGG - Intronic
1096172977 12:49488365-49488387 TATGAAATACAGGCCAGGTGCGG + Intronic
1096308700 12:50501709-50501731 AATGAAGGAGAGGCCAGGTGTGG + Intergenic
1096322027 12:50623094-50623116 TATATAAAACAGGCCAGGTGTGG + Intronic
1096343347 12:50822872-50822894 TATTAAAAACAGGCCAGGCGAGG - Intergenic
1096412936 12:51390487-51390509 GATGAAAACCAGGTCAGGTGAGG - Intronic
1096517172 12:52163362-52163384 AATGAAGAGTAGGCCGGGCGCGG + Intergenic
1096615570 12:52831382-52831404 TGAGGAGAGCAGGCCAGGCGGGG - Intronic
1096641548 12:52998597-52998619 TCTGGTTAGCAGGCCAGGTGCGG - Intergenic
1096768135 12:53911165-53911187 AATAATGAGCAGGCCAGGTGCGG - Intergenic
1097028053 12:56072854-56072876 AAAAAAGAGAAGGCCAGGTGCGG - Intergenic
1097216128 12:57414538-57414560 AATGAGAAGCAGGCCGGGTGCGG + Intronic
1097602786 12:61715278-61715300 AATGAAGCACTGGCCAGGTGTGG + Intronic
1097863148 12:64537936-64537958 GACGAAGAGGAGGCCATGTGAGG - Intergenic
1098097490 12:66974212-66974234 AGTAAAGACCAGGCCAGGTGCGG - Intergenic
1098468630 12:70819028-70819050 AATAAAGAGAAGGTCAGGTGTGG + Intronic
1098717209 12:73845570-73845592 TATGAACCATAGGCCAGGTGCGG + Intergenic
1098852198 12:75610159-75610181 TATGATGCATAGGCCAGGTGCGG - Intergenic
1099294452 12:80812839-80812861 AATGAAGGGCAGGCTGGGTGTGG - Intronic
1099384892 12:82002437-82002459 TATCAACATCAGGCCAGGTGCGG + Intergenic
1099855756 12:88163905-88163927 CATCAAAATCAGGCCAGGTGTGG + Intronic
1100108917 12:91213131-91213153 TATGAAGTCCAGGCCGGGTGTGG - Intergenic
1100189134 12:92172088-92172110 TATGATAATCTGGCCAGGTGGGG - Intergenic
1100277233 12:93082272-93082294 TATGGAAAGCAGGCCGGGCGCGG + Intergenic
1100355155 12:93821825-93821847 TGTAGACAGCAGGCCAGGTGTGG + Intronic
1101333468 12:103776263-103776285 TGAAAAAAGCAGGCCAGGTGCGG + Exonic
1101359896 12:104016344-104016366 GATGATGTGCAGGCCGGGTGTGG + Intronic
1101950570 12:109171638-109171660 TGTAAAGAGAAGGCCAGGCGTGG - Intronic
1102310230 12:111838990-111839012 TATCAAGAATTGGCCAGGTGTGG + Intergenic
1102393993 12:112572927-112572949 TATAAAGGGGAGGCCAGGGGTGG - Intronic
1102516752 12:113454111-113454133 AATGAAGAAAAGGCCAGGCGTGG - Intergenic
1102964578 12:117115916-117115938 AAGGAAGCACAGGCCAGGTGTGG - Intergenic
1103019474 12:117522395-117522417 AATGGAGAGAAGGCCAGGGGTGG + Intronic
1103498999 12:121386043-121386065 TATTAAAAGTAGGCCAGGTGCGG - Intronic
1103620503 12:122184382-122184404 TCTAGAGAGTAGGCCAGGTGCGG - Intronic
1103788758 12:123454150-123454172 AATAAATATCAGGCCAGGTGCGG - Intergenic
1103836575 12:123825830-123825852 TTAGAAAAACAGGCCAGGTGTGG + Intronic
1103927559 12:124432365-124432387 TCTGCAGAGGAGGCCAGGTCTGG - Intronic
1104061605 12:125273294-125273316 TAAGAAAAACAGGCCGGGTGTGG + Intronic
1104119201 12:125782715-125782737 TGTCAACAGCAGGCCAGGCGCGG - Intergenic
1104201237 12:126591421-126591443 TATGTAAAGAAGGCCAGGGGAGG - Intergenic
1104236752 12:126945939-126945961 TATGAATAACAGGCTATGTGGGG + Intergenic
1104353606 12:128066279-128066301 TCAGAAAAGAAGGCCAGGTGAGG + Intergenic
1104426312 12:128681268-128681290 AATGAAAAACAGGCCGGGTGCGG - Intronic
1105220181 13:18318571-18318593 TAAGAAGTACTGGCCAGGTGTGG + Intergenic
1105366890 13:19773526-19773548 TATAAAAAACAGGCCGGGTGCGG - Intronic
1105414163 13:20194120-20194142 TGTGCAGAGCAGGCTGGGTGGGG + Intergenic
1105707664 13:22978290-22978312 TATAAAACGCCGGCCAGGTGAGG - Intergenic
1105985592 13:25563117-25563139 TTTCAAGAGGAGGCCAGGTGCGG + Intronic
1105989480 13:25603800-25603822 TAGGAGGAGCAGGTAAGGTGGGG + Intronic
1106009469 13:25805216-25805238 TTTAATGAGGAGGCCAGGTGTGG + Intronic
1106038909 13:26070915-26070937 AATGATGAGTAGGCCGGGTGTGG - Intergenic
1106145196 13:27043992-27044014 AATGAAAACCAGGCCAGGCGTGG - Intergenic
1106433373 13:29703425-29703447 TGGGAAGAGCATTCCAGGTGAGG - Intergenic
1106808047 13:33331654-33331676 AATGAAGAACAGACCAGGTGTGG - Intronic
1107279450 13:38716796-38716818 AAGAAAGAGCAGGCCAGGCGCGG - Intronic
1107585367 13:41841494-41841516 TATAAACAGTAGGCCGGGTGCGG + Intronic
1107616491 13:42173259-42173281 TATGAAATAAAGGCCAGGTGTGG - Intronic
1107907057 13:45071037-45071059 TAGCAAGAGCAGGCAAGGTGTGG + Intergenic
1108311696 13:49198639-49198661 TATTAGAAGTAGGCCAGGTGTGG + Intronic
1108347665 13:49562334-49562356 CATGAAGATCAGGCCAGGCATGG + Intronic
1108502789 13:51083819-51083841 AATGAGGACCAGGCCAGGTGAGG + Intergenic
1108609298 13:52068676-52068698 TATGAAGGGTTGGCCAGGCGTGG + Intronic
1108616596 13:52139606-52139628 AACAAAAAGCAGGCCAGGTGTGG + Intronic
1108755366 13:53495048-53495070 TAGGCATTGCAGGCCAGGTGTGG + Intergenic
1108912394 13:55571993-55572015 TATAAAGAGCAGGCCAGCTAAGG + Intergenic
1108921597 13:55681394-55681416 AATGTAGAGAAGGCCAGGTGTGG - Intergenic
1109713953 13:66196048-66196070 TATGAACATCAGGCCAGGTGTGG - Intergenic
1109758824 13:66799107-66799129 AAAGAGTAGCAGGCCAGGTGTGG - Intronic
1110105761 13:71674198-71674220 TATTATGAGAAGTCCAGGTGGGG - Intronic
1111874689 13:93878666-93878688 TCTGAAGGGTAGGCCAGGAGCGG - Intronic
1111982367 13:95030309-95030331 TATGAAATCCTGGCCAGGTGTGG - Intronic
1112029197 13:95441529-95441551 TATTCATGGCAGGCCAGGTGTGG - Intronic
1112315086 13:98353666-98353688 TACAAAAAGCAGGCCGGGTGTGG - Intronic
1112338853 13:98536652-98536674 AATGGAGAGAAGGGCAGGTGTGG - Intronic
1113535130 13:111060224-111060246 TAGCAAGAACAGGCCAGGTGTGG + Intergenic
1113986283 13:114318612-114318634 TCTGATGATCAGGCCGGGTGTGG - Intronic
1113993421 14:16047090-16047112 TATCAAGAGAAGGCCAGGCAAGG - Intergenic
1114258547 14:21022007-21022029 TGTGAGGAACAGGACAGGTGCGG - Intronic
1114416591 14:22548948-22548970 TAAGAAAAGCAGGCCGGGTGTGG - Intergenic
1114509298 14:23243784-23243806 TATAAATAACAGGCCAGCTGAGG + Intronic
1114781713 14:25545572-25545594 GATGAAGAGATGGCCAGGTACGG - Intergenic
1115203979 14:30881666-30881688 TATTAATTGCTGGCCAGGTGCGG + Intronic
1115305799 14:31932303-31932325 AATGAAAGGCAGGCCAAGTGAGG - Intergenic
1115534411 14:34358929-34358951 TATGAAGAAAAGGCCAGGTGCGG - Intronic
1115559541 14:34570709-34570731 AAAAAAGAGAAGGCCAGGTGCGG - Intronic
1115863420 14:37714885-37714907 TATTGAGGGCTGGCCAGGTGTGG + Intronic
1116064333 14:39963476-39963498 AATAATGAGCAGGCCAGATGTGG + Intergenic
1116947192 14:50846864-50846886 TAAAAAGGGTAGGCCAGGTGCGG + Intergenic
1117017861 14:51536705-51536727 TATGGACAAGAGGCCAGGTGCGG - Intronic
1117129254 14:52668253-52668275 TATAAACAGCAGGCCAGGCATGG + Intronic
1117289895 14:54322146-54322168 TAAGAAGTTAAGGCCAGGTGTGG - Intergenic
1117783385 14:59257823-59257845 TGTGAAGACCAGGGCAGGTGGGG - Intronic
1117820236 14:59641255-59641277 AAAGAAGAACAGGCCAGGTATGG - Intronic
1118026684 14:61775542-61775564 TATAGAGGGTAGGCCAGGTGTGG - Intronic
1118170351 14:63382689-63382711 TTAGAAGGGCAGGCCAGGTGTGG - Intronic
1118250172 14:64152022-64152044 TATAAAGAGTAGACCAGGTCAGG + Intronic
1118358228 14:65033565-65033587 TAAAAAAAGCAGGCCAGGTGCGG + Intronic
1118384817 14:65247066-65247088 AAAGAAAAACAGGCCAGGTGTGG + Intergenic
1118542105 14:66839986-66840008 TATTGAAAGCAGGCCAGTTGTGG + Intronic
1118586132 14:67355100-67355122 TAAAAAATGCAGGCCAGGTGCGG - Intronic
1118776765 14:68978535-68978557 TATGGAGAGGTGGCCAGGGGCGG + Intronic
1119036462 14:71233786-71233808 TATGAATAACAGGCCGGGTGTGG + Intergenic
1119038685 14:71252909-71252931 AAAGAAGAACAGGCTAGGTGTGG + Intergenic
1119227881 14:72958011-72958033 TGAAAAGATCAGGCCAGGTGTGG + Intronic
1119339699 14:73866425-73866447 AAAGAAAAACAGGCCAGGTGGGG - Intronic
1119355807 14:74005515-74005537 AATGAACAACTGGCCAGGTGCGG + Intronic
1120197129 14:81496447-81496469 AATAAAGAGCTGGCTAGGTGTGG + Intronic
1120315755 14:82890575-82890597 TATATAGAGGAGGCCAGGCGTGG - Intergenic
1121059442 14:90891900-90891922 AATGAAGACAAGGCCAGCTGTGG - Intronic
1121450250 14:94002442-94002464 GATACAGAACAGGCCAGGTGTGG - Intergenic
1122064560 14:99163202-99163224 AATTAAGACCAGGCCAGGCGTGG - Intergenic
1122118810 14:99540987-99541009 TGTGAAAACCAGGCCAGGAGGGG - Intronic
1122336468 14:100991323-100991345 TATGAATAACTGGCCAGATGTGG - Intergenic
1122663414 14:103312538-103312560 CATGAATATGAGGCCAGGTGTGG + Intergenic
1122749518 14:103922215-103922237 TATGCAGAGCAGGCCGGGCGCGG - Intronic
1122763370 14:104046934-104046956 GAAAAAGAGCAGGCCAGGTGCGG - Intronic
1122832194 14:104403909-104403931 CAGGAAGGGCAGGACAGGTGGGG + Intergenic
1123015561 14:105372615-105372637 AATGAAAAGATGGCCAGGTGCGG + Intronic
1123114191 14:105886533-105886555 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1123114210 14:105886597-105886619 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1123114234 14:105886677-105886699 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1123114254 14:105886742-105886764 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1123116408 14:105896141-105896163 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1123118413 14:105905198-105905220 GGTGAAGTCCAGGCCAGGTGAGG + Intergenic
1123120643 14:105914842-105914864 GGTGAAGCCCAGGCCAGGTGAGG + Intergenic
1123167899 14:106344056-106344078 AATGCACAGGAGGCCAGGTGGGG - Intergenic
1124832970 15:33167179-33167201 TGTCATGGGCAGGCCAGGTGGGG + Intronic
1124842006 15:33250919-33250941 AATCAGGATCAGGCCAGGTGTGG - Intergenic
1124911414 15:33924610-33924632 AATGATGTGCTGGCCAGGTGTGG - Intronic
1125703080 15:41705946-41705968 TATGTAATACAGGCCAGGTGCGG + Intronic
1125823862 15:42658820-42658842 AAAGAAAAGCAGGCCAGGTGTGG + Intronic
1125961541 15:43833923-43833945 TATAAATGGCAGGCCGGGTGTGG - Intronic
1126116010 15:45208216-45208238 AAGAAAGAGCAGGCCAGGTGAGG - Intergenic
1126439865 15:48675812-48675834 TATGAAGAGAAGGCTCAGTGGGG - Intergenic
1126463567 15:48939329-48939351 TATGAAGGGCAGGCAATGAGAGG + Intronic
1126583090 15:50258868-50258890 AAGGAAGGGCAGGCCGGGTGCGG + Intronic
1126615705 15:50577257-50577279 TAGAAAAATCAGGCCAGGTGCGG + Intronic
1126647563 15:50890234-50890256 AAAGAAGAGCAGTCCAGGCGCGG + Intergenic
1126813918 15:52436218-52436240 TATGATGGCCAGGCCAGGTGTGG - Intronic
1126874399 15:53024520-53024542 TATGAAGAGCAGGCAAGAGTAGG + Intergenic
1127630844 15:60826321-60826343 TATGCTGACCAGGTCAGGTGTGG - Intronic
1127784270 15:62342305-62342327 TAAGAAAAGCAGGCCGGGCGCGG + Intergenic
1128011534 15:64301595-64301617 AGTGAAAAGAAGGCCAGGTGTGG + Intronic
1128030689 15:64477428-64477450 TAAGTAAAGCAGGCCAGGCGTGG - Intronic
1128038678 15:64550401-64550423 TATGATTTGCAGGCCAGGTATGG + Intronic
1128146565 15:65335237-65335259 GAGGAGGAGGAGGCCAGGTGGGG + Intronic
1128277492 15:66365833-66365855 TATGCAGAGCAGGCTGGGCGCGG - Intronic
1128492832 15:68167109-68167131 AATGAACTGCTGGCCAGGTGTGG - Intronic
1129052387 15:72793295-72793317 TAGGAAGGGTAGGCCTGGTGCGG - Intergenic
1129218814 15:74118945-74118967 TAATAAAAGCAGGCCAGGTGCGG - Intronic
1129560522 15:76561851-76561873 TATGAGGCAGAGGCCAGGTGCGG + Intronic
1129762586 15:78139142-78139164 TATGAGGATCTGGCCAGTTGCGG - Intronic
1130316213 15:82799359-82799381 TATAAAGAGCAGCCAAGGGGAGG - Intronic
1130318230 15:82815058-82815080 TATGAAAAACAGGCCGGGTGCGG - Intronic
1130341647 15:83004036-83004058 TAAGAAGTCCAGGCCGGGTGTGG - Intronic
1130359812 15:83172545-83172567 TAAGAAAATCAGCCCAGGTGTGG + Intronic
1130834588 15:87637009-87637031 GATACAGAGCAGGCCAAGTGTGG + Intergenic
1130967671 15:88709298-88709320 CATGAAGAGCAAGCAAAGTGGGG - Intergenic
1131119933 15:89815643-89815665 TGAGAGGCGCAGGCCAGGTGTGG - Intergenic
1131157296 15:90082941-90082963 TATAAAGTCCTGGCCAGGTGTGG - Intergenic
1131238849 15:90720872-90720894 TGAAAAAAGCAGGCCAGGTGCGG - Intronic
1131651513 15:94404587-94404609 GATGAAACGGAGGCCAGGTGCGG - Intronic
1131810444 15:96167955-96167977 AATTTAGAGGAGGCCAGGTGTGG + Intergenic
1132001145 15:98181314-98181336 TGTTAAGAGTGGGCCAGGTGTGG + Intergenic
1132015234 15:98309464-98309486 AAAGAAGAGGAGGCCGGGTGAGG - Intergenic
1132415534 15:101616094-101616116 GAGGAAGAGCAGCCCACGTGCGG + Intergenic
1132487094 16:199479-199501 GATCAAGACCAGGCCAGGCGCGG + Intronic
1132898798 16:2242281-2242303 TATGGACAGTGGGCCAGGTGCGG - Intronic
1133210962 16:4263316-4263338 TCTGACTAGCAGGCCCGGTGGGG + Intronic
1134244247 16:12528113-12528135 AATAAATAACAGGCCAGGTGCGG - Intronic
1134249842 16:12566523-12566545 TCTGAAGAGCATGACAGGAGGGG + Intronic
1134464660 16:14464463-14464485 AATGAAGGTGAGGCCAGGTGTGG + Intronic
1134542531 16:15079098-15079120 TATGAAGAGGAGGCCGGGCGTGG - Intronic
1134682974 16:16139319-16139341 AATCAGAAGCAGGCCAGGTGCGG + Intronic
1134683868 16:16145409-16145431 TATGAAGAGGAGGCAGAGTGAGG + Intergenic
1135025322 16:18995108-18995130 TAATAAGAGCTGGGCAGGTGGGG + Intronic
1135032285 16:19047987-19048009 CATCAAGAGTAGGCCGGGTGCGG - Intronic
1135110010 16:19683211-19683233 TAAGAAGGGAAGGCCAGGTGTGG - Intronic
1135112322 16:19699805-19699827 AAAGCAGAGCTGGCCAGGTGTGG + Intronic
1135278870 16:21136842-21136864 GAGGAATAACAGGCCAGGTGTGG + Intronic
1135360108 16:21805176-21805198 TATGAAGAGGAGGCTGGGTGTGG - Intergenic
1135677458 16:24429106-24429128 ATTGATGAGCAGGTCAGGTGTGG + Intergenic
1135894118 16:26383050-26383072 TATGAACAGGAGGCCAGAAGTGG - Intergenic
1136243322 16:28958157-28958179 TAAGAAGATGTGGCCAGGTGCGG + Intronic
1136262698 16:29091764-29091786 TATGAAGAGGAGGCCGGGTGTGG + Intergenic
1136407793 16:30058770-30058792 GAAGCAGAGCAGGCCAGGCGTGG - Intronic
1136926297 16:34377766-34377788 CAAGCAGATCAGGCCAGGTGTGG - Intergenic
1136978277 16:35034041-35034063 CAAGCAGATCAGGCCAGGTGTGG + Intergenic
1137260529 16:46824952-46824974 TATGAGTATCAGGCCGGGTGTGG - Intronic
1138079846 16:54080094-54080116 TAAGAAGAGTAGGCCAGGCATGG + Intronic
1138375728 16:56562859-56562881 TATCAAAACCAGGCCAGATGTGG - Intergenic
1138568823 16:57854335-57854357 TATAAAGATGGGGCCAGGTGCGG + Intronic
1138575905 16:57907206-57907228 TAAGCAGAGCAGGGCAGGGGTGG - Intronic
1139235769 16:65337329-65337351 AAAGAAATGCAGGCCAGGTGTGG + Intergenic
1139740279 16:69029815-69029837 TAAGAAGAACAGGCCGGGTGTGG + Intronic
1139777117 16:69323443-69323465 TATAAAATGCAGGCTAGGTGTGG - Intronic
1139988953 16:70923510-70923532 AAATAAGAACAGGCCAGGTGTGG + Intronic
1140113151 16:72020640-72020662 ACTGAAAAACAGGCCAGGTGCGG - Intronic
1140210425 16:72965167-72965189 AAAGAAAAACAGGCCAGGTGCGG - Intronic
1140225814 16:73075918-73075940 GATGAAAAGCTGGCCGGGTGCGG - Intergenic
1140256701 16:73343432-73343454 CATGAAGAGGAGGCCACATGCGG + Intergenic
1140391220 16:74588707-74588729 TGTTAAGAACAGGCCAAGTGTGG - Intronic
1140754281 16:78053577-78053599 AATAGAAAGCAGGCCAGGTGTGG - Intronic
1140768098 16:78178573-78178595 AATAGATAGCAGGCCAGGTGCGG + Intronic
1140958938 16:79894203-79894225 TGTGAAGTGGTGGCCAGGTGTGG - Intergenic
1141091008 16:81130350-81130372 TAAGAAAACCAGGCCAAGTGTGG - Intergenic
1141690534 16:85593979-85594001 AAAGAAGCGCAGGCCAGGCGCGG - Intergenic
1141824626 16:86470465-86470487 TATGAAGATCAGGCCAGGCGTGG + Intergenic
1142039502 16:87883618-87883640 TACGAAAAGTAGGCCGGGTGCGG - Exonic
1142075041 16:88113066-88113088 TCTGCACAGCAGGCCAGGCGCGG - Intronic
1142168739 16:88608651-88608673 TAGGAAGTGAGGGCCAGGTGTGG - Intronic
1142443245 16:90115753-90115775 TATAGATAGCAGGCCAGGTGTGG - Intergenic
1142464149 17:119091-119113 TATAGATAGCAGGCCAGGTGTGG + Intergenic
1142654553 17:1382732-1382754 AATGAAAAACAGGCCAGGTGCGG + Intronic
1142748582 17:1973746-1973768 TAAAAAGAGCTGGCCGGGTGTGG + Intronic
1142873025 17:2833425-2833447 TACCAAGAACAGGCCAGGCGCGG - Intronic
1142913484 17:3114519-3114541 GATGATGGGAAGGCCAGGTGCGG - Intergenic
1142973976 17:3632243-3632265 TATGACCTGCAGGCCAGGCGCGG - Intronic
1142990671 17:3728661-3728683 CAAAAAGAGAAGGCCAGGTGCGG - Intronic
1143069569 17:4279617-4279639 TAAGAACCTCAGGCCAGGTGCGG + Intronic
1143935056 17:10475296-10475318 AATGAAGAGCATTCCAGGTAGGG + Intergenic
1144090147 17:11849124-11849146 TACAAAGAGGTGGCCAGGTGCGG - Intronic
1144253346 17:13441210-13441232 AATGATGATCTGGCCAGGTGCGG + Intergenic
1144771991 17:17764878-17764900 AAAGAAGAGGAGGCCAGGCGCGG - Intronic
1144932378 17:18870241-18870263 AATTAAGTGCAGGCCGGGTGCGG + Intronic
1145718589 17:27047130-27047152 TTTAAAGAGCTGGCCAGGTGCGG + Intergenic
1145867879 17:28252384-28252406 TAGAAAGTGCAGGCCAGGTGTGG - Intergenic
1146069723 17:29668956-29668978 TGAGTAGAGCAGGCCGGGTGTGG + Intronic
1146186183 17:30725839-30725861 TAATAATAGCAGGCCAGGTGTGG + Intergenic
1146204635 17:30891995-30892017 TATTAATTTCAGGCCAGGTGAGG - Intronic
1146230332 17:31102450-31102472 AAGGGAGAGTAGGCCAGGTGCGG + Intronic
1146258511 17:31405642-31405664 AATAAAGAGCAGGCTGGGTGCGG - Intronic
1146367449 17:32240001-32240023 AATCAAGTGCAGGCCAGGCGCGG + Intronic
1146384684 17:32359399-32359421 TATAAAAACTAGGCCAGGTGTGG - Intronic
1146795534 17:35777756-35777778 TATGCACGGTAGGCCAGGTGCGG + Intronic
1146857932 17:36270594-36270616 TTGGAAGATCAGGCCAGGTGCGG + Intronic
1147076726 17:37995130-37995152 TTGGAAGATCAGGCCAGGTGCGG + Intronic
1147077077 17:37997929-37997951 TTGGAAGATCAGGCCAGGTGCGG - Intronic
1147088252 17:38074676-38074698 TTGGAAGATCAGGCCAGGTGCGG + Intergenic
1147108958 17:38245841-38245863 TTGGAAGATCAGGCCAGGTGCGG - Intergenic
1147379199 17:40043224-40043246 TATTAACAACAGGCCGGGTGTGG - Intronic
1147589495 17:41672706-41672728 TTTAAAGAGCTGGCCAGGTGAGG - Intergenic
1147918642 17:43902993-43903015 AATTAAGAACAGGCCAGGTGTGG + Intronic
1147924238 17:43936847-43936869 TAGAAAGTGCAGGCCAGGTGTGG + Intergenic
1148007659 17:44447124-44447146 CATGAAATGGAGGCCAGGTGCGG - Intronic
1148056561 17:44800983-44801005 TTTTAAGAGCAGGCCAGGCGCGG + Exonic
1148140284 17:45323277-45323299 AATGCAGAGCAGAGCAGGTGAGG + Intergenic
1148256186 17:46134547-46134569 AAAGACGAGGAGGCCAGGTGTGG + Intronic
1148420494 17:47542254-47542276 TTGGAAGATCAGGCCAGGTGCGG + Intronic
1148429291 17:47628838-47628860 AATTAAGAGAAGGCCAGGTTTGG - Intergenic
1148452949 17:47792032-47792054 AAGGAAAAGGAGGCCAGGTGCGG - Intergenic
1148702532 17:49598063-49598085 TCTGAAGAACAGGCCAGCAGAGG + Intergenic
1148801070 17:50226252-50226274 TAACAAGAGTTGGCCAGGTGTGG + Intergenic
1149425234 17:56548462-56548484 GATGAAGTTGAGGCCAGGTGTGG + Intergenic
1149474101 17:56944725-56944747 AATAAACAGAAGGCCAGGTGCGG + Intronic
1149800031 17:59558614-59558636 TATTAAAATAAGGCCAGGTGTGG + Intergenic
1149942084 17:60881262-60881284 TGAAAAGACCAGGCCAGGTGCGG - Intronic
1150541300 17:66102931-66102953 TATGAAAAACTAGCCAGGTGTGG + Intronic
1150561696 17:66300923-66300945 AATGAAGAGCAGGGCATGTTGGG - Intergenic
1150938459 17:69662922-69662944 AGTGAAGAACAGGCCAGGCGTGG - Intergenic
1150956450 17:69865640-69865662 TGTTTAGAGCTGGCCAGGTGTGG - Intergenic
1151035366 17:70792622-70792644 GACCCAGAGCAGGCCAGGTGCGG - Intergenic
1151173931 17:72271366-72271388 TATGAAAAATAGGCCAGGCGTGG + Intergenic
1151392389 17:73796271-73796293 TATAAAGAACAGGCCAGGCATGG + Intergenic
1151459740 17:74247492-74247514 TGTGAAGAGCAGGCCTGGCCTGG + Intronic
1152014773 17:77743351-77743373 ACTTGAGAGCAGGCCAGGTGTGG + Intergenic
1152129835 17:78469457-78469479 TAAGAAACACAGGCCAGGTGCGG + Intronic
1152845852 17:82599394-82599416 CATGAACAAGAGGCCAGGTGCGG - Intronic
1152914707 17:83027821-83027843 TAAGATAAACAGGCCAGGTGTGG + Intronic
1153016000 18:583155-583177 TGGGAAGAACTGGCCAGGTGTGG + Intergenic
1153102236 18:1486793-1486815 TAGGAAGAGCAGCTCAGGTGTGG + Intergenic
1153126887 18:1803856-1803878 TATAAACTGCAGGCCAGGTGTGG - Intergenic
1153153031 18:2116231-2116253 TGTGAAGCACAGGCCAGGTGCGG + Intergenic
1153473270 18:5469524-5469546 TGTCAAGGGCAAGCCAGGTGTGG - Intronic
1153639728 18:7146497-7146519 TATCTAGAAGAGGCCAGGTGCGG + Intergenic
1153721402 18:7907055-7907077 GATGAAGAGCAGGCCATTTCTGG - Intronic
1154130827 18:11735594-11735616 TATAAAAAGTTGGCCAGGTGTGG + Intronic
1154470566 18:14696260-14696282 AGTAAAGAGCTGGCCAGGTGCGG - Intergenic
1154935425 18:21051155-21051177 AAGAAAGAACAGGCCAGGTGTGG + Intronic
1154970813 18:21407162-21407184 TGTTAAGAGAAGGCCAGGTGCGG - Intronic
1155002326 18:21699202-21699224 TGTGTAAAGTAGGCCAGGTGTGG - Intronic
1156084256 18:33379997-33380019 TATAAAGAGAAGGCCAGCTTAGG + Intronic
1156128226 18:33934686-33934708 TATGAAGAGTAAGAGAGGTGAGG - Intronic
1156537844 18:37880907-37880929 TAGGAGGAGCAGGCCGGGTGCGG - Intergenic
1156606014 18:38668363-38668385 GATGCAAAGCAGGCCGGGTGCGG + Intergenic
1156937585 18:42729400-42729422 TGGGAAAATCAGGCCAGGTGTGG - Intergenic
1156937971 18:42733839-42733861 TATAATGATCTGGCCAGGTGTGG - Intergenic
1156975984 18:43221932-43221954 AATAAAGAAAAGGCCAGGTGCGG - Intergenic
1157542662 18:48522905-48522927 TAGGTACCGCAGGCCAGGTGGGG + Intergenic
1157868335 18:51205931-51205953 TATGGAAAAAAGGCCAGGTGCGG + Intronic
1158208576 18:55021712-55021734 GAGGTAGAGCCGGCCAGGTGCGG + Intergenic
1158516424 18:58134289-58134311 TAAGAATATTAGGCCAGGTGCGG - Intronic
1158616795 18:58995346-58995368 TATTAAAAGAAGGCCAAGTGTGG - Intergenic
1158790710 18:60777376-60777398 TATAAAAAACTGGCCAGGTGTGG + Intergenic
1159617043 18:70592783-70592805 TATGAAGAAAAAGCCAGGTAAGG - Intergenic
1159908932 18:74125242-74125264 AATGCAGAGCAGGCAAGCTGCGG + Intronic
1160122856 18:76146138-76146160 TGTTAAAAGCAGGACAGGTGTGG + Intergenic
1160951901 19:1671865-1671887 GAAGAAGAGCAGGCCGGGTACGG - Intergenic
1160967077 19:1751412-1751434 CAAGAAGCGCAGACCAGGTGGGG - Intergenic
1161379344 19:3956455-3956477 TACACATAGCAGGCCAGGTGCGG + Intergenic
1161433802 19:4249995-4250017 TAGAAGGAGAAGGCCAGGTGCGG - Intronic
1161440089 19:4286180-4286202 AAGAAAGAGCGGGCCAGGTGCGG - Intronic
1161986269 19:7656363-7656385 AATGAAGAGCAGTCCAGGCGTGG + Intergenic
1162113968 19:8417151-8417173 TGTAAAGACCAGGCCAGGGGTGG + Intronic
1162177630 19:8843036-8843058 TCTGAAGAGCAGGCAAGGTGGGG - Exonic
1162187470 19:8917088-8917110 CATGAAGTCCTGGCCAGGTGTGG + Intronic
1162338640 19:10077906-10077928 TAATAAGGACAGGCCAGGTGTGG - Intergenic
1162430756 19:10626710-10626732 AATTAAGTCCAGGCCAGGTGTGG - Intronic
1162598261 19:11646163-11646185 AATGTAGAACAGGCCAGGTGCGG - Intergenic
1162618087 19:11817917-11817939 TATAATTATCAGGCCAGGTGTGG + Intronic
1162690344 19:12424830-12424852 AAAGAAAAACAGGCCAGGTGCGG + Intronic
1162759391 19:12879811-12879833 TACAAAAAGTAGGCCAGGTGTGG + Intronic
1162972649 19:14190213-14190235 TAATAATAGCAGGCCAGGTGTGG - Intronic
1163084598 19:14970359-14970381 TAAGAAAATCAGGCCAGGTGAGG - Intronic
1163212460 19:15851284-15851306 TCTGATTGGCAGGCCAGGTGCGG - Intergenic
1163231199 19:16003311-16003333 TCTGAAGAGCCAGCCAGGAGTGG - Intergenic
1163264920 19:16214640-16214662 TATGAAAAGAAGGCCGGGTGTGG - Intronic
1163309700 19:16506263-16506285 TATGAAGACATGGCCAGGCGCGG - Intronic
1163355375 19:16807201-16807223 TATGAACACCAGGCCGGGTGTGG + Intronic
1163422533 19:17222184-17222206 AATGAGGAATAGGCCAGGTGCGG + Intergenic
1163492828 19:17626901-17626923 AATGGAGAACAGGCCAGATGCGG + Intronic
1163549511 19:17957824-17957846 TGTGGAGAGCAGGGCAGGAGTGG + Intronic
1163604794 19:18268086-18268108 TTTGAAAAGCAGGCCGGGCGCGG - Intronic
1163624182 19:18379186-18379208 TATAAAGATTAGGCCAGGTGTGG + Intronic
1163709196 19:18835628-18835650 AATGAAATGCTGGCCAGGTGCGG - Intronic
1163763509 19:19149787-19149809 GAAAATGAGCAGGCCAGGTGCGG + Intronic
1163855112 19:19695505-19695527 AAAGAATAGCCGGCCAGGTGCGG - Intergenic
1164744383 19:30600382-30600404 AATAAACAGCCGGCCAGGTGCGG - Intronic
1164968492 19:32509342-32509364 TATGAACAACAGGCCGGGTGCGG - Intergenic
1165191598 19:34068267-34068289 TACGTATACCAGGCCAGGTGAGG + Intergenic
1165212206 19:34244896-34244918 AATAAAGAGGAGGCCAGGCGCGG + Intergenic
1165360526 19:35333838-35333860 TCAGAAGATCAGGCCGGGTGCGG - Intronic
1165525577 19:36351891-36351913 TATTAAGATCCGGCCGGGTGTGG + Intronic
1165548786 19:36565410-36565432 AATGAAGAACAGGCCGGGCGCGG + Intronic
1165644404 19:37422038-37422060 TTTAAAGTGCTGGCCAGGTGTGG - Intronic
1166037012 19:40175900-40175922 AATAAAAAGCAGGCCGGGTGCGG - Intergenic
1166194481 19:41196904-41196926 TTTACAGAACAGGCCAGGTGCGG + Intronic
1166252016 19:41577826-41577848 TATGAGGAGGAGGCCAAGGGGGG - Intronic
1166411228 19:42556518-42556540 AAAGAAGAAAAGGCCAGGTGCGG - Intronic
1166924135 19:46254355-46254377 AATAAAGAACAGGCCAGGCGCGG + Intergenic
1167303603 19:48694544-48694566 TATGCAAAACAGGCCAGGTGTGG - Intergenic
1167378256 19:49123730-49123752 TAAGAACATGAGGCCAGGTGCGG - Intronic
1167572088 19:50295023-50295045 TTTTAAAAACAGGCCAGGTGTGG + Intronic
1167832036 19:52031705-52031727 TAGCAAGAGGAGGCCAGGCGTGG + Exonic
1167876512 19:52418271-52418293 TATGCTGAGCTGGCCAGGTGTGG - Exonic
1167897988 19:52597549-52597571 TAAGAAGATTGGGCCAGGTGGGG + Intronic
1167943672 19:52968791-52968813 TAAGAGGATTAGGCCAGGTGCGG - Intergenic
1168399776 19:56078833-56078855 TATATATATCAGGCCAGGTGCGG + Intergenic
1168427164 19:56247978-56248000 TTGAAAGAACAGGCCAGGTGCGG - Intronic
1168550201 19:57286669-57286691 TAAGAAGTCCAGGCCAGGAGTGG + Intronic
1168587097 19:57602497-57602519 TATTAATAGCAGGCCAGGAAGGG + Intronic
1168630965 19:57955842-57955864 TATGCAGTTCAGGCCAGGAGTGG + Intergenic
1168660696 19:58163628-58163650 CATGGAAATCAGGCCAGGTGTGG - Intergenic
925236852 2:2286270-2286292 AATGAAGAACAGGCCGGGTGTGG - Intronic
925315867 2:2922598-2922620 AATGAAGATGAGGCCGGGTGCGG + Intergenic
925439232 2:3869460-3869482 TAGCAAGACTAGGCCAGGTGTGG + Intergenic
925591857 2:5517686-5517708 AATGAACATAAGGCCAGGTGTGG - Intergenic
926041019 2:9673267-9673289 TTTGAAGAGCAGACCAGGTGTGG + Intergenic
926172842 2:10564029-10564051 AAGAAAAAGCAGGCCAGGTGCGG + Intergenic
926209259 2:10857088-10857110 TGTAAAGAATAGGCCAGGTGTGG + Intergenic
927167315 2:20336910-20336932 TAGGAATACTAGGCCAGGTGTGG - Intronic
927367820 2:22319295-22319317 TAGGAAAAGGAGGCCAGGCGCGG + Intergenic
927579012 2:24224918-24224940 ATTTAAGAGCAGGCCAGGCGTGG - Intronic
927604089 2:24470706-24470728 AAAGAAGAAGAGGCCAGGTGTGG + Intergenic
927721169 2:25383507-25383529 AAGCAAGACCAGGCCAGGTGCGG - Intronic
927812266 2:26186683-26186705 GATTAAGTTCAGGCCAGGTGCGG + Intronic
927933006 2:27057783-27057805 TAGAAAGAGCTGGCCAGGTGCGG + Intronic
928001774 2:27529507-27529529 TGTGAATAGCCGGCCAGGTGCGG + Intergenic
928142660 2:28744121-28744143 GAAGAAGATCAAGCCAGGTGTGG + Intergenic
928168673 2:28989339-28989361 TATGAAAAGCGGGCCCGGTATGG - Intronic
928200692 2:29246041-29246063 TCTGAAGAGCAGGTGAGCTGTGG + Intronic
928299408 2:30112190-30112212 GCTGTAGAGCAGGCCAGGTGCGG + Intergenic
928566420 2:32555678-32555700 TTAGAGTAGCAGGCCAGGTGTGG + Intronic
929680583 2:43989921-43989943 AATAAACATCAGGCCAGGTGCGG + Intronic
929833184 2:45366769-45366791 AAAGAAGAGCAGGCCGGGTGCGG - Intergenic
930024608 2:47022495-47022517 TGGCAAGAGAAGGCCAGGTGTGG - Intronic
930070658 2:47363367-47363389 TATGCTGAGTTGGCCAGGTGCGG + Intronic
930808447 2:55516636-55516658 TATGTATAACAGGCCGGGTGCGG - Intergenic
931250793 2:60529127-60529149 AGAGAAGAGCAGGGCAGGTGGGG - Intronic
931284656 2:60821719-60821741 AAGGAAGAGAAGGCCTGGTGGGG - Intergenic
931299234 2:60960186-60960208 TATGAAGATTAGGTCAGGTGGGG + Intronic
931991333 2:67793521-67793543 CATGAAGAACAGGATAGGTGAGG + Intergenic
932424870 2:71623778-71623800 AATCAAAAGCAAGCCAGGTGTGG + Intronic
933087341 2:78072242-78072264 AAGGAAAAGCAGGCCAGGCGCGG + Intergenic
933383975 2:81586657-81586679 TATGTATTGCTGGCCAGGTGCGG - Intergenic
933626354 2:84605055-84605077 TTTAAAGGGCAGGCCAGGCGTGG + Intronic
933883092 2:86690970-86690992 TATTAAAATTAGGCCAGGTGTGG - Intronic
934149313 2:89130259-89130281 TAAGAATAACTGGCCAGGTGTGG - Intergenic
934217980 2:90051775-90051797 TAAGAATAACTGGCCAGGTGTGG + Intergenic
934687880 2:96335061-96335083 AATGAGGAGCGGTCCAGGTGGGG - Intergenic
936613991 2:114030705-114030727 AAAGAAGAGAAGGCCAGGAGCGG + Intergenic
936953911 2:118005471-118005493 TAAGAAGCATAGGCCAGGTGCGG + Intronic
937494105 2:122400024-122400046 AAGGAAGGGCAGGCCAGGCGTGG + Intergenic
937850497 2:126628685-126628707 TATGTGAGGCAGGCCAGGTGTGG + Intergenic
937921378 2:127133988-127134010 CAAGAAAAGCATGCCAGGTGTGG - Intergenic
937938883 2:127269709-127269731 TGTGAATAGAAGGCCAGGCGCGG - Intronic
938005203 2:127783894-127783916 AAGGAAGTGCTGGCCAGGTGCGG - Intronic
938210075 2:129459766-129459788 TGTGAGGAGCAGGCCAGGTGAGG + Intergenic
938283701 2:130088863-130088885 GATGAAAATAAGGCCAGGTGTGG - Intronic
938334345 2:130477427-130477449 GATGAAAATAAGGCCAGGTGTGG - Intronic
938355481 2:130643241-130643263 GATGAAAATAAGGCCAGGTGTGG + Intronic
938431906 2:131250030-131250052 GATGAAAATAAGGCCAGGTGTGG + Intronic
938475578 2:131608655-131608677 GATGAAAATAAGGCCAGGTGTGG + Intergenic
938538259 2:132263772-132263794 TATCAAGAGAAGGCCAGGCACGG + Intergenic
938555800 2:132423272-132423294 TGTGCAGAGAAGGCCAGGTCAGG - Intronic
939380126 2:141424400-141424422 TAAGAAGATGAGGCCGGGTGCGG - Intronic
939579511 2:143931254-143931276 AATAAAGACAAGGCCAGGTGTGG - Intergenic
939763063 2:146209072-146209094 TATGAGGAGTAAGCTAGGTGTGG + Intergenic
940564239 2:155340020-155340042 TAGCAAGAGGTGGCCAGGTGCGG - Intergenic
940908635 2:159190947-159190969 TCTGTAGAGCAGGCTTGGTGGGG + Intronic
941361311 2:164554801-164554823 TATGAAGAGCAGTCTAGGGGAGG - Intronic
941821738 2:169850467-169850489 GATCCAGAGCAGGCCGGGTGCGG - Intronic
941869656 2:170370926-170370948 GAAAAAGAACAGGCCAGGTGCGG + Intronic
941922696 2:170867707-170867729 TAGGAACAGCAGGCCTGGCGCGG - Intergenic
941938105 2:171002562-171002584 TAGAAAAAGCAGGCCAGGCGCGG - Intronic
942019677 2:171854276-171854298 TCTGCATAGCAGGCCAGGCGCGG + Intronic
942175482 2:173329442-173329464 AATAAAAAGCAGGCGAGGTGCGG - Intergenic
942375418 2:175331594-175331616 TAAAAAGATCCGGCCAGGTGTGG + Intergenic
942384372 2:175425827-175425849 TTAAAAGAGCAGGCCAGGTGTGG + Intergenic
942395375 2:175541503-175541525 AATCAAGATCAGGCCAGGTGCGG - Intergenic
942477260 2:176340445-176340467 TATCACAACCAGGCCAGGTGTGG - Intergenic
942618101 2:177815918-177815940 TCTACAGAGCAGGCCAGGTGTGG + Intronic
942711985 2:178847237-178847259 AAAGCAAAGCAGGCCAGGTGCGG + Intronic
943000234 2:182318386-182318408 TATGAAGATTAGGACTGGTGAGG - Intronic
943248929 2:185492614-185492636 TATGAAGGCTAGGCCAGGAGCGG - Intergenic
943312496 2:186344350-186344372 TATTAAAAGTTGGCCAGGTGCGG + Intergenic
943366845 2:186974570-186974592 TTTTAAAAGCAGGCCAGGCGTGG - Intergenic
943537449 2:189170005-189170027 TAATAATAACAGGCCAGGTGTGG - Intronic
943609295 2:190013806-190013828 AATAAAGAGAAGTCCAGGTGTGG - Intronic
943752042 2:191519635-191519657 TATGAAGCTCAGGCCGGGTGTGG - Intergenic
944158532 2:196634742-196634764 AATAAAGACCAGGCCAGGTGCGG + Intergenic
944823893 2:203460824-203460846 TATAAAGATGAGGCCAGGCGTGG + Intronic
944830487 2:203529262-203529284 TCAGTAGAGCAGGCCAGGTGCGG - Intronic
945089193 2:206163054-206163076 ATTGCAGTGCAGGCCAGGTGTGG + Intergenic
945821717 2:214673220-214673242 TATGAAATGCCAGCCAGGTGCGG - Intergenic
946255557 2:218439219-218439241 TTTGAGAACCAGGCCAGGTGTGG - Intronic
946281737 2:218670880-218670902 AATGAAAAGGAGGCCGGGTGTGG + Intronic
946320131 2:218948702-218948724 TATGAACAACTGGCCAGGTGTGG + Intergenic
946723185 2:222633390-222633412 AAAGAAGAGAACGCCAGGTGTGG + Intronic
947212593 2:227721709-227721731 TCTAAAGATAAGGCCAGGTGCGG - Intergenic
947505422 2:230704796-230704818 AAGGAAAAGCAGGCCAGGCGCGG - Intergenic
947638169 2:231690948-231690970 TCTCAAAAGAAGGCCAGGTGTGG - Intergenic
947676714 2:231988131-231988153 TAAGAAAAATAGGCCAGGTGCGG - Intronic
947859798 2:233350559-233350581 TTTGAGGAGTAGGGCAGGTGCGG + Intergenic
948516896 2:238509786-238509808 TGGGAAGAGCAGGCCAGCTTAGG - Intergenic
948777462 2:240297085-240297107 TCTGCAGAGCATGTCAGGTGAGG + Intergenic
1168967432 20:1907350-1907372 TCTGAAGAGCAGGCCAGCACTGG - Intronic
1169098980 20:2929240-2929262 AAAAAACAGCAGGCCAGGTGTGG - Intronic
1169238637 20:3954612-3954634 TTTGAAGAACTGGCCAGGTATGG + Intronic
1170640330 20:18146367-18146389 TATAAAAAACAGGCCAGGCGCGG + Intronic
1170652205 20:18252978-18253000 AATGAAGAGCAGCCCAAGTATGG - Intergenic
1171506101 20:25634972-25634994 TAAGAAACTCAGGCCAGGTGTGG - Intergenic
1171811603 20:29748769-29748791 TATGAAGAGAAGGCCAGGCATGG + Intergenic
1172251838 20:33485121-33485143 TAAGAATATTAGGCCAGGTGCGG - Intergenic
1172451955 20:35032313-35032335 TATAATAATCAGGCCAGGTGTGG - Intronic
1172504658 20:35452710-35452732 TATGAGGAGTCGGCCGGGTGCGG - Intronic
1172559513 20:35874264-35874286 AATTTATAGCAGGCCAGGTGTGG - Intronic
1172748809 20:37234968-37234990 TATTAAGGTCAGGCCAGGCGTGG - Intronic
1172759775 20:37313936-37313958 GATGAAGAGGAGCCCATGTGAGG + Intronic
1172888520 20:38247425-38247447 AATGAGGAGTTGGCCAGGTGAGG - Intronic
1172944683 20:38678025-38678047 TATCCAGAGCAGGTCATGTGGGG - Intergenic
1172975198 20:38900845-38900867 TATCAAGAGCAGGACATGAGAGG + Intronic
1173604088 20:44317657-44317679 AATAAAAAGCAGGCCAGGAGCGG + Intergenic
1174228844 20:49027404-49027426 AATGGAGAGCAGGCCAGGCAAGG + Intronic
1174379984 20:50150082-50150104 TAGGAAGAGCATGCCTGGGGTGG + Intronic
1174504527 20:51008621-51008643 TCATAAGATCAGGCCAGGTGTGG - Intronic
1174770061 20:53291179-53291201 TATCAAGAGCAGGCTGGGAGCGG + Intronic
1175006325 20:55687301-55687323 TAAGAAGAGTAGGCCAGGCGTGG + Intergenic
1175028283 20:55926604-55926626 TATGAAGGACATCCCAGGTGTGG - Intergenic
1175124291 20:56739965-56739987 TATCAAGAACAAGACAGGTGGGG - Intergenic
1175893709 20:62326873-62326895 CATGGAGAGCAGGCCGGATGTGG - Exonic
1176107182 20:63394951-63394973 TGTGAAGACAAGGCCACGTGAGG + Intergenic
1176803916 21:13461604-13461626 AGTAAAGAGCTGGCCAGGTGTGG + Intergenic
1176912215 21:14579770-14579792 TCTGAAGAAGTGGCCAGGTGTGG - Intronic
1178119344 21:29452112-29452134 AATGAAAAACAGGACAGGTGCGG - Intronic
1178310024 21:31522159-31522181 TATTAAGAGCCGGCCGGGCGTGG - Intronic
1178312581 21:31542133-31542155 TGGGTACAGCAGGCCAGGTGCGG + Intronic
1178535731 21:33408886-33408908 AAAGAAGAAAAGGCCAGGTGTGG + Intronic
1178890507 21:36517128-36517150 TGTAAAGACCAGGCCAGGCGTGG - Intronic
1179062948 21:37996477-37996499 TCTGAAAAGCAGGCCTGGAGAGG + Intronic
1179137392 21:38692292-38692314 CAAAAAGAGCAGGCCAGGTGCGG + Intergenic
1179476064 21:41646048-41646070 AGTATAGAGCAGGCCAGGTGCGG - Intergenic
1179530459 21:42015068-42015090 GAGGCAGAGAAGGCCAGGTGTGG - Intergenic
1180044855 21:45300606-45300628 TCTGAAGGGAAGGCCAGCTGTGG - Intergenic
1180217365 21:46333914-46333936 TGTTTAGAGCTGGCCAGGTGTGG + Intronic
1180256895 21:46635806-46635828 AAGGAAGGACAGGCCAGGTGAGG + Exonic
1180313847 22:11260423-11260445 TATCAAGAGAAGGCCAGGCAAGG + Intergenic
1180341502 22:11623134-11623156 TATCAAGAGAAGGCCAGGCACGG - Intergenic
1180627569 22:17204324-17204346 TAAGAAGAGGAGGCCAGGCGTGG + Intronic
1180658169 22:17442271-17442293 AATGCAGATCAGGCCAGGTGTGG + Intronic
1180985259 22:19900458-19900480 TATGAAGTTATGGCCAGGTGCGG + Intronic
1181136360 22:20769377-20769399 TATCAAGGTCAGGCCAGGTGTGG + Intronic
1181163407 22:20970891-20970913 AATGGAGAGAAGGCCAGGTGTGG - Intronic
1181724180 22:24799914-24799936 TAAGAAAAATAGGCCAGGTGTGG - Intergenic
1181789586 22:25253958-25253980 TATGCAAATCAGGCCAGGTGCGG - Intergenic
1181824407 22:25502782-25502804 TATGCAAATCAGGCCAGGTGCGG - Intergenic
1181916131 22:26281666-26281688 AAAGAAAAGAAGGCCAGGTGCGG - Intronic
1181916820 22:26288042-26288064 TGTGAAGAGGAAGCCAGTTGGGG + Intronic
1182012880 22:27015199-27015221 TCTGAAGAGCAGGTCAGAGGAGG + Intergenic
1182139506 22:27941137-27941159 TACAAAAAGAAGGCCAGGTGTGG - Intergenic
1182183630 22:28378049-28378071 AATGCAGAGGGGGCCAGGTGAGG + Intronic
1182231906 22:28844510-28844532 GAAGAAGAACAGGCCATGTGAGG + Intergenic
1182326881 22:29519922-29519944 TAGAAAGGCCAGGCCAGGTGCGG - Intronic
1182423663 22:30260608-30260630 AAGGAAGAGCAGGGCAGGTGGGG - Intergenic
1182479821 22:30600524-30600546 TATAAAAATAAGGCCAGGTGTGG + Intronic
1182536502 22:31007756-31007778 TAAGAAGAGGAGGCCGGGTGTGG + Intergenic
1182539633 22:31031429-31031451 TAAGAAAATCAGGCCAGGTGTGG - Intergenic
1182581124 22:31312298-31312320 TACAAAAATCAGGCCAGGTGCGG + Intergenic
1182728742 22:32470498-32470520 AATGTTTAGCAGGCCAGGTGCGG + Intergenic
1182943170 22:34297673-34297695 AAAGGAGAGCAGGCCAGGGGAGG - Intergenic
1183160027 22:36106730-36106752 AAGCAAGAGCAGGCCGGGTGCGG - Intergenic
1183173559 22:36205403-36205425 CAACAAGAGCAGGCCTGGTGCGG - Intergenic
1183179801 22:36252429-36252451 CAACAAGAGCAGGCCTGGTGCGG + Intergenic
1183685593 22:39359747-39359769 CGGGAAGAGGAGGCCAGGTGTGG - Intronic
1183861756 22:40675324-40675346 TAAAATGAGTAGGCCAGGTGTGG + Intergenic
1183906399 22:41044149-41044171 TATCAAAAATAGGCCAGGTGTGG - Intergenic
1183973459 22:41496019-41496041 GATGAGTTGCAGGCCAGGTGTGG + Intronic
1185122300 22:48979150-48979172 TATGAGGTCTAGGCCAGGTGTGG + Intergenic
1185180628 22:49358821-49358843 TAATAAAAACAGGCCAGGTGCGG - Intergenic
949104658 3:189193-189215 TATGAAGTATAGACCAGGTGTGG - Intergenic
949399848 3:3654564-3654586 TATAAAGAGCAGGGTGGGTGTGG + Intergenic
949602032 3:5610563-5610585 TAACATGGGCAGGCCAGGTGTGG - Intergenic
949704735 3:6803370-6803392 TAAGAAAAGTGGGCCAGGTGCGG - Intronic
949988859 3:9560630-9560652 TATGGCGTACAGGCCAGGTGTGG + Intergenic
950010514 3:9719701-9719723 TATACAAAGCAGGCCAGGTGTGG + Intronic
950119657 3:10473339-10473361 TATGAAGAGCAGGCCAGGTGTGG + Intronic
950515646 3:13463288-13463310 TAATAGGAGGAGGCCAGGTGGGG + Intergenic
950635593 3:14312168-14312190 AAGGAAGAGCAGGCACGGTGTGG + Intergenic
951535594 3:23737886-23737908 TAAGAAAAGCAGGCCAGGTGTGG + Intergenic
951810439 3:26693038-26693060 GATCAAGAGCAGGCCGGGCGCGG + Intronic
951892303 3:27578775-27578797 AAAGAAAAGCAGGCCAGGTGCGG + Intergenic
952083716 3:29792946-29792968 AAGGAAAAGCTGGCCAGGTGTGG + Intronic
952349043 3:32516849-32516871 AATGAAGAGGTGGCCCGGTGTGG + Intergenic
952471057 3:33651947-33651969 AGTGAAGTGGAGGCCAGGTGTGG - Intronic
952619262 3:35316704-35316726 GATAAGGACCAGGCCAGGTGTGG + Intergenic
952633371 3:35497269-35497291 TAAGAAAAATAGGCCAGGTGTGG + Intergenic
952972357 3:38659573-38659595 TATCTAGAGCATCCCAGGTGGGG - Intergenic
953131338 3:40142341-40142363 AATCAACAGCAGGCCGGGTGCGG - Intronic
953283500 3:41581616-41581638 TATGAACAGCAGGCTAGGCCAGG + Intronic
953934814 3:47032219-47032241 GAAGTAAAGCAGGCCAGGTGTGG + Intronic
953963566 3:47284625-47284647 TAAGAAGAGCAGGCTGGGCGCGG - Intronic
954154013 3:48674751-48674773 TGGGAAGAGCAGGCCAGCTCAGG + Intronic
954244305 3:49318616-49318638 TATAAACAACCGGCCAGGTGTGG + Intronic
954252128 3:49376129-49376151 TAGCAAGAACAGGCCAGGCGTGG - Intronic
954667250 3:52262836-52262858 CACAATGAGCAGGCCAGGTGCGG + Intronic
954776573 3:53024343-53024365 TAGGAAGAGCATTCCAGGCGAGG + Intronic
954937585 3:54341015-54341037 GAGGAAGAGCAGTCTAGGTGAGG - Intronic
955382891 3:58454933-58454955 AAAGAAGAGCAGACCAGGTGTGG - Intergenic
955392135 3:58529688-58529710 TCTGAAGCCCAGGCCAGGCGAGG + Intronic
955698795 3:61662991-61663013 TGAAAAGAGCAGGCCAGGTATGG + Intronic
956102547 3:65783830-65783852 AAAAAAGTGCAGGCCAGGTGTGG + Intronic
956122290 3:65978434-65978456 TTGGAAGAGAAGGCCAGGGGAGG + Intronic
956252337 3:67247884-67247906 TATTAAGAGCAGGCGATCTGAGG - Intergenic
956426038 3:69136479-69136501 AATCAAGAGCAGGCAAAGTGAGG + Intergenic
956840589 3:73136177-73136199 TATACAGAATAGGCCAGGTGCGG - Intergenic
957187987 3:76967495-76967517 AAAAAAGAGCTGGCCAGGTGCGG - Intronic
958864117 3:99481317-99481339 AATGAAATGGAGGCCAGGTGTGG + Intergenic
959012051 3:101089088-101089110 AATGAAGACCATTCCAGGTGAGG + Intergenic
959413117 3:106049565-106049587 TATGAAGAGTAAGAGAGGTGAGG + Intergenic
959667176 3:108935101-108935123 GAGCAAGAACAGGCCAGGTGTGG - Intronic
960179768 3:114562088-114562110 TATGAAGACCAAGAGAGGTGAGG - Intronic
961732299 3:128974829-128974851 AAAGAAGAGAAGGCCAGGCGTGG + Intronic
961739751 3:129025826-129025848 TCTGGAGAGCAGGACAGATGAGG - Intronic
961767146 3:129220277-129220299 AATGAAAAATAGGCCAGGTGCGG + Intergenic
962078121 3:132106441-132106463 TAGAAACAGAAGGCCAGGTGTGG - Intronic
963068524 3:141282788-141282810 TATGAAAGGCAGGCCCGATGGGG + Intronic
963504500 3:146166573-146166595 TAAGAAGAGCATGCCAGGATAGG + Intergenic
966393976 3:179482184-179482206 TAAAAGAAGCAGGCCAGGTGTGG - Intergenic
966502380 3:180657947-180657969 TATTAATAGCAGGCCAGGTGCGG + Intronic
966608911 3:181849069-181849091 GCTGAATATCAGGCCAGGTGTGG + Intergenic
966685318 3:182687378-182687400 GATGAAATGCAGGCCAGGTATGG + Intergenic
966844217 3:184114473-184114495 TATTCAGGGCAGGCCGGGTGCGG + Intergenic
966847023 3:184138643-184138665 AATGAAAATAAGGCCAGGTGTGG - Intronic
967060007 3:185863883-185863905 CATAAAGACCTGGCCAGGTGTGG + Intergenic
967133105 3:186490856-186490878 TATGAAGTATTGGCCAGGTGCGG + Intergenic
967216536 3:187215435-187215457 TAAGAAGAGTAGGCCAGGCACGG - Intergenic
967347583 3:188475610-188475632 TATGAAAAGCAGGCCGGGCGTGG + Intronic
967788191 3:193519933-193519955 TAGAAATTGCAGGCCAGGTGCGG - Intronic
968035717 3:195545761-195545783 AAGGAAAAGCAGGCCATGTGTGG - Intergenic
968111033 3:196046950-196046972 TATACAAAGCTGGCCAGGTGCGG + Intronic
968175328 3:196544082-196544104 AATGAAAAGCTGGCCAAGTGTGG - Intergenic
968328684 3:197844771-197844793 TACGAAAAACTGGCCAGGTGTGG - Intronic
968363562 3:198167141-198167163 TATAGATAGCAGGCCAGGTGTGG - Intergenic
968427075 4:531289-531311 TCAGGAGAGCAGGCCAGATGGGG + Intronic
968763163 4:2452770-2452792 TATGAAGGCCAGGCCAGGCATGG + Intronic
968813469 4:2810281-2810303 GGAGAGGAGCAGGCCAGGTGAGG - Intronic
968864070 4:3196444-3196466 TATCCATTGCAGGCCAGGTGTGG + Intronic
968925226 4:3543490-3543512 TATGAAGGGCAGCCGAGGAGGGG - Intergenic
969684103 4:8659951-8659973 TATGAAAATTAGGCCGGGTGCGG - Intergenic
969888407 4:10237195-10237217 TATCAAGGGCAGGCAAGATGAGG - Intergenic
970127902 4:12834902-12834924 TATGAGAAGGAGGCCGGGTGTGG - Intergenic
970322116 4:14885359-14885381 TATGCAGATCAGGCCAGGCATGG + Intergenic
970585205 4:17508866-17508888 AAGGAAGAACAGGCCAGGCGCGG + Intronic
970798121 4:19939371-19939393 TATGAAGACTGGGCCGGGTGCGG + Intergenic
971219522 4:24692033-24692055 TATAAAGAGCAGCACAGGAGAGG + Intergenic
971404904 4:26313375-26313397 TACAAAGAAAAGGCCAGGTGTGG + Intronic
971634888 4:29045715-29045737 ATTGAAGTGCAGGCCAGGTGGGG + Intergenic
972086515 4:35223747-35223769 AATGGAAAACAGGCCAGGTGTGG + Intergenic
972388870 4:38593702-38593724 TAAGAGTAGTAGGCCAGGTGTGG - Intergenic
972426720 4:38940179-38940201 AATGAAAGGCAGGCCAGGTGTGG - Intronic
972541183 4:40040773-40040795 TATCTCAAGCAGGCCAGGTGTGG - Intergenic
972644874 4:40957872-40957894 TATGAGGTGGAGGCCGGGTGTGG - Intronic
972961131 4:44453303-44453325 TGTGAACAGCAGGCCAGGCCAGG + Intergenic
972968980 4:44548911-44548933 TATTAAAAACAGGCCAGGCGTGG - Intergenic
973325592 4:48857861-48857883 AATGAAGTCAAGGCCAGGTGTGG + Intronic
973622395 4:52740748-52740770 AATGAGGACCAGGCCAGGTGCGG + Intronic
973653075 4:53016816-53016838 GATCAAGATCTGGCCAGGTGCGG + Intronic
973769874 4:54196681-54196703 GATGAAAAACAGGCCAGGTGCGG + Intronic
973816190 4:54621606-54621628 TATGGACTGCAGGCCAGGTGCGG - Intergenic
973980718 4:56306201-56306223 GATAAATATCAGGCCAGGTGTGG + Intronic
974007257 4:56571092-56571114 TATAAAGTAAAGGCCAGGTGTGG - Intronic
975303610 4:72821526-72821548 TAAAAACAACAGGCCAGGTGTGG + Intergenic
975587831 4:75968739-75968761 AAAGCAGAACAGGCCAGGTGCGG + Intronic
975814540 4:78203856-78203878 AAACAAGAGGAGGCCAGGTGTGG - Intronic
976730758 4:88258792-88258814 TACAAAGATCTGGCCAGGTGCGG + Exonic
976880782 4:89922394-89922416 TATTGAGTACAGGCCAGGTGCGG - Intronic
977436432 4:97001624-97001646 AAAAAAGATCAGGCCAGGTGCGG - Intergenic
977977126 4:103278707-103278729 AGCGAAGAGCTGGCCAGGTGTGG - Intergenic
978170566 4:105665202-105665224 TTTTAGTAGCAGGCCAGGTGCGG + Intronic
978271766 4:106899587-106899609 TAAGAAGAAAAGGCCAGGTGCGG - Intergenic
978316115 4:107439320-107439342 AATAATGAGCAGGCCATGTGTGG + Intergenic
978600057 4:110418643-110418665 TAAGAAGATTAGGCCGGGTGGGG + Intronic
978605119 4:110471461-110471483 AATAAAAATCAGGCCAGGTGAGG - Intronic
979480788 4:121214530-121214552 TATGGAGAGGTGGCCGGGTGAGG + Intronic
979551304 4:121994064-121994086 AATAAAAAGCAGGCCAGGTGCGG - Intergenic
980140532 4:128910971-128910993 TAGTAACAACAGGCCAGGTGCGG + Intronic
980496549 4:133592326-133592348 TTTGGAGAGGAGGCCAGCTGGGG + Intergenic
980622952 4:135333376-135333398 TATATAGTGCAGGCCAGGTGTGG + Intergenic
980947920 4:139341303-139341325 AATTAACATCAGGCCAGGTGCGG + Intronic
981085896 4:140683166-140683188 TTCAATGAGCAGGCCAGGTGCGG - Intronic
981311107 4:143298990-143299012 AAAGAAAGGCAGGCCAGGTGTGG + Intergenic
981312668 4:143312449-143312471 TAGGAAGAGTGGGCCAAGTGGGG - Intergenic
981522784 4:145681048-145681070 TTTGAAAGGCAGGCGAGGTGGGG + Intronic
981636618 4:146888345-146888367 GGTAAAGAGCAGACCAGGTGGGG + Intronic
982007036 4:151073395-151073417 TATAAAGACCTGGCCAGGCGTGG + Intergenic
982552365 4:156818790-156818812 TAGAAAGAGTGGGCCAGGTGCGG - Intronic
982773915 4:159422957-159422979 AAGGATTAGCAGGCCAGGTGCGG + Intergenic
983010585 4:162540566-162540588 TGTGTAGGACAGGCCAGGTGTGG - Intergenic
983921251 4:173347764-173347786 GACTATGAGCAGGCCAGGTGTGG + Intergenic
984270519 4:177543442-177543464 TATAAAGGCCAGGCCAGGTGTGG + Intergenic
984308982 4:178032398-178032420 ATGGAAGAGCTGGCCAGGTGTGG - Intergenic
984475410 4:180228728-180228750 TATGAGGGGCAGGCAAGCTGAGG - Intergenic
984672407 4:182505744-182505766 AAAGAAAAGCAGGCCGGGTGTGG - Intronic
984756135 4:183327284-183327306 GATGCAGTGAAGGCCAGGTGCGG + Intergenic
985146345 4:186897914-186897936 TCTAAGGAGCCGGCCAGGTGCGG - Intergenic
985813108 5:2105088-2105110 AATAAATTGCAGGCCAGGTGTGG + Intergenic
985898256 5:2763543-2763565 TCTGGAGAGGAGGCCAGGAGAGG - Intergenic
986055340 5:4130818-4130840 TTTAAAGAGCAGGCCAGGTTTGG - Intergenic
986607860 5:9540297-9540319 TATGGAGAGAAGGCCGGGCGCGG + Intronic
987359099 5:17090753-17090775 TAGAATGAACAGGCCAGGTGTGG + Intronic
987376003 5:17235550-17235572 CATAAAGAGCAGGCCAGGCGTGG - Intronic
987982473 5:25104246-25104268 TTTTAAAAGTAGGCCAGGTGCGG + Intergenic
988461364 5:31441128-31441150 AAAAAAGGGCAGGCCAGGTGTGG + Intronic
988827083 5:34948574-34948596 TAGTGAGAGCTGGCCAGGTGCGG + Intronic
988874940 5:35433663-35433685 TATAAAAAAGAGGCCAGGTGTGG + Intergenic
989160725 5:38388327-38388349 AATGCAAACCAGGCCAGGTGTGG + Intronic
989167240 5:38444059-38444081 TATAAAGAGTTGGTCAGGTGTGG - Intronic
989365105 5:40647228-40647250 TAGTAATAACAGGCCAGGTGCGG + Intergenic
989622730 5:43400792-43400814 TAAGAAGGGCAGGCTGGGTGTGG + Intronic
989978560 5:50614018-50614040 TCTGTAAATCAGGCCAGGTGTGG + Intergenic
990415169 5:55579449-55579471 TCTGATCAGCAGGCCAGGGGTGG - Intergenic
990963472 5:61419110-61419132 TATAAAGAGGAGGCCGGGCGTGG - Intronic
991444525 5:66684969-66684991 AAAGAATAGCTGGCCAGGTGGGG + Intronic
992209199 5:74460996-74461018 TAGGAAGAGAAGGAGAGGTGCGG + Intergenic
992433733 5:76735181-76735203 TTAAAAGAGCAGGCCAGGCGCGG + Exonic
992680515 5:79148315-79148337 TAAGAGCAGCAGACCAGGTGCGG - Intronic
992715145 5:79503240-79503262 TAAGAAAAGCAGGCCAGGCATGG + Intronic
992802473 5:80306037-80306059 AATGAAAAGCAAGCCAGTTGGGG - Intergenic
992900151 5:81286628-81286650 AAGGTAGAGCGGGCCAGGTGTGG - Intergenic
992953737 5:81886992-81887014 TAAGAAAAGCAGGCCGGGCGCGG - Intergenic
993336426 5:86665407-86665429 TAGCAAGAAAAGGCCAGGTGCGG + Intergenic
993964379 5:94343398-94343420 GGTGAAAAGGAGGCCAGGTGTGG + Intronic
994508697 5:100675371-100675393 TAAGAAAAACAGGCCAGGTGGGG - Intergenic
995294031 5:110497714-110497736 TGTGTAAAGCAGGCCAGGTGGGG - Intronic
995879290 5:116826084-116826106 GATGCAGATCAGGCCAGGCGCGG + Intergenic
995917722 5:117269749-117269771 AATAAACAACAGGCCAGGTGCGG + Intergenic
996260009 5:121455599-121455621 TATGAAGAACAGGTCAGGCCAGG - Intergenic
996328843 5:122307839-122307861 CATGAAGAACAGATCAGGTGAGG + Intergenic
996555737 5:124777339-124777361 TATCTAGAGAAGGCCGGGTGTGG + Intergenic
997525332 5:134549367-134549389 TATAAAAACTAGGCCAGGTGCGG + Intronic
997915774 5:137923303-137923325 TTTTAAAAGTAGGCCAGGTGCGG - Intronic
997991269 5:138546048-138546070 AAGGAAGAGGAGGCCAGGTGTGG - Intergenic
998223489 5:140307179-140307201 AATGTACATCAGGCCAGGTGTGG + Intergenic
998249992 5:140546115-140546137 TTTGAGAAGCTGGCCAGGTGTGG + Intronic
998297436 5:140985225-140985247 TAAGAAGATTAGGCCAGGCGCGG - Intronic
998350683 5:141498639-141498661 GAAGAAGACCTGGCCAGGTGTGG + Intronic
998380562 5:141722092-141722114 ATGGAAAAGCAGGCCAGGTGTGG - Intergenic
998534559 5:142917327-142917349 TCTGAAGTTTAGGCCAGGTGTGG - Intronic
999045444 5:148463468-148463490 CTTGAAAAGCAGGCCAGGTGTGG - Intronic
999669607 5:153947386-153947408 AAAGAAAAACAGGCCAGGTGAGG + Intergenic
999735431 5:154509543-154509565 AAAGAGGAGAAGGCCAGGTGTGG + Intergenic
1000109434 5:158093809-158093831 AATGAGGAACTGGCCAGGTGTGG - Intergenic
1000357527 5:160414894-160414916 TCTGTAGAGCAGGCCAGGGGTGG + Intronic
1000922222 5:167151805-167151827 GAAGAAAAGCAGGCCAGGCGCGG - Intergenic
1001725826 5:173898954-173898976 AATTAAGTTCAGGCCAGGTGCGG - Intronic
1001786990 5:174422166-174422188 TATGAAGTTCTGGCCGGGTGCGG - Intergenic
1001810290 5:174622451-174622473 AAAGAAGGGCAGGCCAGGAGGGG + Intergenic
1002255665 5:177956844-177956866 TGTCAGGAGGAGGCCAGGTGCGG + Intergenic
1002282102 5:178137125-178137147 GATGGAGAGCAGGCCAGGTGAGG + Intronic
1002386724 5:178873076-178873098 TAAGAAACACAGGCCAGGTGTGG - Intronic
1002602047 5:180359450-180359472 TAAGAAAAGCAGGCCAGGCTGGG + Intergenic
1002625484 5:180525244-180525266 TTTGAAAAGTAGGCCGGGTGCGG + Intronic
1002633413 5:180595551-180595573 CTTGAAGGCCAGGCCAGGTGAGG + Intergenic
1002968535 6:1991358-1991380 TGTGGGGAGTAGGCCAGGTGCGG - Intronic
1003200616 6:3956861-3956883 AATGAAGAGTAGGGCAGGAGTGG - Intergenic
1003217859 6:4131564-4131586 TTTGAAAAACAAGCCAGGTGTGG + Intronic
1003302552 6:4897624-4897646 TCAGGAGACCAGGCCAGGTGTGG + Intronic
1003319690 6:5039432-5039454 AATGAAGAGCAGGGAAGGGGTGG + Intergenic
1003823330 6:9924860-9924882 AAGGCAGAGCAGGCCAGGAGGGG + Intronic
1003943740 6:11054241-11054263 TAATAAGTGTAGGCCAGGTGCGG + Intergenic
1004062614 6:12212763-12212785 GAAGAAAAACAGGCCAGGTGTGG + Intergenic
1004288032 6:14340761-14340783 CAGGAAGAGGAGGCGAGGTGAGG + Intergenic
1004640369 6:17509385-17509407 TATAAAAAGCAGACCAGGTGTGG + Intronic
1004754136 6:18593376-18593398 AACAAAGAACAGGCCAGGTGTGG - Intergenic
1004905774 6:20235737-20235759 TAAAAAGAACAGGCCAGGCGTGG + Intergenic
1004937065 6:20518267-20518289 TAAGAAAAGTAGGCCAGGCGTGG + Intergenic
1005282004 6:24284315-24284337 AATGTAAAGCAGGCCAGGCGTGG + Intronic
1005426748 6:25710768-25710790 TAAAAAGAAAAGGCCAGGTGCGG + Intergenic
1006531619 6:34660007-34660029 TAAGAAAACCAGGCCAGGTGTGG + Intronic
1006674580 6:35753124-35753146 TATCAAAAGTAAGCCAGGTGCGG - Intergenic
1006851229 6:37100216-37100238 AAGGAAAAACAGGCCAGGTGTGG + Intergenic
1007100462 6:39242717-39242739 TAAAAAAAGCAAGCCAGGTGCGG + Intergenic
1007511390 6:42376829-42376851 TAGCTAGAGGAGGCCAGGTGCGG - Intronic
1007544459 6:42681916-42681938 TCTTAAAAGTAGGCCAGGTGTGG + Intronic
1007565798 6:42849374-42849396 AATGAAAAGGAGGCCAGATGTGG - Intronic
1007781047 6:44254940-44254962 GATGAAGAGCTGGCCACATGCGG + Exonic
1007882456 6:45182550-45182572 AAAGAAAGGCAGGCCAGGTGCGG - Intronic
1007898327 6:45385607-45385629 TCTTAAAAGCAGGCCAGGTGTGG + Intronic
1008367304 6:50697485-50697507 AAAGAAGATCAGGCCAGGCGTGG + Intergenic
1008488209 6:52057703-52057725 GATTAAAAGCTGGCCAGGTGTGG - Intronic
1008809550 6:55479156-55479178 TATGAAGCCCAAGCCTGGTGAGG - Intronic
1009968579 6:70603369-70603391 AACAAATAGCAGGCCAGGTGCGG - Intergenic
1010170200 6:72966266-72966288 AAAGAAAAGCAGGCTAGGTGTGG + Intronic
1010223031 6:73464029-73464051 TATAAACAACAGGCCAGGTGTGG - Intronic
1010817658 6:80377330-80377352 CATAAAAATCAGGCCAGGTGTGG - Intergenic
1010976758 6:82324406-82324428 TATCAATATCAGGCCAGGTGCGG + Intergenic
1011037178 6:82990566-82990588 AAGGAAAGGCAGGCCAGGTGTGG - Intronic
1011494075 6:87921584-87921606 TGTGAACAGTTGGCCAGGTGTGG + Intergenic
1011755149 6:90491203-90491225 AAGGAAAACCAGGCCAGGTGCGG - Intergenic
1012562969 6:100609050-100609072 TATTTATAGCAGGCCAGGCGCGG - Intronic
1012892532 6:104912884-104912906 TAAAAAGAAGAGGCCAGGTGTGG + Intergenic
1013036939 6:106393961-106393983 AAGGAAGAGGAGGCCAGGGGTGG - Intergenic
1013082520 6:106824825-106824847 TTAAAAGAACAGGCCAGGTGTGG - Intergenic
1013389023 6:109664742-109664764 AAAGAAGATCAGGCCAGGTGCGG + Intronic
1013505319 6:110794333-110794355 TGGGAAGAACAGGCCAGGCGCGG - Intronic
1013536260 6:111065901-111065923 TAGGAATATCTGGCCAGGTGTGG - Intergenic
1013541702 6:111117058-111117080 TGGGAAGGTCAGGCCAGGTGTGG + Intronic
1013685137 6:112572178-112572200 AATGAAGAGCAGGGCTTGTGAGG + Intergenic
1013702228 6:112786358-112786380 TAGGGAGCTCAGGCCAGGTGCGG - Intergenic
1013802859 6:113967417-113967439 TATCAAGATTAGGCCAGGTGTGG - Intronic
1014106853 6:117574788-117574810 AAAAAAGAGTAGGCCAGGTGCGG + Intronic
1014214324 6:118738250-118738272 TAAGAACAGCTGTCCAGGTGTGG + Intergenic
1014844599 6:126259485-126259507 AATGTGGTGCAGGCCAGGTGCGG - Intergenic
1014852395 6:126357895-126357917 TAAGAAGAACTGGCCAGGCGTGG - Intergenic
1015128233 6:129778367-129778389 AATGTACAGCAAGCCAGGTGTGG + Intergenic
1015139934 6:129919578-129919600 TAAAATGAACAGGCCAGGTGTGG + Intergenic
1015422804 6:133030359-133030381 GGTGCAGAACAGGCCAGGTGCGG - Intergenic
1015750181 6:136550772-136550794 TCCGAGGAGCAGCCCAGGTGGGG + Intronic
1016082225 6:139870329-139870351 TAGCCAGAGCAGGCCAGGCGCGG + Intergenic
1016146188 6:140676888-140676910 AAAGTACAGCAGGCCAGGTGCGG - Intergenic
1016414864 6:143821701-143821723 AAGAAAGAGTAGGCCAGGTGTGG + Intronic
1016646469 6:146414690-146414712 AATAAAAGGCAGGCCAGGTGTGG - Intronic
1016716439 6:147237064-147237086 AATGAAGAACAGGTCAGGCGTGG - Intronic
1016786810 6:148019892-148019914 TATGAAGACCAGGGAAGGTTTGG + Intergenic
1016960864 6:149671422-149671444 ACTGAACATCAGGCCAGGTGCGG - Intronic
1017162516 6:151379348-151379370 TAATAAAACCAGGCCAGGTGTGG + Intronic
1017334449 6:153238994-153239016 TAAGAAGTTCAGGCCAGGTGTGG + Intergenic
1017689712 6:156951731-156951753 AATGAAGTGTTGGCCAGGTGCGG - Intronic
1017772087 6:157651362-157651384 GAGGAAGAGAATGCCAGGTGAGG - Intronic
1017925556 6:158909090-158909112 GATCGAGACCAGGCCAGGTGTGG + Intronic
1017926768 6:158917431-158917453 AAGGAAGCGCAGGCCGGGTGCGG - Intergenic
1018050169 6:160002098-160002120 TAAGAAAATCAGGCCGGGTGTGG + Intronic
1018627781 6:165796374-165796396 AAAGATGTGCAGGCCAGGTGCGG - Intronic
1018638854 6:165888572-165888594 GAAAAAAAGCAGGCCAGGTGCGG - Intronic
1019252138 7:21542-21564 TATAGATAGCAGGCCAGGTGTGG + Intergenic
1019677797 7:2325535-2325557 GAGGAATATCAGGCCAGGTGGGG + Intronic
1019746088 7:2701073-2701095 TATAAAGATCACGCCGGGTGTGG + Intronic
1019764042 7:2836631-2836653 TAACAAGAGAAGGCCAGGTGCGG + Intronic
1019979536 7:4611127-4611149 AATTAACAGCAGGCCAGGTGTGG + Intergenic
1020046202 7:5042477-5042499 AATGCATAGCAGGCCAGGTGCGG + Intronic
1020063495 7:5169959-5169981 GGTCAAGAGCAGGCCAGGTATGG + Intergenic
1020065979 7:5189016-5189038 TATAAATAGAAGGCCAGGTGTGG - Intergenic
1020167912 7:5822779-5822801 TATAAACAGTAGGCCAGGCGCGG - Intergenic
1020417850 7:7967015-7967037 TATGTAAAGCTGGCTAGGTGCGG - Intronic
1020669105 7:11083748-11083770 TAGGGAAAGCAGGCCAGGTGTGG - Intronic
1021203465 7:17752660-17752682 TCAGAGGAGCAGGCCGGGTGCGG + Intergenic
1021268012 7:18548947-18548969 TATAAAAAATAGGCCAGGTGTGG + Intronic
1021463925 7:20920450-20920472 TAGGAAGGGCATGCTAGGTGGGG + Intergenic
1021480205 7:21107137-21107159 TATGAAAAATTGGCCAGGTGTGG - Intergenic
1022085376 7:27062474-27062496 AATGCAATGCAGGCCAGGTGTGG + Intergenic
1022580331 7:31547131-31547153 TATAAAGAGAAGGGAAGGTGTGG + Intronic
1023166661 7:37349742-37349764 AGTGAAGACTAGGCCAGGTGTGG - Intronic
1023380339 7:39600685-39600707 TAAAAACAGCAGGCCAGGGGCGG - Intronic
1023438789 7:40165823-40165845 TAACAATTGCAGGCCAGGTGTGG + Intronic
1023533558 7:41183734-41183756 AAAGCAGAGCTGGCCAGGTGTGG - Intergenic
1023855939 7:44184052-44184074 GATGAAGAGCAGGAGAGGAGAGG + Intronic
1024296356 7:47845869-47845891 AATGAATAACAGGCCAGGCGTGG - Intronic
1024327199 7:48118150-48118172 AATAAAGAACAGGCCGGGTGTGG - Intergenic
1024539286 7:50463056-50463078 AAGGAAGAGAAGGCCGGGTGCGG - Intronic
1024619513 7:51145667-51145689 GAGGAATAACAGGCCAGGTGTGG - Intronic
1024787151 7:52921525-52921547 TATGAAGAACAGGCTGGGAGCGG + Intergenic
1025016457 7:55442824-55442846 AATAAAAAGCAGGCCGGGTGCGG + Intronic
1025063882 7:55836029-55836051 TATGGTAACCAGGCCAGGTGTGG - Intronic
1025066022 7:55856780-55856802 AAACAAGTGCAGGCCAGGTGTGG + Intronic
1025203042 7:56973905-56973927 TACAAAAATCAGGCCAGGTGCGG - Intergenic
1025668902 7:63603021-63603043 TACAAAAATCAGGCCAGGTGCGG + Intergenic
1026456616 7:70578118-70578140 TATGGACAAAAGGCCAGGTGCGG - Intronic
1026491832 7:70870145-70870167 AATGTAGTACAGGCCAGGTGTGG - Intergenic
1026552688 7:71381486-71381508 CCTGCAGAGCAGGCCAGGTGCGG + Intronic
1026630556 7:72034061-72034083 TAGGAACAACAGGCCAGGTGCGG + Intronic
1026635250 7:72076306-72076328 AAAAAAAAGCAGGCCAGGTGCGG + Intronic
1026781041 7:73267673-73267695 AATCAAGCACAGGCCAGGTGTGG - Intergenic
1027021895 7:74821115-74821137 AATCAAGCACAGGCCAGGTGTGG - Intronic
1027066126 7:75124802-75124824 AATCAAGCACAGGCCAGGTGTGG + Intronic
1027117071 7:75489676-75489698 AATGTATAGCAGGCCAGGCGCGG - Intergenic
1027179240 7:75926503-75926525 TATTGAGTGCTGGCCAGGTGTGG + Intronic
1027179953 7:75931657-75931679 AAGGAAAAACAGGCCAGGTGCGG - Intronic
1027196911 7:76037072-76037094 TAAGAAGAGCTGGCCGGGTGCGG - Intronic
1027274738 7:76545928-76545950 AATGCATAGCAGGCCAGGCGCGG + Intergenic
1027353838 7:77337858-77337880 AATCAAGGGCAGGCCAGGTGTGG + Intronic
1027422148 7:78027335-78027357 TATGACCTGCAGGCCAGGCGCGG + Intronic
1027782822 7:82541012-82541034 TATGAAGAGGAGTAAAGGTGAGG - Intergenic
1028959333 7:96731712-96731734 CATGAAAAGCAGGCCGGGCGCGG + Intergenic
1029443717 7:100601705-100601727 TGTGAAGTGGAGGCCAGGTGTGG + Intergenic
1029594035 7:101527259-101527281 GAGAGAGAGCAGGCCAGGTGGGG - Intronic
1029720432 7:102360386-102360408 AATGCATAGCAGGCCAGGCGCGG + Intergenic
1029872707 7:103711947-103711969 AATGAATAGCAGGTCAGCTGTGG - Intronic
1030089409 7:105844073-105844095 TAAGAAGTGCAGGCCATTTGGGG - Intronic
1030288521 7:107849416-107849438 AAATAAAAGCAGGCCAGGTGCGG - Intergenic
1031504077 7:122559478-122559500 TAAGAAGAGAGGGCCAGGTGCGG + Intronic
1031926418 7:127642863-127642885 AGTCAAGAGCAGGCCAGGTGCGG - Intergenic
1032300271 7:130680214-130680236 AAGGAAAAGCAGGCCAGGTGCGG + Intronic
1032393755 7:131574361-131574383 TATGATGAGAAGGTCGGGTGCGG - Intergenic
1032542448 7:132714574-132714596 TTTAAAAAGCAGGCCAGGTATGG + Intronic
1032661845 7:133992571-133992593 TACAAAAATCAGGCCAGGTGCGG - Intronic
1033100229 7:138463178-138463200 AAATAAGAACAGGCCAGGTGCGG - Intronic
1033191652 7:139286216-139286238 TATAAAAATTAGGCCAGGTGTGG - Intronic
1033345963 7:140525952-140525974 AATGAAGAGCAGGGCTGGGGAGG + Intronic
1033479007 7:141720309-141720331 AATGAAGAACTAGCCAGGTGTGG - Intronic
1033649298 7:143328746-143328768 TGTGAAGAGCAGGGCAGAAGGGG + Intronic
1033714198 7:143982590-143982612 AATAAAGAAGAGGCCAGGTGGGG + Intergenic
1034121416 7:148631454-148631476 AAAGAAGAGGGGGCCAGGTGTGG + Intergenic
1034132635 7:148734532-148734554 CAAGAAAAACAGGCCAGGTGCGG - Intronic
1034230018 7:149516674-149516696 AATAAAAAGCAGGCCAGGCGCGG + Intergenic
1034527394 7:151674131-151674153 TAAGAATACAAGGCCAGGTGCGG - Intronic
1035344203 7:158187983-158188005 AATGGAGAGCAGGCAAGATGGGG + Intronic
1035826996 8:2655577-2655599 TATTATATGCAGGCCAGGTGTGG + Intergenic
1035856535 8:2982063-2982085 TATGGGTAACAGGCCAGGTGCGG + Intronic
1036044109 8:5120406-5120428 TATCAAGAGCAAGCCACGGGAGG + Intergenic
1036061352 8:5324974-5324996 TAGGCAGAGCAGGCCGGGCGCGG + Intergenic
1036119190 8:5996975-5996997 GATGAAGAGCTGGCCAGTGGGGG - Intergenic
1036437919 8:8752698-8752720 TCTAAAAATCAGGCCAGGTGTGG + Intergenic
1036523853 8:9517181-9517203 TATAGTAAGCAGGCCAGGTGCGG - Intergenic
1036755968 8:11471361-11471383 TCAGAAGAGCTGGGCAGGTGAGG + Intronic
1036806994 8:11841960-11841982 TATAAACATTAGGCCAGGTGTGG + Intergenic
1036929774 8:12944389-12944411 TATATAGAAGAGGCCAGGTGTGG + Intergenic
1036974097 8:13390695-13390717 TAAGAAAAACAGGCCAGGTGTGG + Intronic
1037149261 8:15616285-15616307 TCAGAATATCAGGCCAGGTGTGG + Intronic
1037403331 8:18515613-18515635 TCTGAAGAGCAGGCCACTGGGGG + Intergenic
1037602229 8:20406731-20406753 TATAAACAGCTGGCCTGGTGTGG - Intergenic
1037605743 8:20435744-20435766 TGTGAAGTCCTGGCCAGGTGAGG + Intergenic
1037800204 8:22029432-22029454 GATGAGAATCAGGCCAGGTGCGG - Intronic
1038290595 8:26246557-26246579 AATGAAGAGCTGGCCAGGTGTGG + Intergenic
1038374777 8:27028726-27028748 AATGAAGAGGAGGCCAGGCACGG - Intergenic
1038423903 8:27452278-27452300 TGAGAATAGAAGGCCAGGTGTGG + Intronic
1038549034 8:28449611-28449633 CAAGAAGATCAGGCCAGGTGTGG - Intronic
1038558831 8:28550780-28550802 AATGAAGAATAGGCCAGGCGTGG - Intronic
1038565559 8:28617488-28617510 AATGAAGATCAGGCCAGGCATGG + Intronic
1038749367 8:30281688-30281710 TTTGAAAAGCAGGCCGGGCGCGG + Intergenic
1038765308 8:30422558-30422580 AAATAACAGCAGGCCAGGTGAGG - Intronic
1039481654 8:37878242-37878264 TGTAAAGATCAGGGCAGGTGCGG + Intronic
1039533254 8:38283811-38283833 TTAGAAAAACAGGCCAGGTGTGG + Intronic
1039675934 8:39667089-39667111 TATAAAAATGAGGCCAGGTGTGG + Intronic
1039782877 8:40804548-40804570 TATTAAGACCAGGCCAGGAGCGG + Intronic
1039956864 8:42214504-42214526 TAACAACACCAGGCCAGGTGAGG + Intergenic
1039957678 8:42219747-42219769 TTTAAAAAACAGGCCAGGTGTGG + Intergenic
1039985017 8:42439794-42439816 AATGAAGTTGAGGCCAGGTGTGG + Intronic
1042124961 8:65529039-65529061 TATTAAAAGCATGCCAGGCGTGG + Intergenic
1042248963 8:66737117-66737139 TAAGAATATCGGGCCAGGTGTGG - Intronic
1042263012 8:66879300-66879322 AATGAAAAGCTGGCCAGGCGCGG + Intronic
1042415797 8:68516928-68516950 TAAGAAAAGCAGGCAGGGTGTGG - Intronic
1042563256 8:70089535-70089557 TAAGATGAGCTGGCCGGGTGTGG - Intergenic
1042986475 8:74589351-74589373 ATTGTAGACCAGGCCAGGTGTGG - Intergenic
1043195676 8:77288517-77288539 TATCAAGGGCAAGCCAGGTGTGG - Intergenic
1043332432 8:79133940-79133962 TAGAGAAAGCAGGCCAGGTGTGG + Intergenic
1043967716 8:86497803-86497825 TACAAAAACCAGGCCAGGTGCGG + Intronic
1044339654 8:91032488-91032510 AATGAAGCACAGGCCAGGCGCGG + Intronic
1044544408 8:93443799-93443821 CAAGAAGTACAGGCCAGGTGCGG + Intergenic
1044950481 8:97431184-97431206 TATAAGGACCAGGCCGGGTGCGG - Intergenic
1045015756 8:98000306-98000328 TATGGATAACAGGCCAGGTGCGG + Intronic
1045292763 8:100847997-100848019 TAAGAAGTCCTGGCCAGGTGCGG + Intergenic
1045446342 8:102268492-102268514 TAGGAAGATAAGGCCGGGTGCGG - Intronic
1045477449 8:102565298-102565320 TGTAATGATCAGGCCAGGTGTGG - Intergenic
1045526410 8:102944363-102944385 AATGGAGAACAGGCCGGGTGTGG + Intronic
1045553025 8:103189650-103189672 GAGGAAGAGCATTCCAGGTGGGG + Intronic
1046461484 8:114542744-114542766 AATGAAGGGAGGGCCAGGTGTGG + Intergenic
1046789574 8:118306623-118306645 TAGGAAGAGCAGGGCTGGGGTGG - Intronic
1047268429 8:123330650-123330672 TATGAAGATAGGGCCAGGCGCGG - Intronic
1047362931 8:124185395-124185417 TATCAAGGGGAGGACAGGTGGGG + Intergenic
1047725076 8:127677181-127677203 AAAACAGAGCAGGCCAGGTGCGG - Intergenic
1048593691 8:135844807-135844829 TACAAAGAGCAGGACAGATGTGG + Intergenic
1049319414 8:141988037-141988059 TCTGAAGGGAAGGCCAGGTGCGG - Intergenic
1049810548 8:144567029-144567051 AATGAAAATGAGGCCAGGTGTGG + Intronic
1050458283 9:5854815-5854837 TAATAAGACCAGGCCGGGTGTGG - Intergenic
1050488030 9:6155723-6155745 TAAGAAGAACAGGCTGGGTGTGG + Intergenic
1050676007 9:8053714-8053736 TATGCTGGGCAGGCCAGGTTGGG + Intergenic
1051135644 9:13917057-13917079 TCTGTTGAGCAGGCCAGGTGTGG - Intergenic
1051154218 9:14122956-14122978 TAAGAAAAGCAGGCCAGGCATGG + Intronic
1051470303 9:17432727-17432749 AATGAGGATCAGGCCAAGTGTGG + Intronic
1052906343 9:33837708-33837730 AAACAAGAACAGGCCAGGTGTGG - Intronic
1053191065 9:36069247-36069269 TATGAAGAGCAGGCCGGGTGCGG + Intronic
1053193635 9:36097031-36097053 TATGCAAAAAAGGCCAGGTGTGG + Intronic
1053205466 9:36182634-36182656 TAGAATGAGTAGGCCAGGTGTGG + Intergenic
1053367442 9:37533253-37533275 ATTGAAAAACAGGCCAGGTGTGG + Intronic
1053479267 9:38403849-38403871 GGTTAAGAACAGGCCAGGTGCGG - Intergenic
1053800116 9:41758672-41758694 TATGAAGGGCAGCCGAGGAGGGG - Intergenic
1054145076 9:61556163-61556185 TATGAAGGGCAGCCGAGGAGGGG + Intergenic
1054188544 9:61970824-61970846 TATGAAGGGCAGCCGAGGAGGGG - Intergenic
1054392201 9:64625938-64625960 AAGGCAGACCAGGCCAGGTGCGG + Intergenic
1054464772 9:65487120-65487142 TATGAAGGGCAGCCGAGGAGGGG + Intergenic
1054649977 9:67617793-67617815 TATGAAGGGCAGCCGAGGAGGGG + Intergenic
1054859066 9:69931099-69931121 TCTGAAGAGCAGGCAATGTTAGG + Intergenic
1055040366 9:71864507-71864529 TATGAAGACTGGGCCAGGGGCGG - Intronic
1055229074 9:74039935-74039957 TATGAATACAGGGCCAGGTGTGG + Intergenic
1055505948 9:76949232-76949254 TATTATGAGTAGGCCAGATGTGG - Intergenic
1055529320 9:77168063-77168085 TAAGAAGACTAGGCCAGGTGTGG - Intergenic
1055674311 9:78639823-78639845 TTTTAAAAGCTGGCCAGGTGGGG + Intergenic
1055789501 9:79907938-79907960 TAAAAAGACCAGGCCAGGTAAGG + Intergenic
1056300076 9:85231618-85231640 TAAGAAAAAGAGGCCAGGTGCGG + Intergenic
1056416039 9:86377033-86377055 TATCAAGGCCGGGCCAGGTGTGG - Intergenic
1056943314 9:90973553-90973575 TATGAAAATTAGGCCAGGTGCGG - Intergenic
1057117243 9:92537164-92537186 TAAGAATTTCAGGCCAGGTGCGG - Intronic
1057183788 9:93044564-93044586 CATCAAGAACAGGCCAGGTGCGG + Intergenic
1058060641 9:100492172-100492194 AAGAAAGAGGAGGCCAGGTGCGG - Intronic
1058484399 9:105428992-105429014 TATGAATAACCGGCCGGGTGTGG - Intronic
1058555234 9:106159826-106159848 TAAGAAGACCAGGCCTGGCGCGG + Intergenic
1058680338 9:107435156-107435178 TACGAAGTGCAGGCAGGGTGCGG - Intergenic
1058715687 9:107720201-107720223 TCAGAATAGCAGGCCGGGTGCGG - Intergenic
1058803941 9:108571880-108571902 AATGGAGAGGAGGCCAGGAGCGG + Intergenic
1059075668 9:111191305-111191327 GATGAATAGGAGGCCAGGTGAGG + Intergenic
1059175405 9:112165698-112165720 AATGAAGTGTATGCCAGGTGTGG - Intronic
1059230411 9:112716330-112716352 AATGAATAGCAGGCCGGGAGCGG - Intronic
1059279801 9:113122992-113123014 TAAGAAAAGCCGGCCAGGCGTGG + Intergenic
1059285837 9:113170847-113170869 TATCAAGGGCAGGCAAGCTGTGG + Intronic
1059475108 9:114540312-114540334 TATGCAAAGGAGGCCGGGTGCGG + Intergenic
1059535608 9:115077478-115077500 TATGATGAGGAGGCCGGGCGTGG - Intronic
1060010258 9:120037588-120037610 TATGAAAAGCATCCCAGGTTAGG - Intergenic
1060382361 9:123188348-123188370 TCTCAAGACTAGGCCAGGTGCGG + Intronic
1060569837 9:124628316-124628338 AATCAAAGGCAGGCCAGGTGCGG - Intronic
1060642178 9:125248332-125248354 TATGAAGAGCTGGCCGGGCGCGG + Intergenic
1060657367 9:125381123-125381145 TCTGGAGAGCAGGCCAGCTGGGG + Intergenic
1060730893 9:126036342-126036364 AATGAATAGATGGCCAGGTGCGG + Intergenic
1061122603 9:128653246-128653268 TACCAAGAGTAGCCCAGGTGAGG + Intronic
1062259936 9:135656496-135656518 TATTAAAAGCTGGCCAGGCGCGG + Intergenic
1062413494 9:136436402-136436424 TAGTAACAGCAGGCCAGGGGCGG + Intronic
1062748203 9:138230373-138230395 TATAGATAGCAGGCCAGGTGTGG - Intergenic
1185639059 X:1576421-1576443 TATGCAGAGCAGGCCATGCAGGG - Intergenic
1185675523 X:1846008-1846030 TATAAATATCTGGCCAGGTGCGG - Intergenic
1185953642 X:4464758-4464780 AATGGAATGCAGGCCAGGTGTGG + Intergenic
1186437473 X:9555367-9555389 AATAAAAAACAGGCCAGGTGTGG - Intronic
1186535202 X:10339972-10339994 TATGATGAGTAGGCAAGGTGGGG + Intergenic
1186735932 X:12463915-12463937 CATGAAAAACAGGCCAGGTTCGG - Intronic
1186768525 X:12794767-12794789 TATGACTAGCAGTCCAGGGGAGG - Intronic
1186825433 X:13335059-13335081 TATGAAGATCTGGCCGGGCGTGG - Intergenic
1187019174 X:15362156-15362178 AAAGAAAATCAGGCCAGGTGTGG - Intronic
1187079839 X:15974617-15974639 TGTGCAAAGCAGGCTAGGTGGGG - Intergenic
1187137683 X:16563976-16563998 TATGTATAACAGGCCGGGTGTGG - Intergenic
1187164310 X:16790490-16790512 TAAAAAGATCAGGCCAGGTGTGG - Intronic
1187347907 X:18483708-18483730 TAAGATGATGAGGCCAGGTGAGG - Intronic
1187482463 X:19670371-19670393 CATGCAGAGCAAGCCAGCTGTGG - Intronic
1187503655 X:19861084-19861106 TAAAAACAGCAGGCCAGGCGCGG + Intronic
1187889200 X:23917706-23917728 TATGATGAGAGTGCCAGGTGTGG - Intronic
1188001301 X:24984948-24984970 TAAAAAGTGCAGGCCGGGTGCGG - Intronic
1188414249 X:29913149-29913171 TTCTGAGAGCAGGCCAGGTGAGG - Intronic
1189112655 X:38309535-38309557 TGTTAAGGTCAGGCCAGGTGTGG + Intronic
1189129364 X:38482153-38482175 TATGAAGAGCATTCCAGGTGAGG + Intronic
1189393803 X:40602358-40602380 AAAGAAGAGGAGGCCGGGTGCGG + Intronic
1189399976 X:40658380-40658402 ACTGAAGTGCAGGCCGGGTGCGG - Intronic
1189441800 X:41043276-41043298 TAGAAAGAAGAGGCCAGGTGCGG + Intergenic
1189716740 X:43874760-43874782 TCTGAAGAACAGTCCAGGTTTGG - Intronic
1189790686 X:44600732-44600754 TATGAAGGGCAGGCCGGGCACGG - Intergenic
1190007115 X:46750638-46750660 TATGAAGATCAGGCTGGGTGTGG - Intronic
1190096795 X:47487796-47487818 TTTAAACAGCAGGCCAGGCGTGG - Intergenic
1190225738 X:48543523-48543545 TTCAAAAAGCAGGCCAGGTGCGG - Intronic
1190710567 X:53065807-53065829 TAACAAATGCAGGCCAGGTGCGG + Intronic
1190823771 X:53998161-53998183 AAAGAAAGGCAGGCCAGGTGTGG + Intronic
1190833160 X:54077399-54077421 AATGGGGAACAGGCCAGGTGTGG + Intronic
1191786038 X:64917883-64917905 CATGACAAGCAGGCCTGGTGAGG + Exonic
1191857168 X:65636444-65636466 AATGAAAAGCAGGCTGGGTGTGG + Intronic
1191881642 X:65848621-65848643 TAAGAAGAGCAGGGAGGGTGTGG + Intergenic
1192327067 X:70142040-70142062 AGAGAAGAGTAGGCCAGGTGTGG + Intronic
1192415160 X:70973176-70973198 TAAGAAGAGGAGGCCAGGCAGGG + Intergenic
1193110411 X:77723988-77724010 TATGATCAGCAGGCCAGGCACGG + Intronic
1193224502 X:78966190-78966212 TATGATGATCTGGCCGGGTGTGG - Intergenic
1193379563 X:80802813-80802835 AATGTCAAGCAGGCCAGGTGCGG + Intronic
1193685270 X:84570456-84570478 TATGAAGGGCAAGAGAGGTGAGG + Intergenic
1194751829 X:97693842-97693864 TAAGAAGAAAAGGCCAGGTGTGG - Intergenic
1194765454 X:97842889-97842911 TATGTAGGTCACGCCAGGTGAGG - Intergenic
1194817746 X:98464802-98464824 AATGAAAAGCAGGCCGGGCGTGG - Intergenic
1195125213 X:101802218-101802240 TCTGCAGAGAAGGCAAGGTGAGG - Intergenic
1195179527 X:102343431-102343453 TCTGCAGAGAAGGCAAGGTGAGG + Intergenic
1195255988 X:103091693-103091715 TAAGAAGATTAGGCCAGGCGCGG + Intronic
1195640740 X:107172031-107172053 TAAAAAGATGAGGCCAGGTGTGG + Intronic
1196229439 X:113203954-113203976 TATAAAAAGCAGGCTAGGTGTGG - Intergenic
1196651835 X:118175802-118175824 TAAGAAAAATAGGCCAGGTGTGG - Intergenic
1197365280 X:125557629-125557651 TATGATGATCTGGCCAGGCGCGG + Intergenic
1197427792 X:126319757-126319779 TAAGGAGGGCTGGCCAGGTGTGG + Intergenic
1198245083 X:134822845-134822867 TATGTACAACAGGCCAGGCGCGG + Intronic
1198453894 X:136796018-136796040 AAGCAAGTGCAGGCCAGGTGTGG - Intergenic
1199550524 X:149056740-149056762 TAGGAAGAGCAGGCAGGCTGAGG + Intergenic
1199606685 X:149584389-149584411 ATTGGAGAGCAGTCCAGGTGAGG - Intronic
1199632438 X:149784979-149785001 ATTGGAGAGCAGTCCAGGTGAGG + Intronic
1199727107 X:150594398-150594420 TATAAGGAACAAGCCAGGTGTGG - Intronic
1201381008 Y:13378982-13379004 TATTAAGACCAGGCCTGGTGGGG - Intronic
1201525408 Y:14927497-14927519 AATAACTAGCAGGCCAGGTGTGG - Intergenic
1202378137 Y:24256333-24256355 CATGAGGAGCCGGCCAGGTGTGG - Intergenic
1202492645 Y:25413788-25413810 CATGAGGAGCCGGCCAGGTGTGG + Intergenic