ID: 950126465

View in Genome Browser
Species Human (GRCh38)
Location 3:10512864-10512886
Sequence ACAGCCCATCACGGTAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 61}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950126465_950126469 9 Left 950126465 3:10512864-10512886 CCTGCTTTACCGTGATGGGCTGT 0: 1
1: 0
2: 0
3: 7
4: 61
Right 950126469 3:10512896-10512918 GGCAAGTCTCTCAACCTCTCTGG 0: 1
1: 11
2: 88
3: 444
4: 1360
950126465_950126470 16 Left 950126465 3:10512864-10512886 CCTGCTTTACCGTGATGGGCTGT 0: 1
1: 0
2: 0
3: 7
4: 61
Right 950126470 3:10512903-10512925 CTCTCAACCTCTCTGGCCTCAGG 0: 1
1: 0
2: 7
3: 75
4: 641

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950126465 Original CRISPR ACAGCCCATCACGGTAAAGC AGG (reversed) Intronic
900664327 1:3804155-3804177 ACAGCCCATAACGGAGAAACAGG + Intergenic
901646055 1:10717342-10717364 ACACCCCAGCACGGCAAGGCAGG - Intronic
903538450 1:24082599-24082621 CGAGCCCATCAGGGTCAAGCAGG - Exonic
910215887 1:84843846-84843868 AGAGCCCATCCAGGTAGAGCTGG - Intronic
914901590 1:151714051-151714073 ACAGAGCATCAGGGTAGAGCAGG - Intronic
921157246 1:212448053-212448075 ACAGGCAATCACAGCAAAGCAGG - Intergenic
923247644 1:232148205-232148227 AGAGCCCATCATGGGACAGCAGG - Intergenic
1062812012 10:473811-473833 AGAGCCCATCATGGAAAACCAGG - Intronic
1064867274 10:19895251-19895273 CCAGCCCAGCATGGTAGAGCTGG + Intronic
1073181373 10:101585441-101585463 ACAGCCCAGCAAGGCAGAGCAGG - Exonic
1078866202 11:15299755-15299777 ATAGCCAATCACAGTAAAACAGG - Intergenic
1097643787 12:62212127-62212149 ACAGCAAATCAGGGAAAAGCAGG + Intronic
1097951444 12:65433605-65433627 AAAGACCATCACAGTGAAGCAGG - Intronic
1100914013 12:99397616-99397638 ACAGCCCATAATGACAAAGCTGG - Intronic
1101236636 12:102796236-102796258 ACAACCCTTCACTGTAAAGGTGG + Intergenic
1103347122 12:120258563-120258585 CAAGCCCATCATGGAAAAGCAGG + Intronic
1107129476 13:36879728-36879750 ACAGCCCTTCACGGCAAAGTGGG + Exonic
1113403053 13:110012666-110012688 ACATACCATCCCTGTAAAGCAGG + Intergenic
1114848893 14:26359057-26359079 AGAGCCTATCAAGGCAAAGCTGG - Intergenic
1118706495 14:68485111-68485133 ACAGCCCCTCTAGGAAAAGCTGG - Intronic
1123137079 14:106037999-106038021 ACAGCCCATCTCTGAAGAGCAGG - Intergenic
1123931157 15:25172277-25172299 ACTCCCCATCACTGCAAAGCGGG - Intergenic
1124918726 15:34002499-34002521 ACAGCTGATCACGGAAAGGCTGG + Intronic
1128538073 15:68505443-68505465 ACAGCCCAGCTCGGTGAAGCTGG - Intergenic
1132321609 15:100929695-100929717 ACAGCCCAGCACGTTCAGGCAGG - Intronic
1138425542 16:56929772-56929794 ACATCCCATCTCTGTGAAGCAGG - Intergenic
1138801272 16:60033113-60033135 ACAACCCATTACTGCAAAGCAGG - Intergenic
1139586724 16:67908736-67908758 ACAGCCCATCACGGACACGAGGG - Exonic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1140778333 16:78271422-78271444 ACAGCCCAGCAAGGTGATGCAGG - Intronic
1141337915 16:83174817-83174839 ACATCTTATCACAGTAAAGCAGG + Intronic
1150452812 17:65283392-65283414 ACAGCCCATCAAGGTGAGCCAGG - Intergenic
1154502011 18:15001791-15001813 ACAGCCCACCAGGGCACAGCTGG - Intergenic
1166055368 19:40285100-40285122 ACAGCCCATCGCGGCACCGCGGG + Intronic
926019304 2:9481459-9481481 ACAGCCAATCTCGGCAAATCTGG + Intronic
926323452 2:11765051-11765073 ACAGCCCATCACGGCCCATCAGG - Intronic
931776864 2:65548300-65548322 ACACCCTATCACACTAAAGCCGG - Intergenic
1173192314 20:40886099-40886121 ACAGCCCAGGATGGTAAACCAGG + Intergenic
1174563909 20:51451132-51451154 TCAGCCCCTCAAGGCAAAGCAGG + Intronic
1177853780 21:26378838-26378860 CCAGCCCACCACAATAAAGCGGG + Intergenic
950126465 3:10512864-10512886 ACAGCCCATCACGGTAAAGCAGG - Intronic
962677388 3:137767064-137767086 ACAGCCCATGACGTTAAACAAGG + Intergenic
963049612 3:141129700-141129722 ACAGCCCCACACGGTTCAGCTGG + Intronic
964655597 3:159063166-159063188 ACAGAACAACACTGTAAAGCAGG + Intronic
987010551 5:13758845-13758867 ACAGGCCATGACTGAAAAGCAGG - Exonic
987027152 5:13939109-13939131 ACATCCCTTCCCTGTAAAGCTGG - Intronic
993616021 5:90113486-90113508 AAATCCCTTCACGGTAAAGTGGG + Intergenic
995289106 5:110429150-110429172 ACAGCCATTCACGGTATACCGGG + Intronic
1003613599 6:7635342-7635364 ACTGCAAATCACAGTAAAGCCGG - Intergenic
1004119181 6:12803367-12803389 ACAGCCCCTCACAGAAAAGGAGG + Intronic
1005088296 6:22029413-22029435 ACAGCCCATCACTGCAAAGAGGG - Intergenic
1007217624 6:40252630-40252652 ACAGCTCATCACTGTGATGCTGG + Intergenic
1009656616 6:66554752-66554774 ACACCCAATTATGGTAAAGCTGG - Intergenic
1011854571 6:91673343-91673365 ACAGCTCATCAGGGATAAGCTGG - Intergenic
1015953413 6:138576455-138576477 GCAGCCCAGCACGGTAAGGAAGG - Intronic
1018881253 6:167883539-167883561 AGAGACCGTCACGGTAAATCTGG + Intronic
1026713532 7:72766171-72766193 ACAGCTCATAACGTTACAGCAGG + Intronic
1032306558 7:130738285-130738307 ACAGTACATCAAGGCAAAGCAGG - Intergenic
1033756288 7:144400196-144400218 CCAGCGCATCATGGTAAAGGGGG - Exonic
1035975889 8:4311130-4311152 ACAGCCAGTCACGGTATTGCTGG - Intronic
1040392132 8:46959380-46959402 ACAGCTCATGACTGTAAAGGTGG + Intergenic
1041352776 8:56965487-56965509 ACAGCCCCTCAAGCTAAATCCGG + Intronic
1049356604 8:142192344-142192366 ACAGCCCCTCACGTTAAACCTGG - Intergenic
1049499967 8:142957109-142957131 ACAGCCCCTCACAGTGCAGCCGG + Intergenic
1056699668 9:88891837-88891859 ACGGCCCATGAGGGGAAAGCAGG + Intergenic
1062043236 9:134413725-134413747 ACAGCCCCTCAGGGTCAAGCAGG - Intronic
1062671017 9:137709402-137709424 CCACCCCACCACGGTAAGGCAGG - Intronic
1190873518 X:54444333-54444355 ACAGCCAATCCTGGAAAAGCTGG + Intronic
1192622645 X:72694509-72694531 ACTGCCCATCAAGGTAAGGCTGG - Intronic