ID: 950119937

View in Genome Browser
Species Human (GRCh38)
Location 3:10475036-10475058
Sequence GCAGAAGCCCAGGCTGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 303}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950119937_950119942 13 Left 950119937 3:10475036-10475058 CCAGTTTCAGCCTGGGCTTCTGC 0: 1
1: 0
2: 1
3: 42
4: 303
Right 950119942 3:10475072-10475094 AGAGGAAGGACGGTTAAGAGAGG 0: 1
1: 0
2: 2
3: 31
4: 341
950119937_950119944 17 Left 950119937 3:10475036-10475058 CCAGTTTCAGCCTGGGCTTCTGC 0: 1
1: 0
2: 1
3: 42
4: 303
Right 950119944 3:10475076-10475098 GAAGGACGGTTAAGAGAGGGAGG 0: 1
1: 0
2: 2
3: 81
4: 1057
950119937_950119946 27 Left 950119937 3:10475036-10475058 CCAGTTTCAGCCTGGGCTTCTGC 0: 1
1: 0
2: 1
3: 42
4: 303
Right 950119946 3:10475086-10475108 TAAGAGAGGGAGGAGGTGAGCGG 0: 1
1: 2
2: 14
3: 177
4: 1544
950119937_950119939 -5 Left 950119937 3:10475036-10475058 CCAGTTTCAGCCTGGGCTTCTGC 0: 1
1: 0
2: 1
3: 42
4: 303
Right 950119939 3:10475054-10475076 TCTGCACTGAACAGACTCAGAGG 0: 1
1: 0
2: 3
3: 14
4: 194
950119937_950119940 -1 Left 950119937 3:10475036-10475058 CCAGTTTCAGCCTGGGCTTCTGC 0: 1
1: 0
2: 1
3: 42
4: 303
Right 950119940 3:10475058-10475080 CACTGAACAGACTCAGAGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 254
950119937_950119947 28 Left 950119937 3:10475036-10475058 CCAGTTTCAGCCTGGGCTTCTGC 0: 1
1: 0
2: 1
3: 42
4: 303
Right 950119947 3:10475087-10475109 AAGAGAGGGAGGAGGTGAGCGGG 0: 1
1: 1
2: 18
3: 169
4: 1531
950119937_950119941 3 Left 950119937 3:10475036-10475058 CCAGTTTCAGCCTGGGCTTCTGC 0: 1
1: 0
2: 1
3: 42
4: 303
Right 950119941 3:10475062-10475084 GAACAGACTCAGAGGAAGGACGG 0: 1
1: 0
2: 3
3: 70
4: 614
950119937_950119945 20 Left 950119937 3:10475036-10475058 CCAGTTTCAGCCTGGGCTTCTGC 0: 1
1: 0
2: 1
3: 42
4: 303
Right 950119945 3:10475079-10475101 GGACGGTTAAGAGAGGGAGGAGG 0: 1
1: 0
2: 2
3: 45
4: 514
950119937_950119943 14 Left 950119937 3:10475036-10475058 CCAGTTTCAGCCTGGGCTTCTGC 0: 1
1: 0
2: 1
3: 42
4: 303
Right 950119943 3:10475073-10475095 GAGGAAGGACGGTTAAGAGAGGG 0: 1
1: 0
2: 2
3: 24
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950119937 Original CRISPR GCAGAAGCCCAGGCTGAAAC TGG (reversed) Intronic
900078626 1:837913-837935 GGACAAGCACAGGCTGAAGCAGG - Intergenic
900530256 1:3149528-3149550 GCAGAGGCCCAGGCGGAGTCTGG - Intronic
900947076 1:5837103-5837125 GCAGAAGTCCTGGAAGAAACAGG + Intergenic
901236681 1:7671000-7671022 GCAGCACCCCAGGCTGAATCAGG - Exonic
901863406 1:12088897-12088919 GCTGAAGCCCAGGATGAAGAGGG - Intronic
901971436 1:12912075-12912097 GCAGAAGCCCAGGGAGGAGCTGG + Intronic
902013732 1:13289665-13289687 GCAGAAGCCCAGGGAGGAGCTGG - Intergenic
902421768 1:16286362-16286384 GCAGAAGCCAAAGGAGAAACAGG + Intronic
902881729 1:19376015-19376037 GCAGAAGTCCAAGATGAAACTGG + Intronic
903812569 1:26043055-26043077 GCAGAACCCAAGTCTGAAATTGG - Intronic
903836087 1:26204052-26204074 GAAGAAGTCCTGGCTCAAACAGG - Intergenic
904026238 1:27505324-27505346 GCAGAAGCTGAGGCTGCAGCTGG - Intergenic
904028450 1:27519556-27519578 GCAGAGGGCCAGGCTGGGACAGG - Intergenic
904305354 1:29585372-29585394 GCAGAAACCCAGGCAGACAGGGG + Intergenic
904334164 1:29786274-29786296 GCCCAAGGCCAGGCTGAAGCAGG - Intergenic
904343340 1:29852331-29852353 GCAGAAACCCAGGCAGACAGGGG + Intergenic
904887660 1:33753381-33753403 GCAGCAGCCCAAGCTGTATCTGG - Intronic
905305724 1:37016513-37016535 GCAGAAACCTAGAGTGAAACAGG + Intronic
905471011 1:38191712-38191734 GCAGAAGGCCAGATTCAAACAGG - Intergenic
906980362 1:50622375-50622397 GCTGAAGCCAAGGCTGAAAAGGG - Intronic
912615677 1:111097425-111097447 GCAGCAGCCCAAGCTGTATCTGG + Intergenic
914516682 1:148380018-148380040 GCAGAGGCACAGGCTGGATCTGG + Intergenic
915367723 1:155324898-155324920 GCAGAAGCCCAGAGTGGGACTGG + Exonic
915724140 1:158005848-158005870 GCAGAACCCCAGGCTGTAGAGGG + Intronic
916246795 1:162696520-162696542 CCAGAGGCTCAAGCTGAAACAGG - Intronic
917794288 1:178521586-178521608 CCAGAAGCCAAGGGTGAAAAGGG - Intronic
918796641 1:188906755-188906777 GCAGATGTCCAGGATGAAAAAGG - Intergenic
918863452 1:189862872-189862894 GCAGAAGCCCAACCTGAAAAGGG - Intergenic
918950054 1:191125692-191125714 ACAGAAGCCGAGGCTGAAGAGGG + Intergenic
919075362 1:192807282-192807304 GGATAAGCCCAGGCTCTAACTGG + Intergenic
920161982 1:204005609-204005631 GCAGAAGGCGAGGCTGCAGCAGG - Intergenic
920932782 1:210404537-210404559 GCAGAGCTCCAGGCTGAAGCTGG - Exonic
922323292 1:224506399-224506421 GCAGAAGCCAAGGCTGAAGGAGG - Intronic
922363395 1:224843128-224843150 TCAGAAGCCCATGCTGTAGCAGG + Intergenic
922467518 1:225854288-225854310 GCAGAAGACAAGGCTGAAAGGGG + Intronic
923462819 1:234221805-234221827 GGAGAAGCCCAGGCTGCAAGAGG - Intronic
924534191 1:244919938-244919960 ACAGGAGCCCTGGCTGAAAGTGG - Intergenic
1063397669 10:5706448-5706470 GCACAAGCCCAGATTGAAGCTGG + Intronic
1063625896 10:7689649-7689671 CCAGTGGCCCAGGCTGAAAGAGG - Intergenic
1064006007 10:11699696-11699718 CCGGGAGCCCACGCTGAAACTGG + Intergenic
1064055523 10:12094043-12094065 ACAGAAGACCAAGCCGAAACAGG - Intronic
1066695875 10:38077111-38077133 GCAGCAGCCCAAGCTGCACCTGG + Intergenic
1067455969 10:46419478-46419500 GGAGAAGCCAAGGCTGGAAAAGG + Intergenic
1067631231 10:47965161-47965183 GGAGAAGCCAAGGCTGGAAAAGG - Intergenic
1070700721 10:78599874-78599896 ACTGAAGCCCAGGATGAAAAAGG + Intergenic
1072611775 10:97021941-97021963 GCAGAAACCGAGGCTCAAAAAGG + Intronic
1072619345 10:97069234-97069256 CCAGGAGCCCAGGCTGACATGGG + Intronic
1075814953 10:125257813-125257835 GCACAAGCGGAGGCAGAAACTGG - Intergenic
1076556271 10:131323290-131323312 GCAGAAGCCCAGGAGGAAAGAGG + Intergenic
1076778656 10:132711728-132711750 GCACAAGTCCAGGCTAAGACAGG - Intronic
1077081887 11:728017-728039 TCAGAGGGCAAGGCTGAAACTGG + Intergenic
1077178619 11:1202592-1202614 GGAGGAGCCCAGGCTGAGCCGGG + Intergenic
1078457455 11:11486293-11486315 TCAGAAGCCCATGCTGCATCAGG + Intronic
1078508080 11:11966702-11966724 GCAAAAGCCCAGTCTGGAATGGG - Intronic
1078789133 11:14525497-14525519 TTAGAAGCCCATGCTGTAACAGG - Intronic
1079118432 11:17656361-17656383 GCAGGCTCCCAGGCTGAACCTGG + Intergenic
1079737330 11:24013154-24013176 GCAGTAGCCCAAGCTGTAACTGG - Intergenic
1080646326 11:34190544-34190566 GCAGGAGTCCAGGGAGAAACAGG + Intronic
1083923784 11:65794025-65794047 GCAGAAGCCCAGGCTGACTGGGG - Exonic
1086504081 11:87484799-87484821 GAAGAGGTCCAGGATGAAACTGG - Intergenic
1087966599 11:104422790-104422812 GGAGAAGCCCAAGCGGGAACCGG - Intergenic
1088237787 11:107743582-107743604 GCAGAGGCCCAGGATGACAGGGG + Intergenic
1089184231 11:116604002-116604024 GCAGAGCCCCAGGCAGAACCTGG + Intergenic
1089511580 11:119001501-119001523 ACACAAATCCAGGCTGAAACGGG - Intronic
1089597825 11:119592940-119592962 GCTGAAGCCCAAACTGAAAGAGG + Intergenic
1089812560 11:121143865-121143887 CCAGTAGCCCAGGCTAAAGCTGG - Intronic
1091401956 12:186527-186549 GCAGCAGCCCTGGCTGACACAGG - Intergenic
1091885836 12:4016398-4016420 GCAGCAGCCCAGATAGAAACAGG + Intergenic
1092294971 12:7190136-7190158 GCAGAGGCGCAGGCTGGAAGCGG + Intronic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1092764075 12:11836834-11836856 GAAGATGCTCAGGCAGAAACAGG - Intronic
1095998125 12:48106267-48106289 GAAAAAGCCCAGACTGAAAAGGG - Intronic
1096535176 12:52267443-52267465 GCAGAAGGCCAGGCAGTACCAGG + Intronic
1096747418 12:53737998-53738020 CCAGAAGCCTATTCTGAAACCGG + Intergenic
1098839114 12:75457954-75457976 TCACAAGGCCAGGGTGAAACTGG + Intergenic
1099190238 12:79554365-79554387 GGAGAGGCCCAGGCAGGAACCGG - Intergenic
1099872940 12:88370716-88370738 TTAGAAGCCCATGCTGTAACAGG - Intergenic
1102531945 12:113553174-113553196 GCAGACGCCCAGGCCGCAATGGG - Intergenic
1102937219 12:116907802-116907824 CCCCAAGCCCAGGCTCAAACTGG - Intergenic
1103521082 12:121537406-121537428 GCCGAGGCCCAGGCGGAAGCCGG - Intronic
1103629515 12:122248308-122248330 GAAGAAGGCCAGGCTGAGACAGG + Intronic
1104017597 12:124971194-124971216 GCAGCAGCCCAGGGTACAACGGG + Intronic
1104986901 12:132602587-132602609 ACAGCAGCCCAGGCTGAAAACGG + Intergenic
1108151821 13:47543959-47543981 GCAGAAGTCCAGGCACAAAAGGG - Intergenic
1109091508 13:58052156-58052178 GCAGCAGCCCAAGCTGTACCTGG - Intergenic
1109976257 13:69836359-69836381 GCAGAAATCCAGGCAGAAAATGG + Intronic
1111479930 13:88811080-88811102 GCAGCAGCCCAAGCTGTACCTGG - Intergenic
1112412551 13:99176798-99176820 GCAGAAGCCGAGGTAGAACCGGG - Intergenic
1112572399 13:100605939-100605961 GCAGAAGACCAGGCTGGAAGGGG + Intronic
1113015400 13:105823078-105823100 GCAGAAGCCAGGGCTGAGCCAGG - Intergenic
1113779488 13:112968200-112968222 GCAGAAGCTGAGGCAGAAGCAGG - Intronic
1114594741 14:23901894-23901916 AGAGCAGCCCAGGCTGAGACTGG + Intergenic
1115121379 14:29941736-29941758 GCAGCAGCCCAAGCTGTACCTGG - Intronic
1116997236 14:51336511-51336533 GCAGAAGCCAAGGGTGGGACTGG - Intergenic
1117285542 14:54282825-54282847 GCAGTAGCCCAGGTTGCAATAGG + Intergenic
1118102254 14:62619913-62619935 GCAGAAGCCCAAGCTGTATCAGG + Intergenic
1119061144 14:71476086-71476108 GCAGATGCTCCTGCTGAAACTGG + Intronic
1119774434 14:77239680-77239702 GCAGAAGCACAGGCGGGCACAGG - Exonic
1120245053 14:81996399-81996421 GCAGAAACCCAAGCTGACAAAGG - Intergenic
1123813711 15:23955188-23955210 GCAGAGGGCAAGGCTGACACTGG + Intergenic
1124025931 15:25965527-25965549 ACAGAAGACGAGGCTGACACGGG - Intergenic
1124683604 15:31758866-31758888 GTTGAAGCCCAGGCTAAATCAGG - Intronic
1128236208 15:66069061-66069083 GCAGAAGCTGAGGCTGAGAGAGG - Intronic
1131112551 15:89774604-89774626 GCAGAAGCTCAAGCTCAAACAGG + Intronic
1131608694 15:93937956-93937978 GCGGAATCCCAGCCTGAAACAGG + Intergenic
1131693813 15:94854792-94854814 GCTGAAGCCCATGCTGGAAAGGG - Intergenic
1132210824 15:100020922-100020944 GGAGAAGCCCAGGAGGAAGCAGG - Intronic
1132878557 16:2150864-2150886 GCAGGAGCTCAGGCTGAAGGAGG + Intronic
1132894779 16:2223656-2223678 GCAGAAGCCCAGGCCGAAGCCGG + Exonic
1133854827 16:9539776-9539798 CCAGAAGGCCAGTTTGAAACAGG + Intergenic
1134133457 16:11665232-11665254 GCAGAGGGCCAGGCTGGTACAGG + Intergenic
1134599691 16:15523644-15523666 GGGGAAGCCGAGGCTGAAACAGG - Intronic
1134762203 16:16724264-16724286 GCAGGAGCAAAGCCTGAAACAGG - Intergenic
1134983857 16:18634906-18634928 GCAGGAGCAAAGCCTGAAACAGG + Intergenic
1137285713 16:47014278-47014300 GCAGAAGCGCATCCTGAAACAGG + Intergenic
1137566164 16:49533738-49533760 GCAGATGCCCAGGGTGACACTGG + Intronic
1138310849 16:56022662-56022684 GCAGAAGCCCAGGCTTCATCTGG + Intergenic
1138676132 16:58652864-58652886 TCAGAAGCTCAGGCTGACAAAGG - Intergenic
1138984527 16:62311753-62311775 GGAGGAGCCTAGTCTGAAACAGG - Intergenic
1141142384 16:81505132-81505154 GCAGAAGCACATGTTGAGACGGG - Intronic
1143455987 17:7068122-7068144 GCAGTAGCCCAAGCTGTACCTGG + Intergenic
1144221230 17:13101653-13101675 GAAGAAGGCCAGGCTAAAATCGG - Intergenic
1145018687 17:19414318-19414340 GGAGAACCCCAGGCTGCAAAAGG + Intronic
1146504117 17:33389972-33389994 GCTGAGGCCCAGCCTGAGACTGG + Intronic
1148598142 17:48873262-48873284 GCAGAAGGTCAGGCTGGACCAGG + Intergenic
1150702753 17:67461993-67462015 GCAGAAGCCCTTCCAGAAACAGG - Intronic
1151122414 17:71807987-71808009 GCAGATCCCAAGGCTGAAAGGGG + Intergenic
1151890844 17:76949592-76949614 GGAGAAGCCCAGAGTGAAAAGGG - Exonic
1152809006 17:82372306-82372328 GCAGAAGCCGAGGGTGCACCGGG - Intergenic
1153946474 18:10022588-10022610 GCATAAACACAGGCTGAACCTGG + Intergenic
1156360238 18:36378306-36378328 ACAGAACCACAGGCAGAAACAGG - Intronic
1156729223 18:40170104-40170126 GCAGAAACCGAGGCTGAAAAGGG + Intergenic
1157286728 18:46382061-46382083 ACAGATGCCCAGGCTGAGGCAGG - Intronic
1157815327 18:50725696-50725718 GGAGAAACCCAGGCTGAGGCTGG + Intronic
1158462641 18:57660024-57660046 GCATAAGCCCAAGGTGACACCGG + Intronic
1158597370 18:58828041-58828063 GTAGAAGCACAGGCGGGAACCGG - Intergenic
1160127952 18:76195815-76195837 GCAGAGGCCAAGGCTCAAGCAGG + Intergenic
1160496953 18:79381355-79381377 GCAGAAGCCCAGGAGGAAGGGGG + Intergenic
1160842918 19:1154485-1154507 GCTGCAGCCCAGGCTGGGACCGG - Intronic
1164146216 19:22514193-22514215 GCAGAAGTCCAGGCTAAATCTGG + Intronic
1165040936 19:33066904-33066926 GCCGAGGCCGAGGCTGAGACTGG + Intergenic
1165837993 19:38771003-38771025 GCAGAAGCCCAGGCGGGCCCGGG - Exonic
1165841572 19:38791694-38791716 GCAGAAGCCCAGGCGGGCCCGGG + Exonic
1166872057 19:45876951-45876973 GAGGAGGCCCAGGCTGAAAGAGG + Intergenic
1166914753 19:46187666-46187688 GCACAACCTCAGGCTTAAACGGG - Intergenic
1168490126 19:56802199-56802221 CCAGGAGCCCAGGCTGACACTGG + Intronic
1168640164 19:58025864-58025886 GGAGAAGCCCAGCCTGAGGCTGG + Intergenic
925246655 2:2389341-2389363 GCAGCAGCTCAAGCTGTAACTGG + Intergenic
926116573 2:10217453-10217475 GCTGAACCCCAGCCTGGAACTGG - Intergenic
926671648 2:15582312-15582334 GAAAAAGCCCAGGCTGCAGCTGG + Intergenic
927182566 2:20457293-20457315 GCAGAGGCCCAGGGTGAATCTGG - Intergenic
927679711 2:25131641-25131663 GAGGAAGCCCAGGCTGGAAGGGG + Intronic
927855309 2:26523968-26523990 GCACAGGCCCAGGCTGACACAGG - Intronic
927991289 2:27449149-27449171 AGAGAAGCTCAGTCTGAAACTGG - Intronic
931323075 2:61191545-61191567 GCAGAGGCACAGGCTGTGACTGG - Intronic
931502637 2:62887126-62887148 GTATAAGCCTAGGCTGAAAATGG - Intronic
932924091 2:75950919-75950941 GCATAACCCCAGGTAGAAACAGG - Intergenic
935626212 2:105174265-105174287 GGAAAAGGCAAGGCTGAAACTGG + Intergenic
935762924 2:106338099-106338121 GCAGAAGCCCACACTCCAACAGG - Intergenic
937163740 2:119792967-119792989 TCACAAGGCCAGGGTGAAACTGG + Intronic
937251765 2:120528366-120528388 GCAAAAGCCGAGGCTGGAAAGGG + Intergenic
938540001 2:132278087-132278109 TCTGACGCCCAGGCTGAAGCTGG - Intergenic
939125377 2:138171945-138171967 GCAGCAGCCCAAGCTGTACCTGG - Intergenic
940183837 2:150961345-150961367 TTAGAAGCCCATGCTGTAACAGG - Intergenic
944091064 2:195912492-195912514 GCAGAAGGCCCATCTGAAACAGG + Intronic
944931264 2:204522552-204522574 GCAGAAGTCAAGGCTCAAAGAGG - Intergenic
945724553 2:213460080-213460102 GCAGAAGACCATGAAGAAACAGG - Intronic
947654138 2:231811708-231811730 GCAGAATCCCAGGAAGAAACAGG - Intergenic
947835736 2:233173961-233173983 ACATTAGCCTAGGCTGAAACAGG + Intronic
947889651 2:233605699-233605721 GCAGCAGCCCAAGCTGTATCTGG + Intergenic
947915449 2:233829351-233829373 GCAGAGGCCCAGGGTGACACAGG - Intronic
948209872 2:236185009-236185031 GCAGCAGCCCAAGCTGTACCTGG - Intergenic
948677265 2:239604103-239604125 GGGGAAGCCCAGGGAGAAACCGG + Intergenic
948911938 2:241009278-241009300 GCAGCAGCCCAGGCTGGAGATGG + Intronic
1169322554 20:4645462-4645484 GCAGCAGCCCAAGCTGTACCTGG + Intergenic
1169899140 20:10535143-10535165 GCAGAAGGCCAGGCTGGAGCAGG + Intronic
1170930848 20:20768439-20768461 GGAGAAGCGCAGGCGGGAACCGG + Intergenic
1172764048 20:37341676-37341698 GCAGAAGGCCTGGCTCACACAGG - Intergenic
1173111206 20:40192302-40192324 TCACAAACCCAGGCTGACACTGG + Intergenic
1173420804 20:42899315-42899337 ACAGAAGGACAGGCTTAAACTGG + Intronic
1173622748 20:44449169-44449191 TCAGATGCCCAGGCAGAAGCCGG - Intergenic
1174187779 20:48719365-48719387 GCCTAAGCACAGGCTGACACAGG + Intronic
1175405417 20:58722881-58722903 GCAAAAGCCCAGGCTGGAGTGGG + Intergenic
1175979380 20:62729399-62729421 TCAGAAGCACAGCCTGAGACAGG + Intronic
1176667120 21:9697967-9697989 GCTGAACCCCAGGCAGAAGCCGG - Intergenic
1176845909 21:13876203-13876225 GCAGCAGCCCTGGCTGTTACAGG - Intergenic
1177255914 21:18662793-18662815 CCAGAAGCCCAGGCAGGAACAGG - Intergenic
1177515663 21:22148169-22148191 GCAGCAGCCCAAGCTGTATCTGG - Intergenic
1178442708 21:32611969-32611991 GCAGCAGCCGGGGTTGAAACGGG - Intronic
1179291600 21:40022683-40022705 GCAGAAGCAGAGGCAGAGACAGG - Intronic
1179507997 21:41854584-41854606 GGACAAGCCCATGCTGAAGCAGG - Exonic
1179553086 21:42155610-42155632 ACAGAAGCCCAGGCAGATAGTGG - Intergenic
1179563444 21:42231746-42231768 GCAGATGCTCAGGCTGAAGGGGG + Intronic
1182055231 22:27347903-27347925 ACCGAAGCCCAGGCTCAAAGAGG - Intergenic
1182577514 22:31283048-31283070 GCAGGAGCCCATGCAGACACTGG - Exonic
1183034805 22:35133608-35133630 GCAGAAGCCCAAGCTGGCAGCGG - Intergenic
1183073410 22:35411773-35411795 GGAGAAGCCCAGGCTAGAAATGG - Intronic
1183268212 22:36844059-36844081 GCAGAATCCCAGCCTTAGACTGG - Intergenic
1184390841 22:44202251-44202273 GTTGAAGCCAAGGCTGAGACTGG + Intronic
1185042981 22:48515184-48515206 GCAGGAGCCCAGGCTTGCACAGG + Intronic
950119937 3:10475036-10475058 GCAGAAGCCCAGGCTGAAACTGG - Intronic
952139146 3:30459042-30459064 GCAGCAGCCTAAGCTGTAACTGG - Intergenic
952346058 3:32486913-32486935 GCAGAAGGCGAGGCGGAAGCAGG - Intronic
953129341 3:40123527-40123549 ACAGCAGCCCAGGCTGAAGCAGG + Intronic
954334519 3:49908598-49908620 GCAGAAGCTCAGACTGAATATGG + Intronic
954463499 3:50640943-50640965 GAAGAAGCCCAGGGTGGAAAAGG - Intronic
954575669 3:51674711-51674733 GCAGAAGTCCAGGCTAAATCTGG - Intronic
956552655 3:70479079-70479101 CCACAAGGCCAGGGTGAAACTGG - Intergenic
956763113 3:72461061-72461083 GAAGAAGCCCCAGCTGAGACAGG + Intergenic
959386223 3:105711685-105711707 GGAGAAACCCAGAATGAAACAGG + Intronic
959631425 3:108511339-108511361 GAAGAAGCCCAGGCTGAAGGTGG + Intronic
959976913 3:112471228-112471250 GCAGCAGAACAGGCAGAAACAGG + Exonic
960012478 3:112848949-112848971 CCAGAGGCCCATGGTGAAACTGG - Intergenic
960150641 3:114245596-114245618 GCAGCAGCCCAAGCTGTACCTGG - Intergenic
960150776 3:114246645-114246667 GCAGAAGGCAAAGCTGGAACAGG - Intergenic
960932031 3:122861904-122861926 GCAGAATCTAATGCTGAAACTGG - Intronic
964172868 3:153791231-153791253 TTAGAAGCCTAGGCTGAAACAGG - Intergenic
964984742 3:162725195-162725217 TTAGAAGCCCATGCTGTAACAGG + Intergenic
968228856 3:196992561-196992583 GCCTGAGCCCAGGATGAAACAGG - Intronic
969417829 4:7072664-7072686 GCAGCTGCCCTGGCTGCAACAGG - Intergenic
969519445 4:7667413-7667435 GCAGAGGCCTAGGATGAAGCTGG - Intronic
970131595 4:12877123-12877145 GCAAAACCCCACGCTGAAGCTGG - Intergenic
972898389 4:43652911-43652933 GTATAAGCACAGGTTGAAACAGG + Intergenic
972988808 4:44798655-44798677 GCAGCAGTCCAAGCTGTAACTGG - Intergenic
973589737 4:52428907-52428929 TCAGAAGCCCAAGTTCAAACAGG + Intergenic
974147031 4:57961842-57961864 ACAGAAACCTAGCCTGAAACTGG + Intergenic
978974798 4:114856675-114856697 GCAGAATGCCAGGGTGATACTGG - Intronic
980177539 4:129365086-129365108 GGGGAAGCCCAGGCTGATTCTGG - Intergenic
981227461 4:142313549-142313571 GCAGCAGCCCAGGCTGACAGAGG + Intronic
982290863 4:153781326-153781348 GAAGCTGCCCAGGCTGAGACTGG + Exonic
982666711 4:158273792-158273814 GAAGAACCCAAGGCTGAAAGAGG - Intergenic
984116046 4:175682685-175682707 GCAGCAGCCCAAGCTGTATCTGG - Intronic
984571776 4:181403802-181403824 GCAGAAGGCAAGGGGGAAACAGG + Intergenic
984728625 4:183045078-183045100 GGAGACGCCCAGGCGGGAACTGG + Intergenic
985508114 5:296321-296343 GCAGAGGCCCAGGGTGAAGTGGG - Intronic
985739922 5:1609348-1609370 GCAGAGGCCCAGGGTGAAGTGGG + Intergenic
986169827 5:5306611-5306633 GCCGAAGCCCAGCCTGGAGCTGG + Exonic
986473635 5:8101065-8101087 GCAGAAACTTAGGCTGAAAGGGG + Intergenic
986869635 5:12031278-12031300 GCAGCAGCCCAAGCTGTATCCGG - Intergenic
987283557 5:16435337-16435359 GCAGTAGCCATGGCTGGAACTGG - Intergenic
987685790 5:21199108-21199130 ACACATGCCCAGGCTGAAGCTGG - Intergenic
989393295 5:40924763-40924785 GCAGCAGCCCAAGCTGTATCTGG + Intronic
989394859 5:40943168-40943190 CAAGAAGCCTAAGCTGAAACAGG + Intronic
990564985 5:57019656-57019678 TTAGAAGCCCATGCTGTAACAGG + Intergenic
991075686 5:62534147-62534169 GCAGAACCAGAGGCTGTAACTGG + Intronic
993198552 5:84782283-84782305 GCAGAAGCCCAAGCTATACCTGG + Intergenic
993309678 5:86313777-86313799 GCAGCAGCCATGGCTGAAAGGGG + Intergenic
994264287 5:97696476-97696498 GTAGAAAACCAGACTGAAACAGG - Intergenic
994925622 5:106114246-106114268 GCAGCAGCCCAAGCGGTAACTGG - Intergenic
996421111 5:123263756-123263778 GCATAAGCCCAGGCTGATGTTGG - Intergenic
997193774 5:131963700-131963722 GCAGAAGTCCAGTCAGAAAGTGG - Intronic
997710027 5:135996400-135996422 GCAGCAGCAGAGGCTGAAAGGGG - Intergenic
997713218 5:136023412-136023434 GCAAGAGCCCAGGCTGAGACTGG + Intergenic
998040001 5:138945822-138945844 GCAGGAGTCCAGGCTGATGCTGG - Intergenic
998117501 5:139549344-139549366 GGAGAGGCCCAGGCAGGAACTGG + Intronic
999009144 5:148015810-148015832 GCAAAACCCCAGGCTCAAAAGGG + Intergenic
1000631331 5:163594144-163594166 TCAGAAGGTCAGTCTGAAACAGG + Intergenic
1001944441 5:175767040-175767062 GCAGCAGCCCAAGCTGTATCTGG + Intergenic
1002312589 5:178323630-178323652 GCAGAAGCCCAGGCTTGCACTGG - Intronic
1002820910 6:723883-723905 CCAAAAGTCCAGGCTGAGACAGG - Intergenic
1002841870 6:913266-913288 TCAGCATCCCAAGCTGAAACCGG + Intergenic
1003346236 6:5270319-5270341 GCAGAAGCCAAGGGTGTAAGTGG - Intronic
1004704498 6:18111678-18111700 GCAGAAGCCTAGCCTGTAAGAGG - Intergenic
1004707088 6:18134611-18134633 GCAGAAGCCAGGGCTGGACCAGG + Intronic
1006738479 6:36291728-36291750 ACAGAAGCCCAGGACGAACCAGG + Intronic
1006802745 6:36769728-36769750 GCAGAAGCTGAGGCTCAGACGGG - Intronic
1006804233 6:36778026-36778048 GCAGAATCCCAGCCTGTAAGTGG + Intronic
1007062755 6:38956520-38956542 GGAGGAGCCAAGGCTGAGACCGG - Intronic
1007732369 6:43954879-43954901 CCAGAAGCCCAGGCTGCAGAGGG - Intergenic
1007850630 6:44799350-44799372 GCTGAAACCCAGTCTGAAACAGG - Intergenic
1008037225 6:46758658-46758680 GCCGATTCCCAGGCTGGAACAGG + Intronic
1008226184 6:48919847-48919869 GCAGCAGCCCAAGCTGTACCTGG - Intergenic
1008821625 6:55638954-55638976 GCAGCAGCCCAGGCAAACACAGG + Intergenic
1008901096 6:56616934-56616956 TTAGAAGCTCAGGCTGCAACAGG - Intronic
1010216427 6:73406406-73406428 GGAGTAGCCCAGACTGGAACAGG + Exonic
1011521145 6:88208370-88208392 TCAGAAGCCAGGACTGAAACAGG + Intergenic
1011711636 6:90060814-90060836 CTAGAATCCCAGGCTTAAACTGG + Intronic
1012977552 6:105796151-105796173 GCAGGAGTGCAGGCTGACACAGG + Intergenic
1013161833 6:107552584-107552606 GGAGAAGACCAGGCTGAACATGG - Intronic
1014115209 6:117662392-117662414 TTAGAAGCCCATGCTGTAACAGG + Intergenic
1014411368 6:121125821-121125843 GAAGAAGCCAGGGCTGAGACTGG + Intronic
1014460289 6:121686772-121686794 GGAGAGGCCCAGGCGGGAACCGG - Intergenic
1014787015 6:125630903-125630925 GCAGAGGCCCAGGGTGAAGTGGG + Intergenic
1014892360 6:126858221-126858243 GCTCAAGCCCAGGCTGAAGAAGG + Intergenic
1015246805 6:131084194-131084216 GCAGAAGGCCAGGATGGATCTGG + Intergenic
1016730291 6:147421127-147421149 ACAGAATCCCAGGCAGAAGCAGG - Intergenic
1017011367 6:150065932-150065954 GCAGAGGCTCAGACTGGAACTGG - Exonic
1017922677 6:158885704-158885726 GTAGAAGCCCATGCTGTAGCAGG + Intronic
1018112510 6:160549018-160549040 GCAGAAGGCAAGGGAGAAACAGG + Intronic
1018692109 6:166354814-166354836 GCAGAAGTCCAGGCATTAACTGG - Intergenic
1018787300 6:167118027-167118049 GCAGAAGGACAGACTGAAGCTGG - Intergenic
1018824244 6:167397392-167397414 GCAGCTGCCCAGGCTCAGACAGG - Intergenic
1018924538 6:168197238-168197260 GCACAGGCCCAGGCTGGACCTGG + Intergenic
1019842266 7:3459459-3459481 GCAGAAAGGCAGGCAGAAACTGG - Intronic
1020028981 7:4919983-4920005 GCACAAGCCCTGCCTTAAACAGG - Intronic
1021180231 7:17497461-17497483 CCTGATGCCCAGGCTGAACCTGG - Intergenic
1022497836 7:30864435-30864457 TCAGAAGCCCAGGCTTTAAGAGG + Intronic
1022875299 7:34521604-34521626 GCAGAAGGCAAAGCTGAAGCAGG - Intergenic
1026802929 7:73411157-73411179 GCCCAAGCCCAGGCTGGCACTGG + Intergenic
1027158455 7:75784962-75784984 TTAGAAGCCCATGCTGTAACAGG - Intronic
1027246185 7:76369210-76369232 ACAGGAGCCCAGGCTGCACCGGG + Intergenic
1031350711 7:120727740-120727762 GCAGATGTCCAGGGTGAAAAAGG + Intronic
1032657188 7:133943827-133943849 GCAGTAGCCAAGCCTGAAACAGG - Intronic
1033102849 7:138490693-138490715 GAAGAAGCCCAGGTTTGAACTGG - Intronic
1033563937 7:142560554-142560576 GCAGAAGCCCAGCCTGATGATGG - Intergenic
1033564326 7:142563868-142563890 GCAGAAGCCCAGCCTGATGATGG - Intergenic
1033763423 7:144461658-144461680 GCAGAAGGCAAGGCAGAAGCAGG - Intronic
1035527018 8:321832-321854 GGACAAGCACAGGCTGAAGCAGG + Intergenic
1036597074 8:10223655-10223677 CCAGAAGCCCAGACAGATACTGG + Intronic
1037410514 8:18591141-18591163 CAAGAAACCCACGCTGAAACAGG + Intronic
1037711798 8:21360969-21360991 GCAGATGCCAAGGCAGAACCGGG - Intergenic
1038312557 8:26455639-26455661 GCAGAAACTCAGGTTGAAAGGGG + Intronic
1039340779 8:36647507-36647529 GGAGAAGCCCAGGAAGAAGCAGG + Intergenic
1040583452 8:48716345-48716367 GGAGAGGCGCAGGCTGGAACCGG - Intronic
1044040125 8:87356988-87357010 GCAGTAGCCCATGCTGTATCTGG - Intronic
1048270681 8:133025807-133025829 GCAGAATCCTAGGCTGAGGCTGG - Intronic
1049344192 8:142129687-142129709 GCAGAAGCTCAGGCTCAGAAAGG + Intergenic
1049450950 8:142661216-142661238 GCAGAAGGCCAGGCTGGCACAGG + Intronic
1053067398 9:35078302-35078324 GCAGGGGCCCAGGTTGGAACAGG - Exonic
1056316393 9:85394752-85394774 GCTTAAGCCCAGGGGGAAACTGG - Intergenic
1057046922 9:91893198-91893220 ACAGAACCCCAGGCTGAAGCTGG + Intronic
1057675974 9:97136191-97136213 GCAGCAGCCCATGCTGTCACAGG - Intergenic
1057851778 9:98571711-98571733 ACAGCAGGCCTGGCTGAAACTGG + Intronic
1057885293 9:98825003-98825025 GCTGAAGCCAAGTTTGAAACTGG - Intronic
1058812301 9:108652795-108652817 GGAAAAGCCCAGGCAGAGACAGG + Intergenic
1058876588 9:109250030-109250052 GCAGAAGAGCAGGCAGGAACTGG + Intronic
1060149959 9:121282183-121282205 GGAGAAACCGAGGCTGAAGCTGG - Intronic
1060236016 9:121863093-121863115 GCAGGAGCCCAGGAGGAAGCAGG - Intronic
1061922017 9:133787660-133787682 GCAGAAGCCTCAGCTGAAGCAGG + Intronic
1062026050 9:134341329-134341351 CCAGAACCCCAGGCTGGAAGTGG - Intronic
1062278456 9:135741532-135741554 GCAGAACCCCAGGCTTAATGGGG - Intronic
1203658976 Un_KI270753v1:23795-23817 GCTGAACCCCAGGCAGAAGCCGG + Intergenic
1185843906 X:3419116-3419138 GCAGAAGCTGAGGCTTAACCAGG - Intergenic
1186623230 X:11263677-11263699 CCAGCAGCCCAGGCAGAGACTGG + Intronic
1186939573 X:14490326-14490348 GCAGAAGGGAAGGCTAAAACTGG + Intergenic
1187358015 X:18596869-18596891 GCAGAAGCACAGGATGATTCGGG - Intronic
1187558477 X:20376004-20376026 GCAGAAACCAAGGCTCAAAGAGG - Intergenic
1189899442 X:45690663-45690685 GCAGCAGCCCAAGCTGTATCTGG - Intergenic
1190881683 X:54496120-54496142 GCCGAGACCCAGGCTGAAGCTGG - Exonic
1193656625 X:84206285-84206307 GCAACAGCACAGGCTTAAACTGG + Intergenic
1194002555 X:88449831-88449853 CAAAAAGCCAAGGCTGAAACAGG - Intergenic
1195325001 X:103751332-103751354 GTAGAAATCAAGGCTGAAACAGG - Intergenic
1196684598 X:118499702-118499724 CAAGAAGCCCAAGTTGAAACTGG - Intronic
1198228688 X:134669768-134669790 GCGGAAGACAAGGCTGAAGCGGG + Intronic
1199228570 X:145408851-145408873 GCAGTTACCCAGGTTGAAACAGG + Intergenic
1200819693 Y:7569874-7569896 GCAGAAGCTGAGGCTTAACCAGG + Intergenic
1201481004 Y:14439601-14439623 GCAGAATCCCAGGCTGAGTCAGG - Intergenic