ID: 950131300

View in Genome Browser
Species Human (GRCh38)
Location 3:10548570-10548592
Sequence CTGGGAAAACCATGAGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 241}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950131292_950131300 -3 Left 950131292 3:10548550-10548572 CCAGCTCCCTTCCCTCTCAGCTG 0: 1
1: 0
2: 8
3: 123
4: 769
Right 950131300 3:10548570-10548592 CTGGGAAAACCATGAGCTGTGGG 0: 1
1: 0
2: 0
3: 31
4: 241
950131295_950131300 -9 Left 950131295 3:10548556-10548578 CCCTTCCCTCTCAGCTGGGAAAA 0: 1
1: 0
2: 3
3: 27
4: 324
Right 950131300 3:10548570-10548592 CTGGGAAAACCATGAGCTGTGGG 0: 1
1: 0
2: 0
3: 31
4: 241
950131296_950131300 -10 Left 950131296 3:10548557-10548579 CCTTCCCTCTCAGCTGGGAAAAC 0: 1
1: 0
2: 2
3: 47
4: 306
Right 950131300 3:10548570-10548592 CTGGGAAAACCATGAGCTGTGGG 0: 1
1: 0
2: 0
3: 31
4: 241
950131291_950131300 -2 Left 950131291 3:10548549-10548571 CCCAGCTCCCTTCCCTCTCAGCT 0: 1
1: 2
2: 5
3: 99
4: 744
Right 950131300 3:10548570-10548592 CTGGGAAAACCATGAGCTGTGGG 0: 1
1: 0
2: 0
3: 31
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950131300 Original CRISPR CTGGGAAAACCATGAGCTGT GGG Intronic
900593884 1:3471738-3471760 CTGTGAATGCCAGGAGCTGTCGG - Intronic
902671798 1:17979772-17979794 TTGGGAAAACCATTAGCGGTGGG + Intergenic
903273262 1:22205291-22205313 CTGGGAGGATCCTGAGCTGTGGG - Intergenic
903502226 1:23807228-23807250 CTGGGAAACGCATGAGCTGAAGG + Intronic
904425635 1:30421148-30421170 ATGGGAAAACCATGCTCTGTGGG - Intergenic
907118217 1:51988314-51988336 CTGGGAAAACAATGAGAAGGTGG - Intronic
907525840 1:55053525-55053547 CTGGGAAAACTGTCAGCTCTGGG + Intronic
910315921 1:85883682-85883704 CTAGGAATACCACGTGCTGTAGG - Intronic
919834957 1:201567197-201567219 ATGGGAAAGCCATCAGCTGCAGG + Intergenic
920242353 1:204562415-204562437 CTGGGAATACCTGGTGCTGTAGG - Intergenic
921678908 1:218008411-218008433 CTGCGAAGGCCCTGAGCTGTGGG + Intergenic
922831879 1:228558288-228558310 CTGGGAATACCGGGTGCTGTAGG - Intergenic
922832359 1:228610270-228610292 CTGGGAATACCGGGTGCTGTAGG - Intergenic
922832919 1:228612511-228612533 CTGGGAATACCGGGTGCTGTAGG - Intergenic
922833480 1:228614752-228614774 CTGGGAATACCGGGTGCTGTAGG - Intergenic
922834040 1:228616993-228617015 CTGGGAATACCGGGTGCTGTAGG - Intergenic
922834597 1:228619234-228619256 CTGGGAATACCGGGTGCTGTAGG - Intergenic
922835149 1:228621449-228621471 CTGGGAATACCGGGTGCTGTAGG - Intergenic
922835708 1:228623669-228623691 CTGGGAATACCGGGTGCTGTAGG - Intergenic
922836266 1:228625911-228625933 CTGGGAATACCGGGTGCTGTAGG - Intergenic
922836824 1:228628150-228628172 CTGGGAATACCGGGTGCTGTAGG - Intergenic
922837383 1:228630392-228630414 CTGGGAATACCGGGTGCTGTAGG - Intergenic
922837944 1:228632633-228632655 CTGGGAATACCGGGTGCTGTAGG - Intergenic
922838502 1:228634873-228634895 CTGGGAATACCGGGTGCTGTAGG - Intergenic
922839060 1:228637098-228637120 CTGGGAATACCGGGTGCTGTAGG - Intergenic
922839620 1:228639339-228639361 CTGGGAATACCGGGTGCTGTAGG - Intergenic
922840180 1:228641570-228641592 CTGGGAATACCGGGTGCTGTAGG - Intergenic
922840740 1:228643811-228643833 CTGGGAATACCGGGTGCTGTAGG - Intergenic
922841304 1:228646042-228646064 CTGGGAATACCGGGTGCTGTAGG - Intergenic
1063270107 10:4498690-4498712 CTGGGAAAAACATGAACACTAGG - Intergenic
1063594331 10:7420037-7420059 ATGAGAAAACCACGAGCTGGAGG + Intergenic
1064373756 10:14777090-14777112 CTGAGAAAAGTATGAGCTCTGGG - Intergenic
1064844257 10:19633685-19633707 CTGGGAATACCGTGTGCTGTAGG - Intronic
1065624974 10:27620824-27620846 CTGAGAAAGACATGAGCTCTGGG + Intergenic
1068791360 10:61034465-61034487 CAGGAAAACCCAAGAGCTGTTGG + Intergenic
1068969020 10:62943844-62943866 ATGGGCAAACCATGGGCTTTAGG - Intergenic
1069061462 10:63899036-63899058 CAGGGAAAACTGTGAGCTCTGGG + Intergenic
1069166724 10:65169395-65169417 CAGGGAAAAACATGGGCTCTGGG + Intergenic
1069708732 10:70475722-70475744 TGGGCAAAAACATGAGCTGTGGG - Intergenic
1069914422 10:71778550-71778572 ATGGGAAAACCATGAACTCTGGG + Intronic
1070116278 10:73531766-73531788 CTGGGAAAACCAGGAGAGCTGGG + Intronic
1070209193 10:74297608-74297630 GTTGGCAAACTATGAGCTGTGGG + Intronic
1070568299 10:77620379-77620401 CTGGGGAAAGCAGGAGCTGTGGG + Intronic
1070929816 10:80253130-80253152 CTGGGAGGACCAAGAGCTGTAGG - Intergenic
1070954132 10:80453847-80453869 CTGGGAGAAGCACGAGCTGTGGG - Intergenic
1071479316 10:86052542-86052564 CTGGGAATACCAGGTGCTGTCGG + Intronic
1071879125 10:89875424-89875446 CTGGGAACACCATGACCTACTGG + Intergenic
1073625517 10:105091783-105091805 CTGGGAGAAGAATGAGATGTAGG + Intronic
1073816450 10:107213128-107213150 CAGGGACACCAATGAGCTGTAGG + Intergenic
1074097999 10:110330841-110330863 CTGGGAAGGCCCTGAGCTTTGGG - Intergenic
1075269885 10:121039505-121039527 CTGGAAAAAGCATGAGCTTTGGG - Intergenic
1075847069 10:125553447-125553469 CTGGGACAACTCTGAGATGTGGG - Intergenic
1078456832 11:11482217-11482239 CTGGGAAGCCCATGTGCAGTCGG + Intronic
1079492122 11:21000883-21000905 CTGGGAATACCGGGTGCTGTAGG - Intronic
1080052314 11:27870039-27870061 CTTGGTATAACATGAGCTGTGGG - Intergenic
1080307215 11:30849807-30849829 CAGGGACAACCAGGAGCTTTGGG - Intronic
1081006378 11:37748644-37748666 CTGGGAAGGCCCTGAGCTCTGGG + Intergenic
1084904523 11:72335432-72335454 CTGGGAGAGCCATGAGCTTGGGG - Intronic
1086467277 11:87067967-87067989 CTTGTAAAACCAGGAACTGTGGG + Intronic
1086486955 11:87315530-87315552 CTGCGAAAACCAATAGCTATAGG - Intronic
1088930343 11:114345068-114345090 TTGGGGAAACCATGAAGTGTTGG + Intergenic
1090719608 11:129459514-129459536 CTGGGAAAACCAAGAGAGTTTGG - Intergenic
1093258421 12:16902429-16902451 CTGGGAAATCCATGGTCGGTTGG - Intergenic
1094204123 12:27822548-27822570 CTGCGAAAGCCATGAACTGAGGG + Intergenic
1094696905 12:32828778-32828800 CTGGGGAAACAATGAGCTGAAGG + Intronic
1094818112 12:34205793-34205815 CTGGGAATACCGGGTGCTGTAGG + Intergenic
1095098808 12:38161468-38161490 CTGGGAATACCGGGTGCTGTAGG - Intergenic
1096886623 12:54725340-54725362 CTAGGAAAGCCTGGAGCTGTTGG - Intergenic
1096898234 12:54846602-54846624 CTGGGGAAACAATGAGAAGTAGG + Intronic
1096951993 12:55483289-55483311 CTGGGGATACCATGAGCTATTGG - Intergenic
1097285990 12:57877871-57877893 ATGGGAAAATCTGGAGCTGTTGG + Intergenic
1101900395 12:108787760-108787782 CTGGGAGAACCAGGAGCCGCCGG - Exonic
1103375978 12:120456306-120456328 CTGGGAGATTCTTGAGCTGTTGG + Intronic
1104713253 12:131000025-131000047 GTGGGAAAATCATGACCTGCTGG - Intronic
1105468233 13:20667476-20667498 CGGGGAACACCCTGGGCTGTGGG - Intronic
1105948118 13:25207033-25207055 CTGGGACAACCATGTGCAGAAGG - Intergenic
1109351436 13:61187605-61187627 CAGAGGAAACCATGAGCAGTAGG + Intergenic
1110833003 13:80053335-80053357 CTTAGAAAACCATCAGCTCTTGG + Intergenic
1110887767 13:80659311-80659333 CTGGGAAAAAGCTGAGCTTTGGG - Intergenic
1111182980 13:84693481-84693503 TTGGGAAAAACGTGAGATGTAGG - Intergenic
1111944628 13:94651399-94651421 CTGGGAATACCAGGTGCTGTAGG - Intergenic
1113890287 13:113731894-113731916 CTGGGCCCACCATGGGCTGTGGG - Intronic
1114433841 14:22686554-22686576 CTGGGAAAACAGGCAGCTGTGGG + Intergenic
1118656167 14:67951480-67951502 CTGGGAAGACGATAAGCTGTAGG - Intronic
1119891671 14:78187317-78187339 GAGGGAAAAGCATGAGCTTTGGG + Intergenic
1120696466 14:87650500-87650522 GTGGGAAGACCATGAGTTTTGGG + Intergenic
1122971347 14:105153528-105153550 CTGGGGAAACCAGGAGGTGGGGG - Intronic
1124965076 15:34427601-34427623 CTAGGACAACCAACAGCTGTGGG + Intronic
1124981687 15:34573811-34573833 CTAGGACAACCAACAGCTGTGGG + Intronic
1125818940 15:42611129-42611151 CTTGGCAAACTATGATCTGTGGG + Intronic
1126634469 15:50767362-50767384 CTCGTTAAACTATGAGCTGTGGG - Intergenic
1129374208 15:75117327-75117349 CTGGGAAGGCCCTGAGCTCTGGG + Intronic
1132561514 16:596736-596758 CTGCCAAGACCATGGGCTGTGGG + Intronic
1132871097 16:2116103-2116125 CCGGGAATACCATGACCTGGTGG + Exonic
1133403455 16:5505267-5505289 TTGGGATAACCCTGAACTGTAGG + Intergenic
1134521437 16:14920791-14920813 CCGGGAATACCATGACCTGGTGG - Intronic
1134613082 16:15626499-15626521 CTGGGAATACTAGGAGCTATAGG + Intronic
1134709108 16:16319442-16319464 CCGGGAATACCATGACCTGGTGG - Intergenic
1134716317 16:16359471-16359493 CCGGGAATACCATGACCTGGTGG - Intergenic
1134950497 16:18349203-18349225 CCGGGAATACCATGACCTGGTGG + Intergenic
1134958433 16:18392688-18392710 CCGGGAATACCATGACCTGGTGG + Intergenic
1136945228 16:34642360-34642382 CTGTGAAAAAAATGAGCTCTTGG + Intergenic
1137223771 16:46482214-46482236 CTGGGAAAAGCATAGCCTGTTGG + Intergenic
1137436113 16:48455516-48455538 CAGGGAAAACGATGGGCTGGAGG + Intergenic
1139466688 16:67157830-67157852 CTGGGAGACCATTGAGCTGTAGG - Intronic
1142745785 17:1957262-1957284 CTCGGAAAATCACCAGCTGTGGG + Intronic
1142855937 17:2730385-2730407 CTGGGAAAAACTCCAGCTGTTGG + Intergenic
1143613423 17:8034401-8034423 CTGAGATCATCATGAGCTGTAGG + Intergenic
1143615367 17:8046330-8046352 CTAGGAAAACCAGGGCCTGTGGG - Intronic
1147234901 17:39050287-39050309 CTGGGAAAAACATGAGCCCTGGG - Intergenic
1147984410 17:44296796-44296818 CTGGGAACACCATGGTCTCTTGG + Intergenic
1148319887 17:46741720-46741742 TTGGGGAAACCAAGAGTTGTAGG + Intronic
1148889826 17:50799631-50799653 CTGGCAGAGCCAGGAGCTGTGGG + Intergenic
1152276495 17:79361013-79361035 CTGGGAAGAACATCAGCTTTTGG + Intronic
1152996164 18:408155-408177 CTGGGAAGATCATGGGCTTTAGG + Intronic
1155274196 18:24170507-24170529 CTGGGAATACCAGGTGCTGTCGG - Intronic
1157106491 18:44778974-44778996 CTGGTTAAACCCTGAGGTGTTGG + Intronic
1157482283 18:48063105-48063127 CTGGGAAAACCAAGACATGTTGG - Intronic
1157510222 18:48266242-48266264 GTGGGAAGAGCATGAGTTGTGGG - Intronic
1158149989 18:54357543-54357565 CTTGGAAAAACTGGAGCTGTGGG + Intronic
1159502206 18:69288396-69288418 CTGGGAAAAACCTGAGCTCCTGG - Intergenic
1159932563 18:74329015-74329037 ATGGGAAAACAAAGTGCTGTTGG + Exonic
1161651993 19:5491321-5491343 CTGGGGAAATCATGAGCTGAAGG - Intergenic
1162683737 19:12365244-12365266 CTGGGAAGACGCGGAGCTGTGGG + Intronic
1163174179 19:15552619-15552641 CTGAGAATACCCTGAGCTGAGGG + Intergenic
1164002293 19:21113130-21113152 CTGGGAATACCGGGTGCTGTAGG - Intronic
1164851686 19:31489520-31489542 CAGGGAACACCATGAGCAGCAGG + Intergenic
1164926337 19:32132707-32132729 CTGGAAAAGCCTTGTGCTGTGGG + Intergenic
1165943730 19:39428790-39428812 CTGGGAAAACCATGGGCGCCAGG + Intergenic
1168688655 19:58363548-58363570 CTGGGAACACCGAGTGCTGTTGG + Intergenic
1168699510 19:58428394-58428416 CTTGGAAAACCAGGAGATATGGG + Intergenic
925528945 2:4838144-4838166 GTGGGAAAGCCAGGAGGTGTTGG + Intergenic
926294849 2:11561663-11561685 CTGGGAATACCAGGTGCTGTAGG - Intronic
926591303 2:14742988-14743010 CTGGGACAACCATAACCTCTGGG - Intergenic
926824398 2:16889222-16889244 CTGGTAAAAACAAGAGCTTTTGG + Intergenic
927104542 2:19812057-19812079 CTGGGAAAACCATGAAAATTGGG - Intergenic
927369558 2:22338888-22338910 CTGGGAATACCAGGTGCTGTAGG - Intergenic
930719863 2:54628552-54628574 CTGTGAAAGCCAGGAGCTGCTGG - Intronic
931196350 2:60055409-60055431 CTGGAATAAGCATTAGCTGTTGG + Intergenic
931229407 2:60361501-60361523 CTGGGTGAACCCTGGGCTGTAGG - Intergenic
932706215 2:74026889-74026911 CTGGGACAGCCCTGAGCTCTGGG - Intronic
934858017 2:97740949-97740971 CTGCGAAGACCCTGAGCTCTGGG + Intergenic
934948813 2:98562464-98562486 CAGGGAAGGCCATGGGCTGTGGG - Intronic
938202743 2:129389015-129389037 CTGTGAAACCCAAGAACTGTGGG + Intergenic
939003823 2:136764683-136764705 CTGGGAAAACCCCTAGCTCTGGG - Intergenic
940725939 2:157336378-157336400 CTGGGAGAACCATCTTCTGTTGG - Intergenic
942640949 2:178059815-178059837 CTGTGAAAATCATGACCTGCTGG + Intronic
942801359 2:179879988-179880010 CTGTGGAAACCAGGACCTGTTGG + Intergenic
942906703 2:181190893-181190915 GTGTGAACACCATCAGCTGTGGG + Intergenic
943381477 2:187154929-187154951 GTTGGCAAACTATGAGCTGTGGG + Intergenic
943665313 2:190602789-190602811 CAGGCAAAATCAGGAGCTGTAGG + Intergenic
945363380 2:208920549-208920571 CTGGGAATACTAAGTGCTGTAGG - Intergenic
946775531 2:223136307-223136329 CTGGGGAAGCCATGACCTGGAGG + Intronic
1169936744 20:10891812-10891834 AGGGGACCACCATGAGCTGTGGG + Intergenic
1171111172 20:22483852-22483874 CTGGTTAAAACATGAACTGTTGG - Intergenic
1171186551 20:23127588-23127610 CAGGGAAACCCAGGGGCTGTGGG + Intergenic
1172847498 20:37938587-37938609 CCCGGAAAAGCCTGAGCTGTGGG + Intronic
1173095203 20:40020494-40020516 CTGGGAAAACCATAAGAGGAGGG + Intergenic
1178582522 21:33848508-33848530 CGGGGAAGAGCATGAGCTCTAGG + Intronic
1178590181 21:33902937-33902959 GTGGTAAAAACATGGGCTGTAGG + Intronic
1179587391 21:42382417-42382439 CTGGGAAACACATGGGGTGTGGG - Intronic
1179837946 21:44049832-44049854 CAGGAAAACCCATGAGCAGTGGG - Intronic
1182480930 22:30608238-30608260 CTGGGGAAACCCTGAGAGGTGGG + Intronic
1183398896 22:37589423-37589445 CTGGGGAGACCATGGGCTGCAGG + Intergenic
1183690071 22:39383346-39383368 CAGGGAAGACCATGGGCTGTAGG + Exonic
1184871854 22:47245686-47245708 CTGGGAAACCCATGGGCCCTTGG - Intergenic
949601738 3:5606543-5606565 CTTGGAAAAGCTTGAGCTGCAGG + Intergenic
950076683 3:10192357-10192379 GTGGCAAATCCAGGAGCTGTTGG - Intronic
950131300 3:10548570-10548592 CTGGGAAAACCATGAGCTGTGGG + Intronic
950582506 3:13871762-13871784 CTGGCAAAAGCATGAACTGCAGG - Intronic
951670695 3:25178537-25178559 CTGGGAAAGGCATGCGCTCTGGG - Intronic
951966115 3:28387144-28387166 CTGGGAAAACCAAGAGTGATTGG - Intronic
954363764 3:50135763-50135785 CTGGGGAGATAATGAGCTGTGGG - Intergenic
957716595 3:83936256-83936278 GTGGGAAAGACATGAGCTTTGGG + Intergenic
958575647 3:95947614-95947636 CTGCGAAGACCCTGAGCTCTGGG + Intergenic
959621429 3:108402414-108402436 TTGGGAAAACTATGGGCTGTGGG + Intronic
959887528 3:111519816-111519838 CTGGAACAACAATGTGCTGTTGG + Intronic
960734990 3:120769376-120769398 ATGGGGAAACCATGAAATGTCGG + Intronic
961065513 3:123872047-123872069 CTGGGAAAACTATGACCAGCAGG + Intronic
961939934 3:130626500-130626522 CTGGGAGAAAAAGGAGCTGTTGG + Exonic
963648438 3:147946211-147946233 CTGGGAAAACCCACAGCTGCTGG + Intergenic
964693844 3:159484850-159484872 CTTGGAAATTAATGAGCTGTAGG - Intronic
964947125 3:162239473-162239495 CTGGGAAAATCTCTAGCTGTAGG - Intergenic
966606086 3:181822874-181822896 CTGGGAATACCGGGTGCTGTAGG - Intergenic
967293052 3:187940441-187940463 CTTGGAAAACAGTGAGCTCTTGG - Intergenic
967594211 3:191311458-191311480 CTGGGAAATCCATGATCTATTGG + Intronic
967815044 3:193791322-193791344 CTGGGAAATTCATGTGCTCTGGG - Intergenic
968848607 4:3062371-3062393 CAGGGAAAACCATGAGGTTTTGG - Intergenic
969443627 4:7232171-7232193 CTGGGGGAAGCATGGGCTGTGGG + Intronic
970296423 4:14635817-14635839 CTGGGCAGACCCTGAGCTCTAGG + Intergenic
972978502 4:44666681-44666703 CTTGGAAAAAGATGAGCTGGAGG - Intronic
974787850 4:66644005-66644027 CTTGGAAAAACATGTTCTGTAGG + Intergenic
976648332 4:87408506-87408528 CTGGGAAGGCCCTGAGCTCTGGG + Intergenic
980520846 4:133932014-133932036 CAGGGTAAACCAGGGGCTGTGGG - Intergenic
980995429 4:139775572-139775594 CAGGTTAAACCATGAGCTGTGGG + Intronic
981352104 4:143743298-143743320 CAGGGAATACCATGAAATGTAGG - Intergenic
983237352 4:165194567-165194589 CTAGGCAAACCAAGATCTGTAGG + Intronic
987200391 5:15571393-15571415 CTGGGAAAATGAAGAGATGTAGG + Intronic
988383358 5:30528514-30528536 CTGAGAAAGCCCTGTGCTGTTGG + Intergenic
989439273 5:41451093-41451115 CTGGGAAAACAATGTTCTTTTGG + Intronic
992936384 5:81711397-81711419 CTGGCAAAGCGATGAGCTGTAGG - Intronic
993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG + Intronic
993903180 5:93597753-93597775 CCAGGAGAACCATGAGCTTTGGG + Intergenic
995070324 5:107913787-107913809 CTGCAAAAACTATCAGCTGTGGG + Intronic
995376443 5:111479734-111479756 CTGGAAAAGCCATGAGCCTTAGG - Intronic
996065315 5:119072505-119072527 CTGGGAATACTAAGTGCTGTAGG + Intronic
997054528 5:130425505-130425527 CTGAGAAACCTTTGAGCTGTGGG + Intergenic
998252818 5:140564155-140564177 GTGGGAAGACCAGGAGCTGAGGG - Intronic
1001113229 5:168916352-168916374 CTGGGAGAACCTGCAGCTGTGGG + Intronic
1001335200 5:170790986-170791008 CTGGGAAAACCAGGGGATATTGG - Intronic
1002300393 5:178254452-178254474 CTGGGGTACCCATGAGCTGCTGG + Intronic
1002706126 5:181161666-181161688 CTGGGGAAACCAGGAGTTGAAGG - Intergenic
1002760715 6:199905-199927 CAGGGAACACCGTCAGCTGTGGG - Intergenic
1003250834 6:4428057-4428079 CTGGGAATACCGGGTGCTGTAGG + Intergenic
1003875516 6:10432878-10432900 CTTGGAAACCCATGAGAAGTTGG + Intergenic
1003892021 6:10572093-10572115 CTGGGAAACCCCTCAGCTCTGGG + Intronic
1003929355 6:10908775-10908797 GTGGAAAGACCATGAGCTTTGGG + Intronic
1004435803 6:15592392-15592414 CTGGAAGAACCTTGAGCTGCTGG + Intronic
1006509335 6:34513454-34513476 CTGGGAATAGCATGTCCTGTGGG + Intronic
1010890759 6:81307540-81307562 CTGGTAACACCATAAGCTGTGGG - Intergenic
1011449324 6:87476075-87476097 TTGGTAAAACCATAAGCAGTGGG - Intronic
1012343512 6:98157213-98157235 CTGGGAAGACACTGAGCTGCAGG - Intergenic
1013071544 6:106733605-106733627 CTTGGAACACCACCAGCTGTAGG - Intergenic
1013663011 6:112317750-112317772 CTGCCATAACCATGAGCTCTAGG - Intergenic
1015534815 6:134257119-134257141 TTGGGAATACCAGGTGCTGTAGG + Intronic
1016809829 6:148249502-148249524 CTGAGAAAAGCATAAGCTTTCGG + Intergenic
1016869771 6:148805396-148805418 CTGGAAAAAGCCTGAGATGTTGG + Intronic
1018834205 6:167471021-167471043 ATGGGAAAACCGTGGGCTGGGGG + Intergenic
1019524102 7:1473004-1473026 CTGGGAAAACCAGGCCCTGTAGG + Intronic
1019906323 7:4067831-4067853 TTGGTAGAACCAGGAGCTGTGGG + Exonic
1020670104 7:11096097-11096119 CTGGGAAAACCATGTGATTAAGG - Intronic
1024557892 7:50619256-50619278 CTTGGAAGACCATGAGCTGGTGG - Exonic
1024765888 7:52658904-52658926 CTGTGAAGACCATTTGCTGTTGG - Intergenic
1026442403 7:70455893-70455915 AGGAGAAAACCATGAGCTTTGGG + Intronic
1027954492 7:84861675-84861697 CTGGGAAAACCTTAAACTGTTGG - Intergenic
1031873246 7:127110082-127110104 CTGGCAAAAGCTTTAGCTGTGGG - Intronic
1032654418 7:133912126-133912148 GTGGGCAAACCATGACCTGTGGG - Intronic
1033326850 7:140386783-140386805 CTGGGAATACCGGGTGCTGTAGG - Intronic
1033529762 7:142250041-142250063 GTGGCAACACTATGAGCTGTTGG + Intergenic
1033661796 7:143407988-143408010 CTGGGACACCCATCAGCTGCAGG + Intronic
1035731292 8:1855126-1855148 AGGGGAGAAACATGAGCTGTTGG - Intronic
1037918607 8:22788098-22788120 CTGGGAGAACCAGGAGCAGCAGG + Intronic
1038919158 8:32063521-32063543 CTGGGAAAACCAGGATGTTTGGG + Intronic
1039770031 8:40676460-40676482 CTGGCAAAACCACGAGCATTAGG + Intronic
1039860073 8:41449551-41449573 ATGGGAAAACTATGGGCTTTGGG - Intergenic
1040373143 8:46796670-46796692 CTGGGGAAACCATGGGCCCTGGG + Intergenic
1042686109 8:71442466-71442488 CTCAGAAATCCATAAGCTGTAGG + Intronic
1045509591 8:102804692-102804714 CAGGGAAACAAATGAGCTGTCGG - Intergenic
1046077215 8:109327477-109327499 TTAGGAAAAGCATGAGCTTTAGG + Intronic
1046291874 8:112172882-112172904 CTAGGAAATCCATGATCTATGGG - Intergenic
1048172146 8:132117487-132117509 CTTGGAAAAGCATGAACTTTGGG - Intergenic
1048493076 8:134912676-134912698 ATGGGAGAACACTGAGCTGTAGG - Intergenic
1048822896 8:138396100-138396122 CTGGAAAGAGCATGAGCTTTGGG + Intronic
1051783405 9:20715093-20715115 TGGGAAAAACCAAGAGCTGTTGG + Intronic
1051937187 9:22457479-22457501 CTGCTAAAACCACCAGCTGTGGG - Intergenic
1055207512 9:73750974-73750996 CTGGGAATACTAGGTGCTGTAGG - Intergenic
1056390148 9:86133441-86133463 CCTGTAAAACCATCAGCTGTTGG - Intergenic
1060868533 9:127020173-127020195 CTGGTAAAACCATGTGGTCTTGG + Intronic
1061363653 9:130158979-130159001 CTGGGGAAACCCTGACCTGGGGG - Intergenic
1186509810 X:10122259-10122281 CAGTGAAAACCATGACCTCTTGG + Intronic
1186545070 X:10440725-10440747 CTGGGACATCCATGATCTGGAGG + Intergenic
1187237065 X:17477402-17477424 ATGGGTAAGGCATGAGCTGTGGG + Intronic
1188339617 X:28982854-28982876 CTGGGAATACCGGGTGCTGTAGG - Intronic
1188441521 X:30218553-30218575 CTGGGTAAACCAAGAAATGTGGG - Intronic
1189886027 X:45545801-45545823 GTGAGAAAACCATGAGATTTGGG - Intergenic
1190550593 X:51575959-51575981 TTTGGACAACCAGGAGCTGTTGG - Intergenic
1192279779 X:69672573-69672595 CTGGGAATACCGGGTGCTGTAGG + Intronic
1192762474 X:74107664-74107686 CTGTCAAAACCAGAAGCTGTGGG + Intergenic
1194643575 X:96430980-96431002 CTGGTAAATACATGAGCTGCTGG + Intergenic
1196167755 X:112554095-112554117 CTTTGTAAGCCATGAGCTGTGGG + Intergenic
1196686219 X:118512777-118512799 CTGGCAGAGGCATGAGCTGTTGG - Intronic
1201763180 Y:17559865-17559887 CTGGGAATACAAGGTGCTGTAGG + Intergenic
1201838373 Y:18346125-18346147 CTGGGAATACAAGGTGCTGTAGG - Intergenic