ID: 950121496

View in Genome Browser
Species Human (GRCh38)
Location 3:10485024-10485046
Sequence CTGTGAAAGGGGCTGGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 271}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950121486_950121496 -6 Left 950121486 3:10485007-10485029 CCTGACGCAGACCCCCTCTGTGA 0: 1
1: 0
2: 1
3: 7
4: 115
Right 950121496 3:10485024-10485046 CTGTGAAAGGGGCTGGTTGAGGG 0: 1
1: 0
2: 0
3: 27
4: 271
950121484_950121496 20 Left 950121484 3:10484981-10485003 CCTGGCACTGACAGGCCTTAAGC 0: 1
1: 0
2: 0
3: 12
4: 119
Right 950121496 3:10485024-10485046 CTGTGAAAGGGGCTGGTTGAGGG 0: 1
1: 0
2: 0
3: 27
4: 271
950121485_950121496 5 Left 950121485 3:10484996-10485018 CCTTAAGCTGACCTGACGCAGAC 0: 1
1: 0
2: 0
3: 1
4: 58
Right 950121496 3:10485024-10485046 CTGTGAAAGGGGCTGGTTGAGGG 0: 1
1: 0
2: 0
3: 27
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950121496 Original CRISPR CTGTGAAAGGGGCTGGTTGA GGG Intronic
900404510 1:2486517-2486539 CAGTGGGAGGGGCTGGATGAGGG + Intronic
900908540 1:5577749-5577771 CTGTGAAAGTAGCTGGGTGGGGG - Intergenic
901150752 1:7099640-7099662 CTGGGGGAGGGGCTGGTTAATGG + Intronic
901799817 1:11701569-11701591 TTGTGAAAGGGGCCGGCTGTGGG + Intronic
902395008 1:16127781-16127803 TTGTGAAAGGGCCTGGATAAAGG - Intronic
905275360 1:36814130-36814152 CTGTGGGAGGTGCTGCTTGATGG + Intronic
906760703 1:48374879-48374901 CTCTGAAAGAGGCAGGTTAATGG - Intronic
907271216 1:53292350-53292372 AAGGGAAAGGGGCTGGCTGAGGG + Intronic
907337865 1:53712175-53712197 CTGTGCAAAGGCCTGGTAGAAGG - Intronic
908674080 1:66582133-66582155 CTGGGAAAGAGGTTGGTTGTGGG + Intronic
910537047 1:88310279-88310301 CTGTGAACTGGGATGGTTAATGG - Intergenic
911830950 1:102550859-102550881 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
913330109 1:117660004-117660026 CTTTGGAAGGGGCTGGCTGAGGG - Intergenic
913466357 1:119147233-119147255 CTGGGGAAGGGGCTGGCGGAGGG - Intergenic
917035947 1:170746943-170746965 TAGGGAAAGGGGCTGCTTGAAGG + Intergenic
920029675 1:203028980-203029002 CTGTGGAAGGGGCTGCTTCTAGG + Intronic
920131624 1:203736595-203736617 AGGTGGAAGTGGCTGGTTGAAGG - Intronic
922613270 1:226945347-226945369 CTGTTCACGGGGCTGGATGAGGG + Intronic
922707436 1:227796710-227796732 CTATGTAAGGGGCTGGGTGGAGG + Intergenic
923537434 1:234863875-234863897 CTGCCAAATGGGCTGGGTGAAGG - Intergenic
1062783929 10:244555-244577 CTGCGAGAGTGGCTGGTGGATGG + Intronic
1063732401 10:8712876-8712898 GTGTGACAAGGGCTGGTTGATGG + Intergenic
1063978699 10:11436874-11436896 CTGGGAAAGTGGCAGGATGAAGG + Intergenic
1065277961 10:24105435-24105457 CTGTGAGATGGGCTGAATGAGGG - Intronic
1067145087 10:43688889-43688911 CTGGGAAAGGGGGAGGTTGCTGG + Intergenic
1067808943 10:49412253-49412275 CTGGGAATGGTGCTGGCTGAGGG - Intergenic
1068542897 10:58315100-58315122 GTGTGAAAGTGGATGTTTGATGG + Intergenic
1069132387 10:64722645-64722667 TTGGGAGAGGGGCTGGTTAATGG + Intergenic
1069605333 10:69735417-69735439 CTGTGGAAGGGGCTGGCTGCTGG - Intergenic
1069891083 10:71652862-71652884 CTGGGCCAGGGGCTGGTTCAGGG + Intronic
1069947825 10:71999709-71999731 CAGTGGAAGGGCCTGGTTGGAGG + Intronic
1070118932 10:73556886-73556908 CTGGGAATGGTGCTGGTAGAGGG - Intronic
1070492457 10:76990518-76990540 ATTTGCAAGGGGCTGGTTGCTGG - Intronic
1070788071 10:79173886-79173908 CTGTGCCAGGGTCTGGCTGAGGG - Intronic
1071151614 10:82641973-82641995 CTTGGAAAGGGGGAGGTTGAGGG - Intronic
1072564976 10:96609939-96609961 CTGTGAGAGAGGCAGGTGGAGGG - Intronic
1073349774 10:102811302-102811324 CCATGAAAGGGGCGGGTTGGGGG + Intronic
1076435839 10:130440707-130440729 CTGTGAGATGGACTGTTTGAGGG + Intergenic
1077200111 11:1302533-1302555 CTGTGAAGGGTGGTGGGTGAGGG - Intronic
1077308793 11:1879491-1879513 CTGTGAGCGGGGCTGGTGGTGGG + Intronic
1077348026 11:2073334-2073356 CTGAGAACGGGGGTGGTTGTCGG - Intergenic
1078829738 11:14968189-14968211 TTGTGAATGGGGCTGGGTGTGGG - Intronic
1081658776 11:44875084-44875106 CTCTGCAAGGGGCTGGTCCAAGG - Intronic
1083151322 11:60793573-60793595 GTGGGGAAGGGGCTGGATGAGGG + Intronic
1083203174 11:61132200-61132222 CTGGGAAAGGGGCCGGTGGCAGG + Exonic
1084349384 11:68584299-68584321 CTGGGAAAAGGGCTGCTTGCAGG - Intronic
1085377741 11:76082085-76082107 ATGAGAAAGGGGCTTGTGGAAGG + Intronic
1085948620 11:81302787-81302809 GTGTTAAAGGTGCTGGTTGAGGG + Intergenic
1087686854 11:101274737-101274759 CTGTGAATGAGCCTGGTGGAGGG + Intergenic
1088505568 11:110523459-110523481 CTGTGGAAAGGGGTGGGTGATGG + Intergenic
1089220999 11:116871570-116871592 GTGTGAAAAGGGCTGGTGGCAGG + Intronic
1090385280 11:126354916-126354938 CTGTGAAAGGGACTGGCCTAAGG + Intergenic
1091767894 12:3133786-3133808 CTGTGAAAATGGATGGATGACGG + Intronic
1091917948 12:4282723-4282745 CTGGGGAGGGGGCTGGTTGGAGG - Intronic
1092322166 12:7487714-7487736 CTGTGAAAGGGACAGGGTTAGGG - Intronic
1092599093 12:10039174-10039196 CTGTGCATGGGGATGGTTGTCGG + Intronic
1096647168 12:53045201-53045223 ATGTTAAAAGAGCTGGTTGAAGG + Intergenic
1096769602 12:53926530-53926552 CTCTGAATGGTGCAGGTTGATGG + Intergenic
1097360437 12:58653809-58653831 CTGTGAAAGCAGCTGGGTGAGGG - Intronic
1098522362 12:71447787-71447809 CTGTGGAACTGGCTGCTTGAAGG + Intronic
1098522745 12:71451906-71451928 CTGGGAAAGGGAGTGGTTGTGGG - Intronic
1101426609 12:104593365-104593387 CTGTGGGAGGGACTGGGTGAGGG + Intronic
1101860066 12:108475555-108475577 CTGTGCAGGGGGCTGGTTGTGGG - Intergenic
1102049984 12:109855420-109855442 CTGTGAATGGGGCTGGCCAAGGG + Intronic
1102639583 12:114355241-114355263 GCGTGAATGTGGCTGGTTGATGG + Exonic
1102678936 12:114677074-114677096 CTTTGAAAGGGGGTGGGGGAGGG + Intronic
1102950931 12:117030897-117030919 TTGTGAAAGGGTCTGGATAAAGG - Intronic
1103361842 12:120359163-120359185 CTGTGCAGGGAGCAGGTTGAAGG - Intronic
1103532488 12:121612047-121612069 CTGTGAAAGGGGAATATTGATGG - Intergenic
1103619038 12:122174694-122174716 CTGTGAATGTGGCGGGTCGAAGG + Intronic
1104071916 12:125353309-125353331 CAGTGATAGGGGCTGCCTGAAGG - Intronic
1106758418 13:32844854-32844876 CTGTGAAAGGGGGTGGATCTGGG - Intergenic
1106877359 13:34088470-34088492 CTGTGAAAGCAGCTGGGAGAGGG + Intergenic
1107479525 13:40773865-40773887 ATGTGAAAGTGCCTGGCTGAGGG + Intergenic
1111323277 13:86658751-86658773 CTGTGAAAGGAGCTGGGTTCAGG - Intergenic
1112652665 13:101416161-101416183 CTGCGAGAGGGGCTGCTAGAGGG - Intronic
1112825003 13:103382086-103382108 CTGTGAAAGGAGCTGGGAGGGGG - Intergenic
1113071577 13:106426607-106426629 CTGTGCCAGGGGCTTGTTGAGGG - Intergenic
1113075908 13:106467962-106467984 CTGTAAAAGGGAAAGGTTGAAGG - Intergenic
1113418967 13:110155136-110155158 CTTTGGAAGGGGATGGTTGGAGG + Intronic
1114471562 14:22966606-22966628 CTATGAAAGGGGGTGGAAGAAGG + Intronic
1117386440 14:55218472-55218494 CTGTAAAAGGTCATGGTTGAGGG + Intergenic
1117954599 14:61112784-61112806 GTGTGAATGAGGCTGGATGAGGG - Intergenic
1121315868 14:92960723-92960745 TGGTTAAAGGGGCTGGTGGAAGG + Intronic
1121708927 14:96022413-96022435 CTTGGAAAGGGGCTGATTTAGGG - Intergenic
1122539017 14:102486543-102486565 CTGTGGAAGGGGCAGTTTCATGG - Intronic
1123049315 14:105532947-105532969 CTGAGAAAGGGGCTGTCTGCAGG + Intergenic
1123193989 14:106599365-106599387 GGTTGAAAGGGGCTGGATGAGGG - Intergenic
1123469305 15:20538408-20538430 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1123648758 15:22462290-22462312 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1123666589 15:22613333-22613355 CTGTCAAAGTGCCAGGTTGAAGG + Intergenic
1123682552 15:22773147-22773169 CTGTGAAAGTGCCAGGTTGAAGG + Intronic
1123729579 15:23133395-23133417 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1123747746 15:23330877-23330899 CTGTCAAAGTGCCAGGTTGAAGG + Intergenic
1123751116 15:23359029-23359051 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1123762532 15:23443933-23443955 CTGTGAAAGTGCCAGGTTGAAGG + Exonic
1124239754 15:28019640-28019662 CTGTGGAGGAGGCTGGGTGAAGG - Intronic
1124280114 15:28354728-28354750 CTGTCAAAGTGCCAGGTTGAAGG + Intergenic
1124283491 15:28382947-28382969 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1124299207 15:28528666-28528688 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1124302586 15:28556883-28556905 CTGTCAAAGTGCCAGGTTGAAGG - Intergenic
1124320432 15:28707906-28707928 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1124334302 15:28845671-28845693 CTGTGAAAGTGCCAGGTTGAAGG + Intergenic
1124482082 15:30087504-30087526 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1124488540 15:30139604-30139626 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1124521508 15:30409699-30409721 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1124537153 15:30556520-30556542 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1124543627 15:30608576-30608598 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1124754988 15:32398718-32398740 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1124761496 15:32451071-32451093 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1124777135 15:32597997-32598019 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1124959701 15:34385207-34385229 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1124976327 15:34531428-34531450 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1125989986 15:44096768-44096790 TTGTGAAATGGGCTGGGTCAAGG - Intronic
1126942397 15:53780941-53780963 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
1127774724 15:62255833-62255855 CTGTCAAAGCAGCAGGTTGAAGG + Intergenic
1129029641 15:72609017-72609039 CTGTCAAAGTGCCAGGTTGAAGG - Intergenic
1129037580 15:72660051-72660073 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1129212307 15:74077174-74077196 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1129351816 15:74959657-74959679 CAGGGAAAGGGGCTGTATGAGGG + Intronic
1129361558 15:75027800-75027822 CTGTGATGGGGGGTGGTAGAGGG - Intronic
1129398090 15:75263905-75263927 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1129401701 15:75288186-75288208 CTGTCAAAGTGCCAGGTTGAAGG - Intronic
1129475293 15:75780893-75780915 CTGTCAAAGTGACAGGTTGAAGG - Intergenic
1129729436 15:77921492-77921514 CTGTCAAAGTGCCAGGTTGAAGG + Intergenic
1129839081 15:78732478-78732500 CTGTCAAAGTGCCAGGTTGAAGG - Intergenic
1130354885 15:83120192-83120214 ATGTGAAAGGTGCTGGTTTTTGG + Intronic
1132136898 15:99350483-99350505 CTATTAGAGAGGCTGGTTGAAGG - Intronic
1132939261 16:2498889-2498911 CTGTGAACGGTGCTGGGTGGGGG - Intronic
1134024989 16:10946539-10946561 CCGGGAAAGGGAGTGGTTGAAGG + Intronic
1134202255 16:12208942-12208964 CTTTGTTAGGGGCTGGTAGAAGG + Intronic
1134376573 16:13681181-13681203 CTGTGGAAGGCTCAGGTTGATGG + Intergenic
1137539072 16:49349715-49349737 CTGAGAAAGGGCCGGCTTGATGG - Intergenic
1142200559 16:88759321-88759343 CTCTGAAAGGGGCCGGGTGAGGG + Intronic
1143088770 17:4436115-4436137 CAGAGATAGAGGCTGGTTGATGG + Intronic
1143346990 17:6257089-6257111 CTGTGAAATGGGCATGATGAGGG - Intergenic
1143847880 17:9786882-9786904 CTGAGAAAGGGACACGTTGAGGG + Intronic
1144334213 17:14254828-14254850 CGGTGACAGGAGCTGGTGGATGG - Intergenic
1145945218 17:28768984-28769006 CTGTGAAATGGGCTGTATGAGGG + Intronic
1146285814 17:31573631-31573653 CTGGGAAGGGGGCTGGGTCAGGG - Intronic
1147161975 17:38573633-38573655 CTGTGATAGGGGTTGGATGATGG - Intronic
1147209513 17:38864042-38864064 CTGAGAAAGGGGCGAGTTTAGGG - Intergenic
1147461659 17:40576084-40576106 CAGTGGTAGGGGCTGGCTGATGG - Intergenic
1147729176 17:42586914-42586936 CTGTGAAAGGAGGGTGTTGAGGG + Intronic
1150341363 17:64370434-64370456 CTGTGAAACGTGCTGCTTCATGG + Intronic
1151543274 17:74776311-74776333 CTGGGAACGTGGCTGGTTGGAGG - Exonic
1152389316 17:79993279-79993301 CTTTGAAAGGGACTGGCTGGTGG - Intronic
1153694982 18:7630865-7630887 CTATGAAGGGGGATGGTTGCAGG + Intronic
1154132603 18:11750242-11750264 CTGAGAAAGGAGCAGGTAGAAGG + Intronic
1155332077 18:24728638-24728660 CTGTGATAGAGGCTGGGGGAAGG - Intergenic
1155852817 18:30793748-30793770 CTGTGAAAGAGGCATGTGGATGG - Intergenic
1157257695 18:46153248-46153270 CTGAGGAAGGGGCTGGGGGAGGG + Intergenic
1157392420 18:47313936-47313958 CTGTGCCAGGGGCTGGATGATGG - Intergenic
1157941160 18:51930322-51930344 CTGTGAAAGCAGCTGGTGGGGGG + Intergenic
1158275672 18:55764626-55764648 CTGTGAAAGGGGCTTCTTGTGGG + Intergenic
1160686538 19:439331-439353 CTGGGAAAGAGGGTGGTAGAGGG - Intronic
1160796344 19:947462-947484 CTGTGAAACGGGCTGGCGGCCGG + Intronic
1161292162 19:3500435-3500457 CTGTGGATGGGGCGGGTTAAGGG - Intronic
1161388483 19:4009137-4009159 ATGTGAAAGGGGATGGGGGAGGG - Intronic
1161746235 19:6061806-6061828 CTGAGAAAGGGGCTGGGAGGGGG + Intronic
1161937835 19:7382968-7382990 CTGTGACTGGGGCTGGTGGTGGG + Intronic
1164685503 19:30164004-30164026 ATGTGAATGGGGCTGGTGAAGGG - Intergenic
1167674893 19:50877882-50877904 CTGTGAGGGAGGCTGGGTGAGGG - Intronic
1168459455 19:56541178-56541200 CTGTGGGAGGAGCTGGTTTATGG - Intronic
926212028 2:10878436-10878458 CTGTGGAAGGTGCTGGCAGAGGG + Intergenic
928325992 2:30319965-30319987 CTGGAAATGGGGCTGGTAGATGG - Intronic
929542240 2:42831280-42831302 CTGGGGAAGGGGCTGGTGGTGGG + Intergenic
930328438 2:49950858-49950880 ATGTGAAAGTGGCTGTTTTAAGG - Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
937856068 2:126672730-126672752 CTGTGAAAGGAGGTGGATAAGGG + Intronic
940233084 2:151479112-151479134 CTGTGAACTGCGCTGGTAGATGG + Exonic
945357918 2:208860666-208860688 CTGTGAAAGCAGCTGGATTAGGG + Intergenic
946247955 2:218398029-218398051 CTGTGAAGGGGGCTGGTACCTGG - Intergenic
947386589 2:229596575-229596597 GTGTCAGAGGTGCTGGTTGATGG + Intronic
948763459 2:240207648-240207670 CTGGGATGGGGGCTGGGTGAGGG - Intergenic
1169710146 20:8551890-8551912 CTGTAAAAGGGTCTGCTTCAAGG + Intronic
1169771148 20:9202235-9202257 CTGTCAAAGGGGCAGCCTGAGGG + Intronic
1171501088 20:25593843-25593865 CTGTGAAGGAGGCTGGGTGAAGG - Intergenic
1172005786 20:31818551-31818573 CTGAGAAAGGCTCTGGGTGATGG + Intergenic
1173111803 20:40197939-40197961 GTGTGAAATGGGTTGGTTGCTGG + Intergenic
1173817653 20:46000162-46000184 CAGTGGAAGGGGCTGGATGCTGG - Intergenic
1174524329 20:51159192-51159214 CAGTGAAAGGGGCTGGATGCAGG - Intergenic
1175744864 20:61449109-61449131 CAGTGCCAGGGGCTGGGTGAGGG + Intronic
1181666135 22:24398856-24398878 CTGAGGAAGGGACTGGGTGAGGG - Intronic
1182145336 22:27993768-27993790 GTGTGGAAGGGGTTGGTTTAGGG - Intronic
1183307292 22:37089522-37089544 CTGGAAAAGGGAGTGGTTGATGG - Intronic
1183376221 22:37467089-37467111 TGGGGATAGGGGCTGGTTGAGGG + Intergenic
1183380398 22:37487828-37487850 CTGTGAAGGGGCCTGGCTGGGGG - Intergenic
1184186131 22:42866535-42866557 CTGTGAAAAGGGGTGGGGGAAGG + Intronic
949598341 3:5572021-5572043 CTGTGCAAGAGGCTGTTAGAAGG + Intergenic
949651385 3:6164078-6164100 ATGTGAAATGGGCTGCTTAATGG + Intergenic
949973791 3:9435292-9435314 CTGTGAAAAGAGCTGGCTGGGGG - Intronic
950121496 3:10485024-10485046 CTGTGAAAGGGGCTGGTTGAGGG + Intronic
950549968 3:13660280-13660302 CTGTGAAAGGGGCAGGTGTTGGG + Intergenic
950806057 3:15603961-15603983 CTGTGAAAGCAGCTGGGAGAGGG - Intronic
953103919 3:39856574-39856596 CTCTGGAAGGGGCTGCTTGTTGG - Intronic
953274884 3:41485099-41485121 CTGTGAAATGGAGTTGTTGAAGG - Intronic
954199262 3:49014498-49014520 CGGTGAGAGGGGCTGGATGATGG + Exonic
955059298 3:55482411-55482433 CTGTGGAAGGGGCTCCTTCAGGG - Intronic
955953405 3:64264244-64264266 CTGTGAAATAGGCTGGCTGATGG + Intronic
957267162 3:77982567-77982589 CTGTGAAAGGAGCCGGGGGAGGG - Intergenic
957843198 3:85698216-85698238 CTGTCAGAGGGGCTGGTCCAAGG + Intronic
961667012 3:128498870-128498892 CTGGGATAGGGGCAGGTTGGTGG - Intergenic
961863147 3:129934040-129934062 CTCTGAAAGGGGCTTGCTAATGG - Intergenic
965871401 3:173269534-173269556 ATGTGGAAGGGGATGGTTGAAGG + Intergenic
966314759 3:178633119-178633141 CTGTGAAAGGAGCTGGCGGGGGG - Intronic
966692155 3:182753279-182753301 CTGTGAATGGCCCTGGTTGGGGG - Intergenic
967929613 3:194681311-194681333 CTTTCAGAGGGGCAGGTTGAAGG + Intergenic
969561596 4:7951539-7951561 CTGGGAGAGGGGCTGGCTGCGGG + Intergenic
969632441 4:8346518-8346540 TTGCGAAAGGGGCTGGATGGAGG + Intergenic
971744883 4:30566707-30566729 CTGTGAAAGCAGCTGGGAGAAGG + Intergenic
971946086 4:33279150-33279172 CTGTGAAAGGGTCTGAGCGAAGG + Intergenic
971996866 4:33975849-33975871 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
973214076 4:47649194-47649216 CCGTGAAAGAGGCAGGATGAAGG + Intronic
977014034 4:91670161-91670183 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
977667324 4:99655883-99655905 TGTTGAAAGGGGATGGTTGATGG - Intergenic
981552996 4:145960642-145960664 GAGAGAAAGGAGCTGGTTGAAGG + Intergenic
982493416 4:156058803-156058825 ATGTGAAAGGTCCTTGTTGATGG + Intergenic
984649686 4:182257106-182257128 CACTGGAAGGGGCTGGTTAAGGG + Intronic
985225072 4:187751316-187751338 CTGTGAAAGCAGCTGGGTGGGGG + Intergenic
986393162 5:7303683-7303705 CTGTGAAAGTGCCAGGTTGAAGG + Intergenic
986970040 5:13322759-13322781 AGGTGAAGGGGGCTGGTGGATGG - Intergenic
987204486 5:15610866-15610888 CTGTAAATGGGGCTGGGTGGAGG - Intronic
987390243 5:17368554-17368576 CTTTGAAATGGGGTGGATGAGGG + Intergenic
987472533 5:18350907-18350929 CTGTGAAAGTGTCTGGGAGAGGG + Intergenic
988858504 5:35252662-35252684 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
990615749 5:57506044-57506066 CTGAGATAGGGGCTGGGAGAAGG + Intergenic
992412352 5:76518485-76518507 TTGTGGGAGGGGCTGGTTGGAGG - Intronic
993109653 5:83641630-83641652 CTGTGATGCGGGCTGGTTGGCGG - Exonic
994002011 5:94791871-94791893 CTGAGAAAGGTGCTGGAAGAGGG - Intronic
994090851 5:95808447-95808469 CTATGCAGGGGGCTGGATGAAGG + Intronic
994590704 5:101768719-101768741 CTGTGAAAGCAGCTGGGAGAGGG - Intergenic
997843964 5:137269253-137269275 CTGGGCAAGGGGTTGTTTGAAGG - Intronic
997977554 5:138449291-138449313 CTGGGAAAGAGGCTGGCTGGTGG + Intergenic
998153020 5:139768072-139768094 AGGGCAAAGGGGCTGGTTGATGG + Intergenic
999216370 5:149939010-149939032 CAGTGACTGGGGCTGGGTGAAGG - Intronic
1000115576 5:158150417-158150439 CTGTGGCAGTGGCTGGTTGGTGG - Intergenic
1001560677 5:172666927-172666949 CTGTAAAATGGGCTTGTTGGAGG + Intronic
1002163497 5:177331202-177331224 ATGTGCAAGGGGCTGGAGGATGG - Intergenic
1002934073 6:1656888-1656910 CTGGGGAAGAGGCTGCTTGAAGG - Intronic
1003233454 6:4275331-4275353 GTGTGTAAGGCACTGGTTGAAGG - Intergenic
1004435264 6:15586437-15586459 CAGTGAGAGTGGCTGATTGATGG - Intronic
1004772462 6:18799378-18799400 CTCTGAAAGTGGCTGGCAGAGGG - Intergenic
1006926299 6:37657353-37657375 CTGTGGAAGGGGCAGAATGATGG - Intronic
1007111896 6:39317650-39317672 CTGTGAAAGAGGAAGGGTGAAGG - Intronic
1007829607 6:44628371-44628393 CTCTGACAGGGGCTGGAGGAAGG + Intergenic
1009994964 6:70887501-70887523 CTGTGAGTGGGGCTGAGTGACGG - Intronic
1010459265 6:76095338-76095360 CTGTGAATCTGTCTGGTTGATGG - Intergenic
1011170998 6:84504176-84504198 CTGTGAAAGCAGCTGGGAGAGGG + Intergenic
1011227128 6:85119828-85119850 ATGTGAAAGGGAATGTTTGAGGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014256025 6:119160533-119160555 CTCTGCAAGGGGCTGGGAGAAGG - Intergenic
1019357354 7:587630-587652 CTGTGGAAGGGGCTGTGTGGTGG - Intronic
1019506549 7:1394290-1394312 CTGTAAAATGGGCTGCTTGGAGG - Intergenic
1020030066 7:4926443-4926465 CTCTGCAAGGGGCAGCTTGAAGG + Intronic
1020078631 7:5274821-5274843 TTGTCAAAAGGGCTGGGTGAAGG - Intronic
1022527504 7:31048078-31048100 CTGTGAAAGGGGGTGGTAAATGG + Intergenic
1023120393 7:36903082-36903104 CTGTGAGATGGGCAGGTAGACGG - Intronic
1025200260 7:56957363-56957385 CTGTCAAAAGGGCTGGGTGAAGG + Intergenic
1025279624 7:57617424-57617446 CTAGGCAAGGGGCTGGTTTATGG + Intergenic
1025305107 7:57848076-57848098 CTAGGCAAGGGGCTGGTTTATGG - Intergenic
1025671685 7:63619569-63619591 CTGTCAAAAGGGCTGGGTGAAGG - Intergenic
1026539698 7:71269093-71269115 CTGTTAAAGGGCCCGGCTGAGGG - Intronic
1027506415 7:79021377-79021399 CTGTGAAAGCGGCTGGGAGGGGG + Intronic
1033457722 7:141517687-141517709 CTGAGGAAGTGGCTGGATGAGGG + Intergenic
1033611829 7:142970620-142970642 CTGTCAGAGGTGCTGGTGGAGGG + Intergenic
1033648288 7:143321558-143321580 CTGTGGGTGGGGCTGGATGATGG - Intronic
1034639997 7:152594930-152594952 GCGTGACAGGGACTGGTTGACGG + Intergenic
1035115081 7:156517423-156517445 CTGTGAAGGAGGCTGTGTGAGGG + Intergenic
1041710069 8:60886391-60886413 CTGTGAATAGGGATGGTTGGAGG - Intergenic
1042227488 8:66525396-66525418 CCGAGTAAGGGGCTGGCTGAGGG - Intergenic
1043400183 8:79876960-79876982 CTGTGAAAGGGGCTGTTCTCTGG + Intergenic
1044879789 8:96712222-96712244 CTGTGAAAGCAGCTGGGAGAGGG - Intronic
1046561799 8:115847135-115847157 CTGTTAGAGGGGTTGGTTGGGGG - Intergenic
1047327087 8:123850231-123850253 CTGAGAAAGGGAAGGGTTGAGGG - Intergenic
1047349313 8:124058465-124058487 CTGTGAAATGGGTTGGTTGCTGG - Intronic
1048288774 8:133163822-133163844 CTGTGAAGGGGGCTAGAAGAGGG + Intergenic
1049377753 8:142297054-142297076 CTGTGAAGTGGGCAGGTGGAAGG - Intronic
1049602386 8:143513970-143513992 TTCAGAAAGGGGCTGGTGGAGGG - Intronic
1052292879 9:26864433-26864455 CTGAGGAAGGGGCTTGATGAGGG - Intronic
1053287028 9:36856193-36856215 CTCTGAAAGGGGCTGGCTCAAGG - Intronic
1055152583 9:73020465-73020487 CTGAGTTAGGGGATGGTTGAAGG + Intronic
1061063911 9:128265741-128265763 CTGTCAAAGTGCCAGGTTGAAGG + Intronic
1061507995 9:131042916-131042938 GTGTGAAAGGGGAGAGTTGATGG - Intronic
1061940252 9:133880155-133880177 GTGGGCAAGGGGCTGGTGGAGGG - Intronic
1186190869 X:7066426-7066448 GGGTGAAAGGGGCTGGTTTTGGG + Intronic
1186538558 X:10375120-10375142 TTGTGAAAGAGGCTGGTTTGAGG + Intergenic
1187852208 X:23602203-23602225 TTGTGAAAGGGGATGGAGGAAGG - Intergenic
1188120958 X:26306471-26306493 CTATGAAAGGGACTGGCTGAAGG + Intergenic
1189912472 X:45824931-45824953 CTTTGAAAAGGATTGGTTGAAGG + Intergenic
1190300140 X:49052768-49052790 CAGTGATAGGGGCTGTTGGAAGG + Intergenic
1191969720 X:66799577-66799599 CTGTGAAAAGGGGTGGCTGTGGG + Intergenic
1193628605 X:83851625-83851647 CTGTCGAAGGGGCTAGTTGGGGG + Intergenic
1193841986 X:86418155-86418177 CTGTGAAAGCAGCTGGGAGAAGG - Intronic
1195391617 X:104368205-104368227 CTTTGAAAGGAGCTGGATGTTGG + Intergenic
1197534877 X:127675186-127675208 CTGTCAATGGGGCTGGGAGAGGG - Intergenic
1197630194 X:128849437-128849459 CAGTGAAAGGAGCTTGTTGCAGG + Intergenic
1198322598 X:135533544-135533566 CTGTGAATGGGGGTGGGGGAAGG - Intronic
1199070361 X:143468840-143468862 CTGTGAAAGCAGCTGGGTGGGGG - Intergenic