ID: 950131475

View in Genome Browser
Species Human (GRCh38)
Location 3:10549871-10549893
Sequence ACTGAGGGGCCCACTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950131467_950131475 -3 Left 950131467 3:10549851-10549873 CCAGCACAGGGGAGGGGCCCACT 0: 1
1: 0
2: 4
3: 29
4: 279
Right 950131475 3:10549871-10549893 ACTGAGGGGCCCACTGAGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950131475 Original CRISPR ACTGAGGGGCCCACTGAGGA GGG Intronic
900131603 1:1089595-1089617 ACTCAGGGGCCTCGTGAGGAGGG - Intronic
900176914 1:1295081-1295103 GCTGGGGGGCCCACTGCGGGGGG - Intronic
900735558 1:4297516-4297538 TGTGAGGGGGCCAATGAGGAGGG + Intergenic
901772009 1:11535342-11535364 ACCGAGGGGACCCCTGAGGGAGG - Intronic
901942501 1:12674108-12674130 CATGTGGGGCCCACTGAGAAAGG + Intergenic
902193626 1:14781570-14781592 ACTGAGGGGTCCAGATAGGAGGG + Intronic
903007278 1:20307108-20307130 GCTGTGTGGCACACTGAGGAAGG + Intronic
903733915 1:25517849-25517871 GGTGAGGGTCCCACTGAGGCAGG - Intergenic
904291024 1:29485903-29485925 ACAGATGGACACACTGAGGAGGG + Intergenic
904421802 1:30398856-30398878 ACTGTGGGGCCCACTGCAAAAGG - Intergenic
904499699 1:30907076-30907098 ACTGACTGGCCCACTGAGGCTGG + Intronic
905398773 1:37686324-37686346 ACAGAGGGGCTCACTGCTGAAGG + Exonic
906538015 1:46562679-46562701 ACTGCGGGGCCGACTGTGGCTGG - Exonic
907387086 1:54133063-54133085 ACTGGAGGGCCCAGTGAGCATGG - Intronic
907458628 1:54592214-54592236 AGCGAGGGGTCCCCTGAGGAGGG + Intronic
909300522 1:74007631-74007653 ATAGAGGGGCCCACTGAGGCAGG - Intergenic
911377956 1:97074741-97074763 ACTAAGGGGCCCACCCAGTAAGG + Intergenic
912209136 1:107539400-107539422 AATGAGGGGCCCTTTGATGAAGG + Intergenic
913083001 1:115407190-115407212 ACAGGGGGGCCCACAGAGAATGG + Intergenic
915284012 1:154841491-154841513 AGTTAGGGGACCACTGAGCAAGG + Intronic
915626976 1:157119938-157119960 ACTGAGTGGCCAACTTAGGCTGG + Intergenic
915706037 1:157844656-157844678 TCTGAGGGGCCCTCTCAGGAAGG + Intronic
916445865 1:164871291-164871313 ACTGAGGAGACCTCTGAGGGAGG + Intronic
918232652 1:182550305-182550327 ACTGGGAGGTCCACTGGGGAAGG + Intronic
920094574 1:203477759-203477781 ACTCCATGGCCCACTGAGGAAGG + Intronic
920280890 1:204842843-204842865 ACTGATGGCCCCACTGCTGAGGG - Intronic
920989532 1:210923448-210923470 ATTGTGGTGGCCACTGAGGAAGG - Intronic
921047003 1:211484915-211484937 ACAGAAGGGGCCACTGAGCAGGG - Intronic
922661749 1:227436179-227436201 AGAGAGTGGCCCACTGAGGCAGG + Intergenic
923114043 1:230917682-230917704 ACCGAGAGGCACACTGAGGCTGG + Intronic
923249672 1:232168145-232168167 ACGGAGGGGCTCCCTGAGGCAGG + Intergenic
1066586792 10:36944511-36944533 ACTGCGGGGCCAACTGTGGCTGG - Intergenic
1069722840 10:70560638-70560660 AGGGAGAGGCCCACTGAGGCAGG - Intronic
1073095788 10:100978932-100978954 ACGGAGCGTGCCACTGAGGAGGG + Exonic
1074810194 10:117096846-117096868 ACTAAAGGGTCCATTGAGGAGGG + Intronic
1077422598 11:2460077-2460099 AGTGAGGGGCCCCCTGGGGGTGG - Intronic
1077540431 11:3144076-3144098 GCTGTGGGACCCCCTGAGGATGG - Intronic
1079814681 11:25040575-25040597 ACTGAGAGGTCCACTGAGTTAGG - Intronic
1082795799 11:57376973-57376995 ACATAGGGGGCCCCTGAGGAGGG - Intronic
1082820845 11:57543717-57543739 CCTGAGAGCCCCACTGGGGAGGG + Exonic
1083274001 11:61586839-61586861 GGGGAGGGGCCCACTGAGGCAGG - Intergenic
1084160923 11:67349670-67349692 ACTGAGGAGGCCAGTGAGGCTGG - Intronic
1084573273 11:69972842-69972864 AGGGAGGGTCCCACTGAGTATGG - Intergenic
1084789624 11:71465196-71465218 ACTGCGGGGGCCACTGCGGAAGG + Intronic
1085235676 11:75013433-75013455 AAGGCAGGGCCCACTGAGGAGGG + Intronic
1086342094 11:85857269-85857291 AATGAGGGTCTCAATGAGGATGG - Intronic
1087677950 11:101183910-101183932 AATCAGGGGCCCACTCAGAAGGG - Intergenic
1088314535 11:108494543-108494565 ACTGTGGAGCCCACTGGGCAAGG + Intronic
1089632447 11:119792162-119792184 ACTGAGGAGCCGACAGAGCAAGG - Intergenic
1091218215 11:133916519-133916541 ACCGAGGGGCTGACTCAGGATGG + Intronic
1092108727 12:5944318-5944340 ACAGAAGGTCCCACTGAGCAAGG - Intronic
1099038060 12:77614685-77614707 ACTGAGGCACTCACTGTGGAAGG - Intergenic
1099200721 12:79673544-79673566 ACTGAGGGGCACAATAAGGCTGG - Intronic
1101245471 12:102880214-102880236 AATGCTGGACCCACTGAGGAAGG - Intronic
1104786910 12:131455848-131455870 ACCCAGGGGCCCAGTGGGGAGGG + Intergenic
1104843861 12:131837092-131837114 TCTGAAGGGCCCACTGGGGTGGG - Intronic
1104917197 12:132271847-132271869 ACTGAAGGGCGCACGGGGGACGG - Intronic
1105498455 13:20951067-20951089 ACAGAGGAGCACACTGAGGTGGG + Intergenic
1107093950 13:36514894-36514916 TCCGAGGGGCAGACTGAGGAAGG + Intergenic
1107418140 13:40220203-40220225 AGTGAGGGGCCCACTGTGCCTGG - Intergenic
1113741017 13:112712439-112712461 ACTGTGGGGCCCAGTGAGCTTGG - Intronic
1114526408 14:23369450-23369472 GCTGAGGGGCCTCCTGGGGAAGG + Intergenic
1114638540 14:24203229-24203251 ATTGAGGGCCCAACTGAGGTTGG - Intronic
1117344530 14:54819314-54819336 ACTGGACGGCCCACTGAGCACGG + Intergenic
1118614812 14:67567989-67568011 ACCCAGGGGCCCCCTCAGGACGG + Intronic
1120179191 14:81325839-81325861 ACAGAGGGGCAGACTGAGAAGGG + Intronic
1121642629 14:95495929-95495951 CTTGAGAGGCCCACTGGGGAAGG - Intergenic
1122235575 14:100329156-100329178 ACTGAGGAGCCCACTCTGGGAGG - Intronic
1123057364 14:105577683-105577705 ACAGAGGGGACCTCTGAGGCGGG + Intergenic
1123475592 15:20591078-20591100 TCTGGTGGGCCCAATGAGGAGGG - Intergenic
1123642419 15:22409285-22409307 TCTGGTGGGCCCAATGAGGAGGG + Intergenic
1125688465 15:41578031-41578053 GCTGAGGAGCCCACTGCGGGAGG + Exonic
1127664760 15:61134825-61134847 AGTGAGTGACCCACTGAAGAAGG - Intronic
1128769955 15:70274504-70274526 TCTCAGCTGCCCACTGAGGAAGG + Intergenic
1131417903 15:92276781-92276803 AATGCAGGGCCCTCTGAGGAAGG - Intergenic
1131508597 15:93036585-93036607 ACTGGGAGGCTGACTGAGGAGGG - Intronic
1132715412 16:1287751-1287773 ACTGAGGGTGACGCTGAGGATGG + Intergenic
1134103510 16:11469468-11469490 AGTGAGGGGCGCAGTGAGCAGGG + Intronic
1134630398 16:15752141-15752163 ACTGTGGGTCCCGCAGAGGAGGG + Intronic
1134862497 16:17573117-17573139 AGTGTGAGGACCACTGAGGATGG + Intergenic
1135648510 16:24185363-24185385 ACTGTGGGCCCCAGGGAGGAGGG + Intronic
1138431462 16:56971879-56971901 ACAGAGGGGAACACTGAGGCTGG + Intronic
1138481785 16:57308010-57308032 ACTAAGGGGGCCACACAGGATGG - Intergenic
1139390923 16:66605757-66605779 ACTGAGGGGCCCAGTGAGAGCGG + Intronic
1139478967 16:67217834-67217856 AGTGAAGGGGCCGCTGAGGAAGG + Intronic
1140922565 16:79552624-79552646 ACCGAGGGGCCCAAGGGGGAGGG - Intergenic
1141311801 16:82920615-82920637 ACTGCAGGCCCCACTGTGGATGG + Intronic
1141468538 16:84222818-84222840 TCTGAGGAGCCCCCGGAGGACGG - Exonic
1141715150 16:85722717-85722739 ACAGAGGGGCTCACTGCTGACGG + Intronic
1142031385 16:87840201-87840223 AGTGAGGGCCCCACTCAGGGCGG - Intronic
1146469992 17:33116497-33116519 GCTGACAGGCCCACTGTGGATGG + Intronic
1146658416 17:34648894-34648916 AGAGAAGGGCCCTCTGAGGAGGG - Intergenic
1147578859 17:41617557-41617579 ACTGATGGGACAAGTGAGGAGGG - Intergenic
1148228545 17:45916558-45916580 AAGGAGGGGCCCAAAGAGGAAGG + Intronic
1148389220 17:47258228-47258250 AATGAAGGTCCCACTCAGGAAGG - Intronic
1149478162 17:56981090-56981112 ATTGACTGGCCCACAGAGGAGGG + Exonic
1151436314 17:74099926-74099948 GCATAGGGGCCCACTGAGGAGGG - Intergenic
1152120852 17:78417439-78417461 ACGATGGGGCCCACTGAGCATGG + Intronic
1152124651 17:78439028-78439050 ACTGAGGTGGCCAATGGGGATGG - Intronic
1152195403 17:78915377-78915399 ACGGATGGAGCCACTGAGGAGGG - Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152646026 17:81468944-81468966 ATTGAGGGGCCCACCCAGCATGG - Intergenic
1155175683 18:23299353-23299375 ACCGGGAGGACCACTGAGGAGGG - Intronic
1155822591 18:30397218-30397240 ACTGTAGGTCCCTCTGAGGAAGG + Intergenic
1157393073 18:47319093-47319115 ACTGAGGCACCCACTGTTGATGG - Intergenic
1162530501 19:11233354-11233376 ACTGGAGGGGCCCCTGAGGATGG + Exonic
1162850746 19:13429485-13429507 AGTGAGGGGCACAGTGAGGGGGG - Intronic
1163530849 19:17848021-17848043 ACCAAGGGGCCCACACAGGAAGG - Exonic
1165034367 19:33022385-33022407 GCTGTGGGGCCCGCTGAGGGGGG - Intronic
1165757687 19:38304001-38304023 ACTGAGGGGGGCTCTGTGGATGG - Intronic
925075160 2:1010198-1010220 ACTTAGGGGCTCACTAAAGATGG + Intronic
927719299 2:25372751-25372773 AAAGAGGAGCCCACGGAGGAGGG + Intergenic
927863279 2:26573666-26573688 ACTCAGGGGGCCAAGGAGGAAGG + Intronic
929378415 2:41319146-41319168 CCTGAAGGGCACACTGAGGTGGG + Intergenic
930886132 2:56328983-56329005 CAGGAGGAGCCCACTGAGGAAGG - Intronic
931157795 2:59655029-59655051 ACTGAAGGGCTCAGGGAGGAAGG - Intergenic
932503920 2:72210591-72210613 ACTCAGGGGCCCTTTGGGGAAGG - Intronic
932886694 2:75555130-75555152 ACTGAGCTCCCCACAGAGGATGG - Intronic
934553430 2:95275642-95275664 ACTGCAGCGCCCACAGAGGAGGG - Intronic
934619458 2:95795230-95795252 GCTGAGTGGCCAACTGAGCAAGG + Intergenic
934641432 2:96029327-96029349 GCTGAGTGGCCAACTGAGCAAGG - Intronic
935379342 2:102435146-102435168 ACTGAGTGGCTCACTGTGGTGGG + Intronic
937280310 2:120713175-120713197 ACTGGGTGGCCCACTGAGGCAGG - Intergenic
940088267 2:149886332-149886354 TGTCAGGGGTCCACTGAGGATGG - Intergenic
942857572 2:180568425-180568447 ACTGAGACGCCCAGTGATGAAGG - Intergenic
945696233 2:213108436-213108458 ACTGTGGGGCACAGTGAGAAGGG - Intronic
947007510 2:225529263-225529285 TCTGAGGTGCCTTCTGAGGACGG - Intronic
947279088 2:228428224-228428246 ACTGAGGATGCCACTGAGGAGGG - Intergenic
948273141 2:236688991-236689013 CCTGCGGGGCCCAGTGAAGAAGG - Intergenic
948427515 2:237897038-237897060 AAAGAGGGACCCACTGAGGCTGG - Intronic
948546168 2:238730351-238730373 TCTGAGGTCCCTACTGAGGAGGG - Intergenic
1169213949 20:3783233-3783255 CCTGAGGGCCTCAGTGAGGAGGG + Intergenic
1169273888 20:4220421-4220443 TCTGAGGGCCTCAGTGAGGAAGG - Intergenic
1171296499 20:24021674-24021696 ACTGTGGTGCTGACTGAGGAAGG + Intergenic
1171419610 20:25009020-25009042 ACAGATGAGCCCACTGAGCATGG + Intronic
1172919935 20:38472932-38472954 ACTGACGGACCGCCTGAGGACGG + Exonic
1173707645 20:45124300-45124322 CCTGAGGGGCCCTCTGGGGCTGG - Intronic
1174087208 20:48017969-48017991 GTTGAGGGTGCCACTGAGGATGG + Intergenic
1174656601 20:52177049-52177071 AATGAACGGCCCACTGAGGGAGG - Intronic
1175201897 20:57283771-57283793 ACTGGGGGACCCTCAGAGGACGG - Intergenic
1175275064 20:57762776-57762798 ACTGAAAGGCCACCTGAGGATGG + Intergenic
1179180192 21:39038042-39038064 ACTGAGGGACCCAGGTAGGAGGG - Intergenic
1179625555 21:42647153-42647175 ACAGAGGGGAGCATTGAGGACGG - Intergenic
1180009496 21:45040291-45040313 ACTGAAGGGTCCACAGAGGACGG - Intergenic
1180717438 22:17881427-17881449 ACTGGGCTGCCCTCTGAGGATGG - Intronic
1181310947 22:21944462-21944484 ACTGAGGCAGCCACCGAGGATGG + Intronic
1183453157 22:37907208-37907230 CCTGCGTGCCCCACTGAGGAGGG - Intronic
1184495337 22:44837881-44837903 ACTGAGGTCCCCAAAGAGGAGGG - Intronic
1184768783 22:46586297-46586319 CCAGTGGGGCCCAGTGAGGATGG - Intronic
949255673 3:2043015-2043037 ACCTAGGTACCCACTGAGGATGG - Intergenic
949505038 3:4719602-4719624 GCCCAGTGGCCCACTGAGGAAGG + Intronic
949808859 3:7984560-7984582 AATGACTGGCCCAGTGAGGAAGG - Intergenic
950131475 3:10549871-10549893 ACTGAGGGGCCCACTGAGGAGGG + Intronic
950259795 3:11535643-11535665 ACACAGGGTCCCTCTGAGGAGGG + Intronic
950440689 3:13008520-13008542 AGTGAGGGCCTCCCTGAGGAGGG - Intronic
950557067 3:13702407-13702429 ACTGAGAGGACCACTGAGTGAGG + Intergenic
950559853 3:13715077-13715099 ATTGAGGGGCCCAAGGTGGAGGG + Intergenic
950579936 3:13855504-13855526 AGTGAGGGGGCCACAGAAGAAGG - Intronic
950653006 3:14419339-14419361 AGTGACGTGCCCAGTGAGGAGGG - Intronic
952255958 3:31695963-31695985 ACAGAGCGGCCCTATGAGGAAGG + Intronic
954083429 3:48225666-48225688 ACTGGGGGTTCCACTGAGAATGG - Intergenic
954366783 3:50150685-50150707 CCTGAGGGGCCCAGTGCAGAAGG + Intergenic
954440321 3:50518206-50518228 ACTGATGGGCAAACTGAGGTTGG - Intergenic
961449037 3:126994241-126994263 AGAGAGGGGGTCACTGAGGAAGG - Intronic
961651523 3:128418889-128418911 ACAGAGGGGCCCAGAGAGCAGGG - Intergenic
962891396 3:139676184-139676206 ACTGAGAGGCCCAGAGAGTAGGG - Intronic
963221595 3:142818971-142818993 ACTGAGAAGCCATCTGAGGATGG - Intronic
965063651 3:163815178-163815200 ACCTAGGTGCCCACTGATGATGG - Intergenic
966611169 3:181869245-181869267 AGTGAGGGGCAAACTTAGGATGG + Intergenic
968360193 3:198141371-198141393 ACGGAGGTGCACACTGAGGCAGG - Intergenic
968591983 4:1463960-1463982 CCTGAGGGGCCCTCCGGGGAGGG - Intergenic
968957512 4:3726828-3726850 ACTGAGGGGCTCACGGTGGATGG - Intergenic
969303432 4:6310787-6310809 ACAGAGGAGCCAACTGAGGCTGG - Intergenic
970466268 4:16326106-16326128 ACTGAGGGTACCAGTGAGAAGGG + Intergenic
973236770 4:47914292-47914314 TGTGAGGGGCCGAGTGAGGAAGG + Intronic
974156070 4:58074485-58074507 ACTGAGGTGCCCACTGATGGTGG + Intergenic
976117552 4:81744164-81744186 TCTGAGGGCCCCACAGAAGATGG + Intronic
980240584 4:130169008-130169030 ACTTAGTGGCCAACTGAGTATGG - Intergenic
985858438 5:2449588-2449610 CCTGAGGTGGCCACTGAGGAAGG - Intergenic
986020106 5:3793842-3793864 ACTGAGAGGCTCACTGTGGCTGG - Intergenic
988654555 5:33194361-33194383 ACTTGGGGGCCCACTGAGAGAGG + Intergenic
993678967 5:90851591-90851613 ACTGAGGGTCCAACTGAGGTTGG + Intronic
995896539 5:117018947-117018969 ACGGAGGTGCCCACTGTAGAAGG + Intergenic
999135513 5:149316179-149316201 ACTGAAGGGCTCAATGAGCAGGG + Exonic
999264674 5:150258625-150258647 ACTGAGGGTGCCTCTGGGGAGGG + Intronic
1002418685 5:179134512-179134534 ACTGAGAGGGCTCCTGAGGAAGG - Intronic
1002514793 5:179749700-179749722 CCTGGGAGGCCCACAGAGGATGG + Intronic
1002634853 5:180602198-180602220 ACTGTGGGATCCACTCAGGAAGG - Exonic
1002931443 6:1637706-1637728 ACTGACTGGCCCACTGCAGAGGG - Intronic
1003826876 6:9962778-9962800 ACTCAGGAGCTCACTGAGGAAGG + Intronic
1004484900 6:16057279-16057301 AGTGAGGAGGCCACTGTGGAAGG - Intergenic
1005763490 6:28988742-28988764 ACTGATGGGAGCAGTGAGGAAGG - Intergenic
1006505603 6:34486705-34486727 AGAGAGGGGCCCACGGAGGAGGG - Intronic
1006606479 6:35260700-35260722 ACTGAGGTCCAGACTGAGGAGGG - Intronic
1006804454 6:36779090-36779112 GCTGGGGGGCCGTCTGAGGATGG - Intronic
1012547202 6:100433303-100433325 ACTGTGGTGGCCACTGAGTAAGG - Intronic
1015663965 6:135606283-135606305 ACCTTGGGGCCCACTGAGGGTGG + Intergenic
1016083585 6:139884822-139884844 ACTGAAGGGGCCACTGAGATAGG + Intergenic
1018713320 6:166513296-166513318 ACTGCGAGGACCACTGGGGAAGG - Intronic
1018948246 6:168361902-168361924 ATTGAGGGGCCCAGGGAGGATGG + Intergenic
1019080458 6:169426094-169426116 ACTGAGGGGCGCAGGGAGCACGG - Intergenic
1019259803 7:75260-75282 ACGGAGGTGCACACTGAGGCAGG + Intergenic
1019330332 7:457767-457789 CCTCTGGGGCCCACAGAGGAGGG + Intergenic
1019434688 7:1015864-1015886 ACAGAGGGGCCCCTGGAGGAAGG - Intronic
1020333824 7:7046154-7046176 ACAGAGAGTCCCAGTGAGGAGGG + Intergenic
1021949353 7:25759954-25759976 ACGCAGGAGTCCACTGAGGAAGG + Intergenic
1022715054 7:32891583-32891605 CCGGAGGGGCCCAGTGTGGACGG - Exonic
1024004666 7:45216697-45216719 CCTCAGAGGCCCACTGAGGCAGG - Intergenic
1024525775 7:50347993-50348015 ACAGAGGGGACCACAGAGCAGGG + Intronic
1024984861 7:55186202-55186224 ACTGGGTGGAGCACTGAGGAAGG + Intronic
1025227369 7:57177345-57177367 ACTCAGGGCCCCACGGAGGGAGG + Intergenic
1026866875 7:73829557-73829579 ACTGAGGGGACCTCTGGGAAGGG - Exonic
1029701825 7:102252241-102252263 ACTGAGGGGCCCAACCAGGAGGG - Exonic
1030222314 7:107109993-107110015 ACTGAAATGGCCACTGAGGAGGG + Intronic
1033727074 7:144130009-144130031 CCTGAGGAGGGCACTGAGGAAGG + Exonic
1035262780 7:157672177-157672199 AGCGAGGGGCCCACTGGGAACGG + Intronic
1035712453 8:1729198-1729220 ACGGAGGGCCCCTCGGAGGAGGG - Intergenic
1036116367 8:5964624-5964646 ACTGAGGGGCCCTCTGTGTCTGG + Intergenic
1040029555 8:42812298-42812320 GCTCAGGGGAGCACTGAGGAGGG + Intergenic
1040292679 8:46133422-46133444 ACTCAGGGACCCATTGAGGCAGG - Intergenic
1040310992 8:46236767-46236789 TCTGAGGGGACCATTGAGGCTGG + Intergenic
1040314585 8:46254293-46254315 ACTCAGGGGGACACTGAGGCGGG + Intergenic
1040331232 8:46386804-46386826 ACTCAGGGGGACACTGAGGCAGG + Intergenic
1040952922 8:52954093-52954115 ACTCAGGAGCCCACAGAAGAGGG - Intergenic
1044337505 8:91004605-91004627 ATTCAGTGGCCCACTGGGGATGG + Intronic
1045933766 8:107655881-107655903 ACTCAGGAGCCCACTGGGCAGGG - Intergenic
1046542635 8:115605894-115605916 ATTGAGGTGCACACTGAGAATGG - Intronic
1047313397 8:123711064-123711086 ACTAAGGGCCCCACTGAGTAGGG - Intronic
1047968414 8:130064430-130064452 ACAGACGGGGACACTGAGGAAGG + Intronic
1048471690 8:134709819-134709841 AATGAGAAGCCCACTGAGAAGGG + Intronic
1048571987 8:135664100-135664122 AGTGAGGGGCCCATTAAGAACGG + Intergenic
1049260697 8:141637571-141637593 ACTGGGTGGGCCACTGAGGGAGG + Intergenic
1049280363 8:141741073-141741095 ACTGAGTGGGCCACGGAGGCAGG - Intergenic
1049686946 8:143942816-143942838 ACTGCAGGGCCCAGGGAGGAAGG + Intronic
1056901638 9:90605642-90605664 ACTGAGGGGCCCGAAGAGGCAGG - Intergenic
1058197186 9:101992131-101992153 AGAGAGGGGACCACTGAAGAAGG + Intergenic
1058802196 9:108555394-108555416 ATTCAGGGGCCTACAGAGGATGG + Intergenic
1059760416 9:117332034-117332056 AATGTAGGGCCCACTGGGGAGGG + Intronic
1060519119 9:124283904-124283926 CCTGAGAGCCCCATTGAGGATGG + Intronic
1060818817 9:126650157-126650179 ACTCCTGAGCCCACTGAGGAGGG + Intronic
1061365482 9:130170846-130170868 AGTGAGGGGCCCACAGTGGGGGG - Intergenic
1061444201 9:130628580-130628602 GATGAGGGGCCCAGTGGGGAGGG + Intronic
1062571975 9:137189932-137189954 GCTGAGGGGCACACGGAGGCAGG - Exonic
1062652532 9:137585598-137585620 CCTGAGAGGCCCAGTGAGGAAGG + Intronic
1203771463 EBV:51995-52017 AGTTAGGGGCCGACCGAGGAAGG + Intergenic
1185754950 X:2645761-2645783 CCTGTGGGGCTCAGTGAGGAGGG - Intergenic
1186295617 X:8145050-8145072 ACACAGGAGCCCACTGAGGGTGG + Intergenic
1186842761 X:13501049-13501071 ACAGTTGGACCCACTGAGGATGG - Intergenic
1186922031 X:14292842-14292864 TCTGAGGGGCACTCTGTGGAGGG - Intergenic
1187253911 X:17623781-17623803 ACTGAGGGAGACAGTGAGGAGGG - Intronic
1189739145 X:44100715-44100737 AGAGAGGGGCTCTCTGAGGAGGG + Intergenic
1191630387 X:63315429-63315451 ATTGATGGGCCCACTAAGTAGGG - Intergenic
1191955627 X:66639783-66639805 ACTCAGGGGCCCAGAGAAGATGG - Intergenic
1192209787 X:69120511-69120533 TCTGAGGAGCCCTCTGAGGCAGG - Intergenic
1195178449 X:102333561-102333583 ACTGAGGAGCTCACTGAGCCAGG - Intergenic
1195180415 X:102353522-102353544 ACTGAGGAGCTCACTGAGCCAGG + Intergenic
1198635952 X:138700550-138700572 AATGAAGTGCCCACTGAGGATGG + Intronic
1199997270 X:153033142-153033164 TCTGTGGGGCTCAGTGAGGAGGG + Intergenic
1201337181 Y:12893609-12893631 ACTGAGGGGGCTTCTCAGGAAGG + Intergenic
1202147697 Y:21817166-21817188 ACTGAGGGCCCAACTGTGGTTGG - Intergenic