ID: 950123479

View in Genome Browser
Species Human (GRCh38)
Location 3:10497050-10497072
Sequence CTGCTGACCTTGGGCAGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 12, 2: 4, 3: 36, 4: 364}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950123471_950123479 22 Left 950123471 3:10497005-10497027 CCAGGAGAGTGCTGGCTGGTGGG 0: 1
1: 0
2: 2
3: 26
4: 289
Right 950123479 3:10497050-10497072 CTGCTGACCTTGGGCAGCTGTGG 0: 1
1: 12
2: 4
3: 36
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950123479 Original CRISPR CTGCTGACCTTGGGCAGCTG TGG Intronic
900386804 1:2414367-2414389 CTGCTGTTCCTGGGCAGGTGGGG + Intergenic
900432221 1:2607761-2607783 CTGCTGGCCTGGGGAGGCTGTGG + Intronic
900919194 1:5660012-5660034 CTGCTGGCACAGGGCAGCTGAGG + Intergenic
901468409 1:9438696-9438718 CAGCTGACCTGGGGGAGCTGGGG - Intergenic
901610583 1:10494801-10494823 ATCCTGAGCGTGGGCAGCTGGGG + Intronic
901917021 1:12507747-12507769 CAGCTGACCTTGAGGAGCCGGGG + Intronic
902931808 1:19736664-19736686 CTCCTGGCCTTGGGTAGGTGAGG - Intronic
903012753 1:20342913-20342935 CTGCTTTCCTAGGACAGCTGCGG - Intronic
903173756 1:21568931-21568953 CTGCGGGCCTGGGGCAGCTGGGG + Intronic
903800321 1:25962466-25962488 CTAATGACCTTGGGCAACTCAGG - Intronic
905425382 1:37879515-37879537 CTACTGACTTTGGGAGGCTGAGG + Intronic
905792947 1:40799805-40799827 CTACTGAACATGGGAAGCTGAGG - Intronic
907450125 1:54541060-54541082 GTGCTGAGCTTGGCCACCTGGGG - Intergenic
907788316 1:57635803-57635825 CTGGTGTCCTTGGCCAGGTGCGG + Intronic
907837008 1:58119685-58119707 CTCCCGACCTGGGGCAGCTCTGG - Intronic
908513472 1:64869311-64869333 CTGATGTCCTTGGGCAGTTCTGG + Exonic
910055892 1:83032564-83032586 CCCATGACCTTGGGCAGCTCTGG - Intergenic
912906623 1:113714501-113714523 CTGCAGGCCTGGGGCAGCGGTGG + Intronic
913203595 1:116515929-116515951 CTCCTGCCCTCGCGCAGCTGGGG + Intronic
914339406 1:146746213-146746235 CTGCTGTCCATGGGCAGGGGAGG - Intergenic
915120289 1:153626312-153626334 CTGCCTACCTTGAGCAGATGGGG + Exonic
916407125 1:164508693-164508715 CACCTGAGCTTGGGAAGCTGAGG - Intergenic
916578145 1:166085303-166085325 CTGGGGACCCTGGGCAGCTCAGG + Intronic
918508445 1:185283346-185283368 CTGCTTACCCTGAGCAGATGAGG + Intronic
918852427 1:189709082-189709104 CTGCTGTCCTGGAGGAGCTGAGG - Intergenic
921604282 1:217137113-217137135 CTGCTGGCATTGGGCAGAGGTGG - Intronic
921766814 1:218982674-218982696 CTGCTAGCCCTTGGCAGCTGTGG - Intergenic
924384959 1:243491800-243491822 GTCCAGATCTTGGGCAGCTGAGG + Intronic
924709955 1:246523495-246523517 CTTCTGCCTTTGGGCAGTTGTGG - Intergenic
1064338419 10:14464851-14464873 CTCCTCACCTTGGGAGGCTGAGG - Intergenic
1064466282 10:15585443-15585465 CTGCTGTCCTGGTGCCGCTGGGG - Intronic
1065522488 10:26586189-26586211 CTGCTCTTCTTGGGCAGCTTGGG - Intergenic
1065528729 10:26647900-26647922 CTGCTCTTCTTGGGCAGCTTGGG - Intergenic
1066299543 10:34084715-34084737 CTGCTGGCCTGGGGGTGCTGTGG - Intergenic
1066566376 10:36725764-36725786 ATGCTGAGCTTGGACAGCTCAGG + Intergenic
1067222212 10:44352514-44352536 CAGCTGAGCCTGGCCAGCTGTGG + Intergenic
1067762015 10:49055545-49055567 CAGCTGACCTTGGGGAGAAGGGG - Intronic
1068121663 10:52786921-52786943 ATGCTGGCCTGGGGCAGGTGAGG - Intergenic
1068121676 10:52787008-52787030 ATGCTGGCCTGGGGCAGGTGAGG - Intergenic
1069659832 10:70116411-70116433 CTGGTCACCTTGGCCACCTGGGG + Intronic
1069995083 10:72336933-72336955 CTGCTGACCTGGGGCCTTTGGGG + Intronic
1070087933 10:73254861-73254883 CTGATGACATTGTGGAGCTGCGG + Intronic
1070653091 10:78252162-78252184 CTGCTGACCTTGGCCACCCAGGG - Intergenic
1070653721 10:78256373-78256395 CTCCTGACCTTGAGAACCTGGGG - Intergenic
1072445377 10:95494641-95494663 AGGCTGACCTTAGTCAGCTGTGG - Intronic
1073270849 10:102262604-102262626 CTGCAAACCTTGAGGAGCTGAGG + Intronic
1075021185 10:118953689-118953711 CTGCTGACCTGTGGCTGCTCTGG - Intergenic
1075234055 10:120710705-120710727 CTACTGACCCTGGGCCACTGTGG + Intergenic
1075736457 10:124667470-124667492 CTGCTGACTGTTGGCAGGTGAGG - Intronic
1076074384 10:127521788-127521810 AAGCTGGCCTTGGGCATCTGAGG - Intergenic
1076143252 10:128096365-128096387 CTGCTGACTTGGGGCAGCCCTGG + Intergenic
1076541949 10:131220253-131220275 CTCCTGACCTACGGCATCTGCGG - Intronic
1076687233 10:132203704-132203726 GGGCTGAGCCTGGGCAGCTGTGG - Intronic
1076877872 10:133225497-133225519 CAGCAGGCCTTGGGCACCTGGGG - Exonic
1077253261 11:1570057-1570079 CCGCTGGCCTGGGGAAGCTGTGG + Intronic
1077502633 11:2916276-2916298 CTCCTGACCTTGGCCAGCGTGGG + Intronic
1078402699 11:11042399-11042421 CTGATGACAATGGGCAACTGGGG + Intergenic
1078650257 11:13184685-13184707 CTGCTCTCCTTTGGCAGCCGAGG - Intergenic
1079075076 11:17380086-17380108 CTGCTGATCTCGGGGATCTGGGG + Intergenic
1079105233 11:17567593-17567615 CTCCAGTCCTTTGGCAGCTGAGG - Intronic
1079280247 11:19080746-19080768 CTGCTGACCTTGAGGGGATGTGG + Intergenic
1079391329 11:20024408-20024430 GAGCTGGCCTTGGGCTGCTGAGG + Intronic
1079979259 11:27131944-27131966 CTGCTGACCACAGTCAGCTGAGG + Intergenic
1080853014 11:36087825-36087847 CAGCTACTCTTGGGCAGCTGAGG - Intronic
1081775970 11:45676117-45676139 CTCCTGAACTTGGGCAGTGGAGG - Intergenic
1081786352 11:45750526-45750548 CTGCTGCCCCAGGGCAGATGTGG - Intergenic
1082932722 11:58625430-58625452 CTTCTGAACTTTGGAAGCTGGGG + Exonic
1083144354 11:60747934-60747956 CTCCTGCCATTGGGAAGCTGTGG + Intergenic
1084604210 11:70162867-70162889 CTGGGGACCTTGGGCAGCTGGGG - Intronic
1084654869 11:70509301-70509323 CTGCTCACATTGGGCAGCGCTGG - Intronic
1084708669 11:70830505-70830527 CAGGTGACCTTGGAGAGCTGGGG + Intronic
1085525487 11:77161282-77161304 CAGCTGACCTTGAGGAGGTGAGG - Intronic
1085642338 11:78200324-78200346 CTGCTGACCCTGGGCTCTTGGGG + Intronic
1088817700 11:113432999-113433021 CTGCAGACCTTGGGTTGCCGAGG + Intronic
1088854078 11:113730983-113731005 ATTCTGACCTTGGTCAGCTCCGG - Intergenic
1089419297 11:118319257-118319279 CTCCTCACCGTGAGCAGCTGAGG + Intergenic
1090164756 11:124535361-124535383 CTGCTGAGCTTGGGGTGCAGAGG - Intergenic
1090224884 11:125063753-125063775 TTTCTGTCGTTGGGCAGCTGGGG + Intronic
1092520946 12:9272163-9272185 TTGGTGCACTTGGGCAGCTGAGG + Intergenic
1094697012 12:32829742-32829764 CCGTTGAACTTGGGCAGCGGAGG - Intronic
1096199414 12:49671124-49671146 CTGCTGACAGTGGGTGGCTGAGG - Intronic
1096475384 12:51906539-51906561 CTGCTGACACAAGGCAGCTGGGG - Intergenic
1096524765 12:52203876-52203898 CAGCTGACCTTGGGGAGCGAGGG + Intergenic
1096772502 12:53945008-53945030 CTGCTCACCTCGGGCTGCAGGGG - Exonic
1097093066 12:56522784-56522806 GTGCTGTCCTTGGGCACATGGGG + Intronic
1097403061 12:59153178-59153200 CTGCTGACCTTGGGTCCCTGAGG + Intergenic
1098188323 12:67922095-67922117 CTGCTGACATTGTGCTGGTGTGG - Intergenic
1098849416 12:75577631-75577653 CTGCAGGCCTTGGGAAGCTTAGG - Intergenic
1101035986 12:100707022-100707044 ATGCTGACCTTCAGCAGATGTGG - Intergenic
1101746622 12:107546611-107546633 CTTCTGACCTTGGGAGGCTGAGG + Intronic
1101959032 12:109234195-109234217 CTGGCGACCTTGGGCAGATGTGG + Intronic
1102305334 12:111800298-111800320 CTCCTGCCCTGAGGCAGCTGGGG - Intronic
1103237592 12:119386222-119386244 CTGCTGAACATGGACAGATGAGG - Intronic
1103474557 12:121209343-121209365 CTCCTAAACTTGGGCAGCTGTGG - Intergenic
1103967893 12:124651937-124651959 CTGGTGACCTTGGACGGGTGGGG - Intergenic
1104769882 12:131354801-131354823 CTGCTGACCTGCTGCAGCTCTGG - Intergenic
1104910341 12:132237224-132237246 CAGGTGGCCTGGGGCAGCTGAGG - Intronic
1104974910 12:132548082-132548104 CTGCTGACCTTGGCCCTGTGAGG + Intronic
1107915266 13:45143599-45143621 CTGCTGAGCTTCGGAAGATGTGG - Intronic
1109942437 13:69388119-69388141 CTGCTGACCTGTGCCAGCTTGGG + Intergenic
1112206423 13:97328100-97328122 CTGCTGTTCTTGGGCACCTTGGG - Intronic
1112601526 13:100860165-100860187 CTGCACAGCATGGGCAGCTGGGG - Intergenic
1112749362 13:102566389-102566411 CTGGTGACTTTGGGGACCTGGGG - Intergenic
1113618841 13:111699540-111699562 CAGCTCCCCATGGGCAGCTGGGG + Intergenic
1113624370 13:111784801-111784823 CAGCTCCCCATGGGCAGCTGGGG + Intergenic
1113750281 13:112772321-112772343 GTGCTGACCTGGAGCGGCTGCGG + Intronic
1114062654 14:19033750-19033772 TTGCTGACCTTGAAAAGCTGTGG - Intergenic
1114099607 14:19366247-19366269 TTGCTGACCTTGAAAAGCTGTGG + Intergenic
1114667947 14:24391712-24391734 CTGGTGTCCTTGGGCAGCCAAGG + Intergenic
1115245135 14:31287086-31287108 CTGCTGTCCATGGACAGCTCAGG + Intergenic
1116920961 14:50573991-50574013 CTACTGAGCTGGGGTAGCTGGGG + Intronic
1117813714 14:59576410-59576432 CTCCTGCCCTAGCGCAGCTGAGG - Intronic
1118837058 14:69484912-69484934 CTGCTGACCCCGGGGAGGTGGGG + Exonic
1119729538 14:76942216-76942238 CTGCTGTCCTTAGCCAGCAGAGG + Intergenic
1120865814 14:89294337-89294359 TTGTTGACATTGGGCAGCTCTGG - Intronic
1121485943 14:94314401-94314423 ATGCTGTCCCTGGGCACCTGTGG - Exonic
1121492968 14:94372938-94372960 CTGCTGATCTGGGGCAGAGGAGG - Intergenic
1122552594 14:102557875-102557897 GCCCTGACCTTTGGCAGCTGCGG + Intergenic
1122958789 14:105085105-105085127 ATGATGGGCTTGGGCAGCTGTGG - Intergenic
1123072112 14:105646978-105647000 CTGCTCACCTGAGGCACCTGAGG + Intergenic
1123661861 15:22571677-22571699 GTCCTGGCCCTGGGCAGCTGGGG + Intergenic
1124023943 15:25947508-25947530 ATGCTGAGCTTGGACAGCTCGGG - Intergenic
1124262349 15:28203868-28203890 GTCCTGGCCCTGGGCAGCTGGGG - Intronic
1124315660 15:28665920-28665942 GTCCTGGCCCTGGGCAGCTGGGG + Intergenic
1125094448 15:35834848-35834870 AAGCTGACCTAGGGCACCTGAGG + Intergenic
1128089974 15:64912602-64912624 CAGCTGGCCTGGGGCAGCTTTGG + Intronic
1128649055 15:69397225-69397247 CTCCTGACCATGGGAAGCAGTGG - Intronic
1128759737 15:70208356-70208378 CTGTTAAGATTGGGCAGCTGAGG - Intergenic
1129368037 15:75069026-75069048 CTGCAGATGTTGGGCAGCAGGGG - Intronic
1131843269 15:96461234-96461256 CTGGTGAAATTGGGTAGCTGTGG - Intergenic
1132473255 16:118841-118863 CGTCTGTCCTTGGGCAGGTGGGG - Intronic
1132541935 16:514233-514255 TTGCTGACCTGGGGCTGCAGGGG - Intronic
1133231731 16:4370162-4370184 CCCCTGACCCTGGGCATCTGTGG + Intronic
1133739029 16:8637845-8637867 CTGCTGACCCTGGCCAGGCGTGG + Intronic
1134026122 16:10955363-10955385 GTGCTGACCTTGAGGAGCTCAGG + Intronic
1134672972 16:16069288-16069310 CAGCTGAGCTTGGGAAGTTGAGG + Intronic
1135158181 16:20072161-20072183 CTGCTCTCCTAGGGCAGCCGTGG + Intronic
1135640637 16:24116865-24116887 TTTCTGTCCTGGGGCAGCTGGGG + Intronic
1136783142 16:32919676-32919698 CTGCAGTCCTTGGATAGCTGGGG + Intergenic
1136886645 16:33934173-33934195 CTGCAGTCCTTGGATAGCTGGGG - Intergenic
1137445783 16:48531362-48531384 CTTCTGCCCTTGTGCAGCTGTGG - Intergenic
1138014410 16:53415699-53415721 ATGCTGAGCTTGGACAGCTGAGG + Intergenic
1138433916 16:56986512-56986534 CTGCTGACCTTGGGCAGGATGGG + Intergenic
1138510991 16:57508328-57508350 CTGCTGCCCCTGGGCTGCTGTGG + Intergenic
1138514603 16:57529119-57529141 AGGCTGCCCTTGGACAGCTGCGG + Exonic
1139568157 16:67792876-67792898 CTGGTGACATTGGGCACATGAGG - Intronic
1139641718 16:68296499-68296521 CTGCTGACCTTGAGAGGCCGGGG - Exonic
1139994869 16:70971134-70971156 CTGCTGTCCATGGGCAGGGGAGG + Intronic
1141386179 16:83624342-83624364 CTGCTGACCTGGGGCAGGGGTGG - Intronic
1142003694 16:87679116-87679138 CAGCTGAGCCTGGCCAGCTGGGG - Intronic
1142006440 16:87691564-87691586 CCCCTGACCTAGGGGAGCTGTGG + Intronic
1142046166 16:87926627-87926649 CTGCTTTCCTTGTGCTGCTGGGG - Intronic
1203085794 16_KI270728v1_random:1183661-1183683 CTGCAGTCCTTGGATAGCTGGGG + Intergenic
1143156872 17:4843045-4843067 CTCCTGGCCTTGGGTAGCTAAGG + Intronic
1143203757 17:5129458-5129480 CTTCTGCCCTTGGGCAGTTGTGG + Intronic
1143244137 17:5468735-5468757 CTGCTGACTGCGGGCAGCGGCGG - Exonic
1143253025 17:5536854-5536876 CTGCTGAAGATGAGCAGCTGAGG + Exonic
1143806435 17:9431583-9431605 CTGCTGCCCTTGGCCAGCCGCGG - Intronic
1144729491 17:17518349-17518371 CAGCTGAACTTGGCCAGCTTTGG - Intronic
1144737815 17:17564700-17564722 CTGTCCCCCTTGGGCAGCTGTGG - Intronic
1144857957 17:18280738-18280760 ATGTTGTCCTCGGGCAGCTGAGG - Intronic
1144874939 17:18392569-18392591 CTTCTGCCCTTGGGCAGTTGTGG + Intergenic
1145029966 17:19496912-19496934 CAGATTACCTTGGGCCGCTGAGG - Intronic
1145110176 17:20155757-20155779 CAGCCTACCTTGTGCAGCTGCGG + Intronic
1145157285 17:20551852-20551874 CTTCTGCCCTTGGGCAGTTGTGG - Intergenic
1145799456 17:27673717-27673739 CTTCTGCCTTTGGGCAGCTGTGG - Intergenic
1146159559 17:30552598-30552620 CTTCTGCCTTTGGGCAGCTGTGG + Intergenic
1146289801 17:31598980-31599002 CAGCTGAACTTGGGGAGGTGGGG + Intergenic
1146662663 17:34674969-34674991 CTGCTCACCCTGGGGACCTGGGG - Intergenic
1146844828 17:36175932-36175954 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1146857133 17:36263867-36263889 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1146863482 17:36324508-36324530 CTGCTGCCCTTGGGCAGCTGTGG + Intronic
1146873045 17:36387777-36387799 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1146880403 17:36438863-36438885 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1146937595 17:36822016-36822038 CTGCTTTCCTTGCTCAGCTGGGG + Intergenic
1147066342 17:37925096-37925118 CTGCTGCCCTTGGGCAGCTGTGG + Intronic
1147075928 17:37988402-37988424 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1147077875 17:38004657-38004679 CTGCTGCCCTTGGGCAGCTGTGG + Intronic
1147087453 17:38067948-38067970 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1147093811 17:38128592-38128614 CTGCTGCCCTTGGGCAGCTGTGG + Intergenic
1147103397 17:38191911-38191933 CTGCTGCCCTTGGGCAGCTGTGG - Intergenic
1147143402 17:38471857-38471879 CTGCAGTCCTTGGATAGCTGGGG + Exonic
1147276860 17:39325122-39325144 CACCTGACCCTGGGAAGCTGAGG + Intronic
1149406892 17:56361492-56361514 CATCTGACCTTTGGTAGCTGTGG + Intronic
1149569680 17:57663503-57663525 CTTCTGACCTTGGGGAGAAGAGG + Intronic
1149847971 17:60018380-60018402 CTGCTGCCCTTGGGCAGCTGTGG - Intergenic
1150086326 17:62274997-62275019 CTGCTGCCCTTGGGCAGCCGTGG - Intronic
1150212655 17:63449887-63449909 GCCCTGACCTTGGGCAGCAGAGG + Intergenic
1150924233 17:69515756-69515778 CAGGAGACCTGGGGCAGCTGTGG + Intronic
1151294465 17:73174346-73174368 CTCCTCATCTAGGGCAGCTGGGG - Intergenic
1151606303 17:75138656-75138678 CTGAGTACTTTGGGCAGCTGAGG - Intronic
1151745858 17:76011434-76011456 CTGCAGCCCCTGGGCAGCTCTGG - Intronic
1152103615 17:78316563-78316585 CCCCTGACCTTGGGCTGTTGGGG - Intergenic
1153319084 18:3753870-3753892 CTGTTGTCCTTGGGAATCTGTGG + Intronic
1155312944 18:24542326-24542348 ATGCTGAGCTTGGGAAGTTGTGG + Intergenic
1155429222 18:25738111-25738133 CAGCTGTCCCTGGGCAGATGAGG + Intergenic
1156700691 18:39820862-39820884 CTGCTGACCTTGGGCTGAACTGG + Intergenic
1157585213 18:48796672-48796694 CTTCTGCCCTTGGGTGGCTGTGG - Intronic
1157824568 18:50801130-50801152 GTGCTGGGCTTGGGCAGGTGGGG + Intronic
1158567623 18:58568479-58568501 CAGCTGACCCTGGGTAACTGAGG - Intronic
1160969618 19:1761750-1761772 CACCTGACCTTGGGCAGCCTTGG + Intronic
1161464916 19:4423860-4423882 CTGCTCACCTTGGGGGCCTGTGG - Exonic
1161628172 19:5338896-5338918 CTGCTGTCCTTGGGGTGCAGAGG - Intronic
1161664384 19:5565951-5565973 CTGCCGGCCTGGGGCAGCTCTGG - Intergenic
1162524196 19:11197812-11197834 CTGCTGTCCCTGGGCCGCTGCGG + Intergenic
1162718309 19:12647537-12647559 CTGCTCACGCTGGCCAGCTGGGG - Exonic
1162802811 19:13120244-13120266 GGGCTGACCGTGGGAAGCTGAGG + Intronic
1163600782 19:18247961-18247983 CTGCTGAACCTGGACAGGTGTGG - Intronic
1163752750 19:19087875-19087897 CTGTTGGCCTGGGGAAGCTGGGG + Intronic
1163860440 19:19740023-19740045 CCTCTGTCCTTGGGCAGTTGTGG + Intergenic
1164000816 19:21096692-21096714 CTGCTGAACATGGGAAGATGTGG + Intronic
1164669278 19:30063571-30063593 CTGATGGCCTTGGGCAGGTTGGG - Intergenic
1164690645 19:30208517-30208539 CTGCTGGCCCCGGGGAGCTGGGG + Intergenic
1164696513 19:30248745-30248767 CTTTTGACCTTGGCCAGCAGTGG + Intronic
1165034253 19:33021715-33021737 CACCTGAGCTTGGGCTGCTGAGG - Intronic
1166204439 19:41259870-41259892 CTCCTGCCCTGGGGCTGCTGGGG - Exonic
1166293468 19:41877841-41877863 CAGCTGTCCTTGAGCAGGTGAGG - Intronic
1166366199 19:42279881-42279903 CTGCTAAGCTGGGGGAGCTGGGG - Intronic
1166863513 19:45822922-45822944 CTGCTCGCCCTGGGGAGCTGAGG + Intronic
1167049120 19:47067934-47067956 CTGCTCACGGTGGGCTGCTGTGG - Intronic
1167292201 19:48630494-48630516 CTGCAGCCCGTGGGCAGCTCCGG - Exonic
1167903809 19:52641811-52641833 CTGAAAACCTTGGGCACCTGTGG - Intronic
925193209 2:1902336-1902358 CTGCTGGCTTGTGGCAGCTGTGG - Intronic
925352003 2:3207625-3207647 CTGCTCACCCTGGGGAGCTTCGG - Intronic
927424460 2:22966380-22966402 CTGCTGAACATGGTCAGTTGAGG - Intergenic
927753924 2:25693641-25693663 CACCTGAGCTTGGGAAGCTGAGG + Intergenic
928040682 2:27873307-27873329 CTGCTATTCTTGGGCAACTGTGG + Intronic
928168268 2:28986615-28986637 CTGCTCACCCTGGACAGCTCAGG + Intronic
928180804 2:29067014-29067036 CTCCTGATCTTGGGGACCTGGGG - Intronic
928555728 2:32423051-32423073 CAGCTAACCTTGGGAGGCTGAGG - Intronic
928753187 2:34494401-34494423 CTGCTGACCCCGGGCAGTGGGGG + Intergenic
930743302 2:54855958-54855980 CTGATGACCATGAGCAGTTGTGG + Intronic
930906627 2:56576341-56576363 CTGCTGGCCTTGGGATCCTGTGG + Intergenic
931219819 2:60278764-60278786 GTTCTGGCCTTGGGCAGCAGGGG + Intergenic
931478305 2:62612912-62612934 CTCCTGAACCTGGGCAGCGGAGG + Intergenic
932335494 2:70928732-70928754 CTCCAGTCCTTGGGAAGCTGAGG - Intronic
932340494 2:70960214-70960236 CAGCTGTCCCTGGGCAGCTCAGG + Intronic
933892991 2:86788485-86788507 CTGCTCACCTTGGCCAGCCCTGG - Intronic
934650729 2:96089931-96089953 CTGCTGACCAGATGCAGCTGAGG - Intergenic
934712414 2:96524799-96524821 CTGCTGCCCTCGGGCAGTTAGGG - Intergenic
935581113 2:104756498-104756520 CAGTTGGCCTTGGGAAGCTGGGG - Intergenic
935695074 2:105764213-105764235 CTGCTGGCCTTCAGCACCTGTGG + Intronic
936396501 2:112135861-112135883 CTGCAGATCCAGGGCAGCTGAGG + Intergenic
936492396 2:112983531-112983553 CAGCTGGCCTTGGGAAGATGTGG + Intronic
936616769 2:114056027-114056049 AAGCTGACCTTAGGCATCTGAGG + Intergenic
936874402 2:117171484-117171506 CTGCTGCCCTAGGGAATCTGCGG + Intergenic
938063473 2:128269185-128269207 CTGCTGGCCTCAGGCGGCTGTGG - Intronic
938609934 2:132937066-132937088 CTGCTGACCTATAGAAGCTGGGG + Intronic
939600732 2:144186907-144186929 CTGCTGTCATTTTGCAGCTGAGG - Intronic
940015489 2:149100092-149100114 ATGCTGGCCAGGGGCAGCTGGGG + Intronic
943099487 2:183471190-183471212 CTGCAGACCTGGGGCAGTGGTGG - Intergenic
943576548 2:189637651-189637673 CAGCTGACCCTGGGCAGGTTGGG - Intergenic
945270812 2:207937985-207938007 CTACTGCCCTTGTGGAGCTGAGG - Intronic
945443126 2:209904345-209904367 TGGCTGACCTTTGACAGCTGTGG - Intronic
946295105 2:218777789-218777811 CTGCTGCCCTTGGGCAACATGGG + Intergenic
946342053 2:219076409-219076431 CTCTTGACCTTTGACAGCTGAGG + Exonic
948313849 2:237011633-237011655 CTGCAGTCCTGAGGCAGCTGAGG + Intergenic
948333754 2:237192114-237192136 ATGCTGAGCTTGGACAGCTGAGG - Intergenic
948607207 2:239143753-239143775 CTGTTGACCTAGGGAAGCCGGGG - Intronic
948788154 2:240363789-240363811 CTGCTGTCCTTGGGGAGATGTGG - Intergenic
948859073 2:240744179-240744201 CTGCTGCCCCTGGGCAGACGTGG - Intronic
948863067 2:240762229-240762251 CAGCTGACCTCCCGCAGCTGTGG - Intronic
949020708 2:241739644-241739666 CTGCTCACTTGGGGCAGCAGTGG + Intronic
1169635298 20:7684151-7684173 CAGCTGACCTTGGGGCTCTGTGG - Intergenic
1170674430 20:18466657-18466679 CAGCTGCCCTTAGGAAGCTGGGG + Intronic
1170792097 20:19516830-19516852 CTGCTGACCTGCTCCAGCTGTGG - Intronic
1171349798 20:24493861-24493883 CTACTGAGCTTGGCCAGCCGGGG - Intronic
1172093981 20:32451791-32451813 CTGCTGGCCTGGCCCAGCTGTGG - Intronic
1173255484 20:41391900-41391922 CTGCAGCCCTTGGGCAGATGTGG + Intergenic
1173507337 20:43598402-43598424 CTGCTGAACTAGGCCAGGTGCGG + Intronic
1173823188 20:46031523-46031545 TTGCTGACCTCGGGCAGGTGGGG + Intronic
1174399864 20:50270167-50270189 AAGCTGACCTTTGGCAGGTGTGG - Intergenic
1175808022 20:61841509-61841531 CTGGTGGCCTTGGGCAGTAGAGG + Intronic
1175814871 20:61878092-61878114 CTGTAGGCCTGGGGCAGCTGGGG + Intronic
1175852672 20:62102121-62102143 CTGCTGACCTTGCTCCTCTGGGG - Intergenic
1176067894 20:63208779-63208801 CTGCTGTGCCTGGGCAGCTCTGG - Intronic
1176068545 20:63213688-63213710 CTGTTAACCTTGGGCATCAGTGG - Intronic
1176312723 21:5161848-5161870 CTGCTGACCTCGCGCTGCTGGGG + Intergenic
1179710794 21:43211889-43211911 CAGCTGGCCTTGGGGAGCTGGGG + Intergenic
1179718705 21:43303348-43303370 CTCGTGTCCTTGGGCAGCTCCGG - Intergenic
1179818665 21:43923775-43923797 CTTCTGTCCCTGGGGAGCTGGGG + Intronic
1179844325 21:44100182-44100204 CTGCTGACCTCGCGCTGCTGGGG - Intronic
1180154328 21:45970809-45970831 CTGGTGCCCATGGGCAGCAGAGG + Intergenic
1180229931 21:46421220-46421242 CTGCAGCACTTGGGCACCTGGGG - Intronic
1180481146 22:15756377-15756399 TTGCTGACCTTGAAAAGCTGTGG - Intergenic
1180800123 22:18627780-18627802 CCTCTGACCTTGAGGAGCTGTGG - Intergenic
1180851356 22:19023345-19023367 CCTCTGACCTTGAGGAGCTGTGG - Intergenic
1180996592 22:19968803-19968825 CTGCTGACCTTCTGCGGCTCCGG + Exonic
1181882722 22:25993708-25993730 CTGCTGACCTTTGGGACTTGTGG + Intronic
1181989891 22:26829409-26829431 CTGCAGACCCTGGAAAGCTGAGG - Intergenic
1183318571 22:37149905-37149927 CTGCTGAGCTCTGGCTGCTGGGG + Exonic
1183582568 22:38734666-38734688 CAGCTGCTCTTGGGCAGATGAGG - Intronic
1184877707 22:47286061-47286083 CTGCTGATGTGGGTCAGCTGTGG - Intergenic
949721768 3:6998335-6998357 GTCATGACCTTGGGCAGCTCTGG + Intronic
949756852 3:7421977-7421999 CTGCTTACATTGGGAGGCTGAGG + Intronic
949894867 3:8761488-8761510 CTGCTGGCCTGGGGCGGCAGGGG + Intronic
950123479 3:10497050-10497072 CTGCTGACCTTGGGCAGCTGTGG + Intronic
953459768 3:43073032-43073054 CTGCCCACCCTGGGAAGCTGTGG + Intergenic
954011436 3:47642960-47642982 CTGCTGAGCCTGGGAAGTTGAGG + Intronic
954654372 3:52185035-52185057 TTTGTGACCCTGGGCAGCTGTGG + Intergenic
954914726 3:54139045-54139067 CTGCTGAGCTTGGGGATCTGGGG + Intronic
955361636 3:58281218-58281240 CTGCTGGCCTTGCTGAGCTGTGG + Intronic
957049457 3:75400170-75400192 CTGCTGACCTCTGGCAACCGTGG - Intergenic
958191734 3:90193249-90193271 CAGCAGACCTTGGTGAGCTGCGG + Intergenic
958615195 3:96484810-96484832 CTCTTGAACCTGGGCAGCTGGGG - Intergenic
958679342 3:97306465-97306487 CTGCTGAGGTTAGGAAGCTGGGG - Intronic
959190405 3:103103727-103103749 CTGGTGACAGTGGACAGCTGTGG + Intergenic
959493713 3:107023650-107023672 CTGAATACCTTGGGAAGCTGAGG + Intergenic
960144483 3:114186239-114186261 CAGCTGAGATTGGGAAGCTGAGG - Intronic
961450331 3:126999648-126999670 CTGCTGCCGGCGGGCAGCTGAGG - Intronic
961790267 3:129371065-129371087 CTGGTGTCCCTGGGCAGCTTCGG + Intergenic
962349010 3:134643333-134643355 GTGATGACCTGGGGCTGCTGAGG + Exonic
962363447 3:134760825-134760847 CTGCTGTCCTGGGGCACCTCCGG + Intronic
963624296 3:147651287-147651309 GAGCTGATCTTGGGCAGCTTAGG + Intergenic
967194065 3:187011534-187011556 TTGTTGTCCTTGGGAAGCTGAGG + Intronic
968731791 4:2272646-2272668 CTGCTGCCCATGAGCTGCTGAGG - Intronic
968772812 4:2518858-2518880 CTGTTGAACCTGGGCAGCAGAGG + Intronic
969439365 4:7208221-7208243 CTTCTGAGCTGGGGCAGGTGGGG + Intronic
969643832 4:8414578-8414600 TTGCTGACGTGGAGCAGCTGCGG - Intronic
971933840 4:33120476-33120498 CTGCTGAGTTAAGGCAGCTGTGG - Intergenic
972323103 4:37991044-37991066 CTGCTGACCTGGGGCGGGGGTGG + Intronic
973027027 4:45284853-45284875 CTGCTGAGTTGGCGCAGCTGTGG - Intergenic
978409959 4:108415895-108415917 CTGCTGGCCTGGGGCAACTTTGG + Intergenic
980387171 4:132101358-132101380 CTGCTGTACTTGGGGAGCTGAGG - Intergenic
981527504 4:145720878-145720900 TTGCAAACCTTGGGCAGCTGTGG - Intronic
983565333 4:169144616-169144638 CTGCATAGCTTGGGCAGTTGAGG + Intronic
985560414 5:583306-583328 CTGGTGCCCTTGGACACCTGTGG + Intergenic
986755110 5:10828398-10828420 CTTCTGACCTTGGGTTGCTCTGG + Intergenic
986773842 5:10996154-10996176 CAGCTGCCCTAGGGCAGGTGTGG + Intronic
986976435 5:13399709-13399731 CTTCTTACTTGGGGCAGCTGTGG - Intergenic
987247658 5:16064687-16064709 CAGTTGCCCTAGGGCAGCTGGGG - Intergenic
989021789 5:37015442-37015464 ATGATGACCTTGGCCAGGTGTGG + Intronic
989099200 5:37808711-37808733 CTGCTGACCCTGGGGAGCAGGGG - Intergenic
990756569 5:59078590-59078612 CACCTGAGCTTGGGAAGCTGAGG - Intronic
992455216 5:76910173-76910195 CTGCTATCCTTGAGCAGCTATGG + Intronic
994464744 5:100112165-100112187 CTCATGACCTTTGGCAGCTCTGG + Intergenic
997253940 5:132412205-132412227 CTGCTGAGGTAGGGCAGCGGCGG - Intronic
997588074 5:135055984-135056006 CTTCTGATAGTGGGCAGCTGTGG + Intronic
997688967 5:135812788-135812810 CTGGTGTACATGGGCAGCTGGGG - Intergenic
998146453 5:139731785-139731807 CTGCTGTCCCTGGGTACCTGGGG - Intergenic
1000115583 5:158150434-158150456 CTCCCAACCTTGGGAAGCTGTGG - Intergenic
1003952272 6:11127390-11127412 CTGTGGGCCTAGGGCAGCTGTGG - Intronic
1004786427 6:18972939-18972961 CTCCTGATCTTGGTCAGCTCCGG + Intergenic
1004836667 6:19538936-19538958 CTGCTGACCTTGCTCATCTCAGG + Intergenic
1005807777 6:29491106-29491128 CTGCTCACCTTGGGCAGGTGTGG + Intergenic
1006339934 6:33441360-33441382 CTGCTGACCTTGCTGAGCTGGGG - Exonic
1006576867 6:35053000-35053022 CATCTCTCCTTGGGCAGCTGGGG - Intronic
1006985493 6:38172977-38172999 CTGCTGACCTTGGGAAGAGAGGG - Exonic
1007631182 6:43274571-43274593 CTGCTGTCCTTGGGTTGATGTGG + Intronic
1007790795 6:44307061-44307083 TTGCTGACCATGAGCCGCTGGGG - Exonic
1010058114 6:71588901-71588923 CTGTAGACCGTGGGAAGCTGGGG + Intergenic
1011133594 6:84076144-84076166 CACCTGAGCTTGGGCAGTTGAGG - Intronic
1011309791 6:85969196-85969218 CTGCTGATCTTGGGGAGAGGAGG + Intergenic
1011841839 6:91510715-91510737 CTGATCACCTTGGGAGGCTGAGG + Intergenic
1014605021 6:123462914-123462936 CTGCTAACCCTGAGCAGCTCGGG - Intronic
1017164229 6:151391838-151391860 CTGCAGACCATGTGCAGCCGAGG + Intergenic
1019014231 6:168867943-168867965 CTGCAGGCCTTTGGCTGCTGCGG + Intergenic
1019564773 7:1673873-1673895 GAGCTGTCCTGGGGCAGCTGGGG + Intergenic
1020068630 7:5210478-5210500 TTGCTGACCTTTGGCAGTTTCGG + Intronic
1023585629 7:41726812-41726834 CTGCTGAAGTTGGGCATCTGAGG - Intergenic
1024240018 7:47427589-47427611 CTTCTGGCCCTGGGCAGCTGTGG - Intronic
1025210913 7:57019263-57019285 CAGCTGTCCTTGGGGGGCTGGGG - Intergenic
1025661042 7:63557584-63557606 CAGCTGTCCTTGGGGGGCTGGGG + Intergenic
1026995410 7:74612722-74612744 CTGCTGGGCCTGGGCCGCTGGGG - Intergenic
1027126935 7:75563180-75563202 ATGCTTACCTCAGGCAGCTGGGG + Exonic
1029110672 7:98211702-98211724 CTGCGGACATGGGGCAGCCGTGG - Intronic
1029236948 7:99128288-99128310 CTGCTGACATTTGGCTGATGAGG + Intronic
1031206719 7:118768106-118768128 GTGCTGCCATTAGGCAGCTGAGG + Intergenic
1032461135 7:132112382-132112404 CTTCTGACATTGTCCAGCTGGGG - Intergenic
1033155818 7:138956142-138956164 GTGCTGACTTTGGGAGGCTGAGG - Intronic
1033195231 7:139321790-139321812 CTGCTGTCCTGGGGAAGCAGGGG - Intergenic
1033951793 7:146793713-146793735 CTCCAGCCTTTGGGCAGCTGTGG + Intronic
1034400041 7:150856310-150856332 AGGCTGTCCTGGGGCAGCTGGGG - Intronic
1034530992 7:151696423-151696445 CTGGTGGCCTGGGGCAGGTGAGG + Intronic
1034625286 7:152487584-152487606 CTCCTGACCTTGGCCGGGTGTGG + Intergenic
1034743137 7:153496882-153496904 CTGGTGACCTTGGAGAGCAGAGG + Intergenic
1034916769 7:155046541-155046563 TTTCTGACCTTGGCCAGGTGCGG - Intergenic
1035239200 7:157519061-157519083 CTGGGGAGCTTGGGGAGCTGGGG + Intergenic
1035453858 7:158996729-158996751 CCGCTGAGCTTGGGCAGCCTGGG - Intergenic
1035890809 8:3340658-3340680 TTGATGACCTTGGGGAGCTGGGG + Intronic
1036118523 8:5988168-5988190 CTGCTGACACTGGCCAGCTTGGG + Intergenic
1036942379 8:13064056-13064078 CTGCTTACGTTGTGGAGCTGGGG - Intergenic
1039380434 8:37079902-37079924 CTGCTGACGTAAGGCTGCTGTGG - Intergenic
1039501531 8:38021592-38021614 CTGCTGATCTGGACCAGCTGGGG - Intergenic
1039895523 8:41714116-41714138 CTGCTCTCCAGGGGCAGCTGGGG + Intronic
1040057064 8:43068260-43068282 CTGCTAACTTTGGGAGGCTGAGG - Intronic
1045557605 8:103229912-103229934 CTGCCAACCTTTGGCAGCTGGGG - Exonic
1046112922 8:109748490-109748512 CTGCTGAGATGGGGCAGGTGGGG + Intergenic
1046239952 8:111477268-111477290 CAGCTGAAGTTGGTCAGCTGTGG - Intergenic
1048297192 8:133223140-133223162 TTGCTGCCCTGGGGCTGCTGGGG - Intronic
1048819212 8:138364305-138364327 ATCCTGCCTTTGGGCAGCTGTGG - Intronic
1049095813 8:140547462-140547484 CTGCTGCCCCAGGGCAGGTGAGG - Exonic
1049229721 8:141475623-141475645 CCGCTTCCCTTGGGCTGCTGGGG + Intergenic
1049767345 8:144361009-144361031 CTCCTGAGCCTGGGCAGGTGGGG + Exonic
1049807874 8:144549051-144549073 CTGGTGCCCTTGGCCAGGTGCGG - Intronic
1051843056 9:21420198-21420220 CTGCTGGCCTGGTGGAGCTGGGG - Intronic
1052610759 9:30770647-30770669 CTGGTAAACTTGGGCTGCTGTGG - Intergenic
1057444181 9:95102609-95102631 AAGCTGACCTTGGGCTGCTCTGG - Intronic
1058868631 9:109183752-109183774 CTGCTGCCCCTGGGCAGTGGTGG - Intronic
1060713091 9:125889970-125889992 CAGCTGACCTTAGCCGGCTGCGG + Intronic
1060820989 9:126661596-126661618 CAGCTGAGCTGGGGCAGTTGGGG - Intronic
1061177376 9:129005839-129005861 CAGCTGACCTTGGGCATGTTGGG + Intronic
1061466587 9:130785359-130785381 CTGCTGCCCTGGGCCAGCTCTGG + Intronic
1061673220 9:132201022-132201044 CTTCTGACCTTGGACTGCTCAGG + Intronic
1061978823 9:134088080-134088102 CTGGGGACATTGTGCAGCTGTGG - Intergenic
1062239105 9:135526363-135526385 GTGCCGTCCTTGGGCTGCTGAGG - Exonic
1062271387 9:135711345-135711367 GTGCTGCCTTTGGCCAGCTGGGG - Intronic
1186196288 X:7113074-7113096 CTGCTCAGCTGGGGCAGCAGTGG + Intronic
1192049731 X:67713263-67713285 CTTCTCAGCTTGGGAAGCTGAGG + Intronic
1192495286 X:71612477-71612499 CGGGTGACCCTGGGCAGCTCCGG - Exonic
1194234975 X:91372173-91372195 CTGCTGCCCTTGGTCAGGTGAGG + Intergenic
1196893179 X:120309636-120309658 CTGCTTACCTTGGCCAGCTGTGG - Intronic
1198740972 X:139842280-139842302 CTGCTCACTTTGGGAGGCTGAGG - Intronic
1200146636 X:153929757-153929779 CTCATGACCTTCAGCAGCTGTGG - Exonic
1200966766 Y:9045963-9045985 CTGCTTTCCTTGAGCAGCTGTGG + Intergenic
1201270499 Y:12249309-12249331 CTGCAGGCTTTAGGCAGCTGTGG - Intergenic
1202131945 Y:21620859-21620881 TTGCTGAAGTGGGGCAGCTGTGG + Intergenic