ID: 950131756

View in Genome Browser
Species Human (GRCh38)
Location 3:10552146-10552168
Sequence CACGGCCGCCGCCTCGGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950131749_950131756 -2 Left 950131749 3:10552125-10552147 CCGGAGAGGGAACACCCTTCCCA 0: 1
1: 0
2: 4
3: 23
4: 242
Right 950131756 3:10552146-10552168 CACGGCCGCCGCCTCGGTGCCGG 0: 1
1: 0
2: 1
3: 13
4: 153
950131745_950131756 19 Left 950131745 3:10552104-10552126 CCTGTGGCAGCATTTCTGCAGCC 0: 1
1: 0
2: 1
3: 16
4: 198
Right 950131756 3:10552146-10552168 CACGGCCGCCGCCTCGGTGCCGG 0: 1
1: 0
2: 1
3: 13
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950131756 Original CRISPR CACGGCCGCCGCCTCGGTGC CGG Intronic
900512971 1:3069047-3069069 CGCCGCCGCCGCCTCGGCGCGGG - Intergenic
901071297 1:6520104-6520126 CACCGCAGCCGCCTCAGGGCCGG + Intergenic
903067047 1:20705526-20705548 CAAAGCCGCTGCCTCTGTGCCGG + Intronic
903115535 1:21176309-21176331 CGCCGCCGCCGCTCCGGTGCCGG + Exonic
910448995 1:87328536-87328558 CGCCGCCGCCGCCTCCGAGCCGG + Exonic
910787997 1:91021660-91021682 GGCGGCCGCCGCCGCGGGGCGGG - Intronic
914386275 1:147172648-147172670 CGCCGCCGCCGCCTCGATGGTGG + Intergenic
915572369 1:156751529-156751551 CGCGGCCCCCGCCTCGATGGTGG + Intronic
920528340 1:206684909-206684931 CGCGGCCGCCGGCCCGGGGCTGG + Intergenic
921060226 1:211578895-211578917 CACCGCCGCCGCCTGGGTGTGGG - Intergenic
921155066 1:212432953-212432975 CGCAGCCGCCGCCGCGGCGCGGG - Exonic
921866764 1:220094485-220094507 TACGGGCCCCGCCTCGGCGCGGG + Intronic
922739343 1:228006816-228006838 CAACGCCGCCGCCGCGGTTCGGG + Intergenic
1063458518 10:6201596-6201618 CCCGGTCGCCGCCTGGGCGCGGG + Intronic
1066464523 10:35640838-35640860 CCCTGCCGCCGCCGCGGTGCGGG + Exonic
1072253704 10:93601142-93601164 CGCGGCCGGGGCCTCGGGGCCGG - Intronic
1076737186 10:132464162-132464184 CACGGCCCCCAGCTCGGTGATGG - Intergenic
1076816848 10:132919255-132919277 CACGGCCGCCCTCTGGGTGTGGG - Intronic
1077058432 11:607234-607256 CACAGGCGCCCCCGCGGTGCGGG - Exonic
1083613464 11:64015249-64015271 CACCGCCACCGCCTCCGAGCAGG + Exonic
1083952172 11:65962776-65962798 CACTGCTGCTGCCTTGGTGCAGG - Intronic
1084494808 11:69497647-69497669 CACTGCAGCAGCCTCTGTGCAGG + Intergenic
1084507002 11:69574649-69574671 CACTTCTGCCACCTCGGTGCTGG - Intergenic
1084519261 11:69653595-69653617 CACGCACGCGGCCTCGGGGCCGG - Exonic
1084520508 11:69659801-69659823 CACGGCGGCCGCCTGGGTGGTGG + Intronic
1086064655 11:82732887-82732909 CAAGACTGCCGCCTCCGTGCCGG + Exonic
1089556367 11:119317642-119317664 CACTGCCTCAGCCTCAGTGCTGG + Intronic
1092196928 12:6555407-6555429 CACGCCCGCCGGCTCGGGCCGGG - Exonic
1095261597 12:40105313-40105335 CACCGCCGGCTCCGCGGTGCTGG - Exonic
1096106550 12:48999494-48999516 CACGGCCGCCCCCTGGGGCCCGG + Intergenic
1096134591 12:49188801-49188823 CCCCGCCGCCGCCGCAGTGCGGG - Intronic
1097854882 12:64452063-64452085 GACGGCCGGCGCGCCGGTGCGGG - Exonic
1102518307 12:113464496-113464518 TACGGCCGCCGCGTCGATCCCGG + Intronic
1103649638 12:122422634-122422656 CGCCGCCGCCGCCGCGGGGCCGG + Intergenic
1105270898 13:18874962-18874984 CCCGGCGGCCACCGCGGTGCAGG - Intergenic
1106422589 13:29595813-29595835 CCCGGCCGCAGCCTCTGGGCTGG - Intergenic
1107467842 13:40665931-40665953 CACCGCCGCCGCCACGGAGCCGG + Exonic
1112402181 13:99086670-99086692 CCGGGCCGCCTCCTCGGGGCGGG + Intergenic
1113789913 13:113022765-113022787 CTCAGCCGCCGCCGCGGTGGGGG - Intronic
1119027473 14:71165518-71165540 CATGGCCGCAGCCCCTGTGCTGG + Intergenic
1124500461 15:30223338-30223360 CCGGGCCGCCACCTCGCTGCCGG - Intergenic
1124629167 15:31327310-31327332 CACGGCCGCGCCCTCGGGCCGGG - Exonic
1124743113 15:32315329-32315351 CCGGGCCGCCACCTCGCTGCCGG + Intergenic
1124971146 15:34490544-34490566 CGCCGCCGCCGCCTCCGTGCTGG + Intergenic
1125462409 15:39919949-39919971 CACACCCGCAGCCTCGGCGCCGG + Exonic
1126436913 15:48645893-48645915 GCCAGCCTCCGCCTCGGTGCGGG + Intergenic
1126738105 15:51751774-51751796 CACGGCGGCCACCGCGCTGCGGG - Intronic
1129386708 15:75200483-75200505 CAGGGTCGCCGGCGCGGTGCTGG + Intronic
1130015880 15:80186055-80186077 CACTGCCGCTGCCTAGGTGTTGG + Intronic
1130527076 15:84716390-84716412 CTGGGTCGCCGCCTCGGTGAAGG - Intronic
1131635803 15:94231712-94231734 CACGGTCGCCGCCTGGGGGTGGG + Intronic
1131693879 15:94855567-94855589 CGCCGCCGCCGCCTCAGCGCTGG - Intergenic
1132848057 16:2009733-2009755 CCCGGCCGCCGCCATGGTCCGGG + Exonic
1135565852 16:23510416-23510438 CGCGGCCGCAGCGTCGGGGCTGG - Exonic
1142271844 16:89093968-89093990 GACGGCCGCGGCCACGGGGCAGG - Exonic
1147200632 17:38799386-38799408 CACCGCCACCGCCGTGGTGCTGG + Exonic
1147891520 17:43720758-43720780 CTGGGCCTCCGCCTCCGTGCTGG + Intergenic
1148356381 17:46978544-46978566 CTCTGCCGCCGCCTCCGGGCGGG - Exonic
1148843595 17:50515221-50515243 CACGCCCGCCGACTCAGGGCTGG + Intronic
1150003657 17:61456655-61456677 CGCCGCCGCCGCCGCGGAGCAGG + Exonic
1151478676 17:74357470-74357492 CACGGCGCCCCACTCGGTGCTGG + Exonic
1151537944 17:74749212-74749234 GCCGGCCGCCGCCGAGGTGCAGG + Exonic
1151797071 17:76353550-76353572 CACGGCCGCCTGCACGGAGCTGG - Exonic
1152398305 17:80048658-80048680 CATGGCCCCCTCCTCGGTGCTGG - Exonic
1157473733 18:48008423-48008445 CCCGGCCCCCGCCTCGCAGCTGG + Intergenic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
1159798225 18:72868200-72868222 CGCGGCCGGCGCCCCGGGGCTGG + Intergenic
1161212739 19:3076090-3076112 CACGGGCGCCGCGTGGGTGGGGG - Intergenic
1162318191 19:9953975-9953997 CCGGGCAGCCGCCTGGGTGCTGG + Intergenic
1163471670 19:17500799-17500821 CACGCCCTCCACCTCGGTGGTGG - Exonic
1165459512 19:35936458-35936480 CCCGGCCCCCGCCTCGGCCCCGG + Intronic
1165850875 19:38849741-38849763 CACCGCCGCCGCCTCCGTGCTGG + Exonic
1167157123 19:47745653-47745675 CGCCGCCGCCGCCTCAGCGCTGG - Exonic
1168288769 19:55347125-55347147 CACAGCCTCCCCATCGGTGCAGG - Exonic
926892395 2:17649674-17649696 CACGGCAGCCTCCTAGGTGCAGG + Intronic
927141888 2:20136401-20136423 CACTGCCCCCGCCTCACTGCAGG - Intergenic
929983220 2:46699572-46699594 CGCTGCCTCCGCCGCGGTGCGGG - Intronic
932611483 2:73203110-73203132 CACTGCCGGCGCCCCAGTGCAGG + Intronic
935592778 2:104856383-104856405 CGCCGCCGCCGCCGTGGTGCGGG - Exonic
943580119 2:189674582-189674604 CACTGCCGCCGCCCGGGCGCGGG - Intronic
945225939 2:207530632-207530654 GGCAGCCGCCGCCTAGGTGCCGG + Intronic
947589876 2:231379500-231379522 CACAGCAGCCGCCTCCTTGCTGG - Intergenic
948824718 2:240568618-240568640 GACGGGCGCGGCCTCGGCGCCGG - Intronic
949004271 2:241636767-241636789 CCCGGCCGCCGTCTCTGGGCCGG - Intronic
1169074458 20:2752428-2752450 TACGGCGGCGGCCTCGGAGCTGG + Exonic
1169214732 20:3786516-3786538 CGCCGCCGCCGCCCCGGGGCGGG + Exonic
1169244540 20:4015386-4015408 CGCGGCCGCCGCCCCCGGGCTGG - Intronic
1171847737 20:30287679-30287701 CAGGGCCGCTGCCTCGCCGCAGG + Intergenic
1172661810 20:36573699-36573721 CGCGGCCTCCGGCTCGGCGCGGG - Intronic
1173576521 20:44115859-44115881 CCCGGCCACCGCCCCGCTGCAGG - Exonic
1175036063 20:56003271-56003293 CACTGCCGCTGCCTCGGAGTAGG - Intronic
1175358616 20:58389548-58389570 CGCGGCCTCCGCCCCAGTGCTGG + Intronic
1176867926 21:14064016-14064038 CCCGGCGGCCACCGCGGTGCAGG + Intergenic
1178992371 21:37366685-37366707 CCCGCCCGCCGGCTCGGGGCTGG + Intronic
1179561539 21:42219054-42219076 CCCGCCCGCCCCCTTGGTGCCGG + Intronic
1179960130 21:44763525-44763547 CATGGCCCCAGCCTCTGTGCGGG - Intergenic
1181017670 22:20080471-20080493 CCCGCCCGCGGCCTCGGTCCCGG - Intronic
1181333699 22:22114716-22114738 CACAGCCCCCGGCTCGGGGCAGG + Intergenic
1181934648 22:26429693-26429715 AAGCGCCGCCGCCTCGGAGCCGG + Intronic
1184357879 22:43994651-43994673 CACGGCCGCTGTCTTGGTGCAGG - Intronic
1184827884 22:46965414-46965436 GACGGCCCCCGTCTCGGTACCGG + Intronic
1185246559 22:49776106-49776128 TGATGCCGCCGCCTCGGTGCTGG - Exonic
950131756 3:10552146-10552168 CACGGCCGCCGCCTCGGTGCCGG + Intronic
953485080 3:43286931-43286953 CGCGGCCGCCGCCGCAGTGACGG - Intronic
955226509 3:57064555-57064577 AACATCCGCCTCCTCGGTGCTGG + Intronic
958980014 3:100709685-100709707 CGCGGCCGCCGCCTCTCCGCAGG - Exonic
963160788 3:142149271-142149293 CCCGGCCGCCGCCTAAGCGCGGG - Exonic
967556338 3:190863037-190863059 CCCGGCCCTCGCCTCGGTCCCGG - Intronic
968372729 4:10881-10903 GACGGACGCCGCCGCGGCGCAGG + Intergenic
968372734 4:10910-10932 GACGGACGCCGCCGCGGCGCAGG + Intergenic
968372739 4:10939-10961 GACGGACGCCGCCGCGGCGCAGG + Intergenic
968372744 4:10968-10990 GACGGACGCCGCCGCGGCGCAGG + Intergenic
968433905 4:575501-575523 CTCGGCCCCCGGCTCGGCGCCGG - Intergenic
968612886 4:1565009-1565031 CTCGGCAGCTGCCTGGGTGCAGG + Intergenic
971308591 4:25505216-25505238 CACGCTCACCGCCGCGGTGCTGG + Intergenic
979547275 4:121951977-121951999 CATCGCCGCCGCCGCGGGGCTGG - Intergenic
982235677 4:153249286-153249308 CTCGGCTCCCGCCTCGGGGCGGG + Intronic
983649686 4:170026158-170026180 CTCGGCCGCCGACCCGGTGCGGG + Intronic
984992638 4:185396286-185396308 CGCTGCTGCCGCCTCGGCGCCGG - Intronic
985462652 4:190121598-190121620 GACGGACGCCGCCGCGGCGCAGG - Intergenic
985462662 4:190121656-190121678 GACGGACGCCGCCGCGGCGCAGG - Intergenic
985462667 4:190121685-190121707 GACGGACGCCGCCGCGGCGCAGG - Intergenic
985462672 4:190121714-190121736 GACGGACGCCGCCGCGGCGCAGG - Intergenic
985462677 4:190121743-190121765 GACGGACGCCGCCGCGGCGCAGG - Intergenic
986337738 5:6767725-6767747 CAAGGCCTCCGCATTGGTGCTGG + Intergenic
992365174 5:76083450-76083472 CACTGCAGCCGCCTCAGTGCGGG - Exonic
992487573 5:77210834-77210856 CGCGGCCGCCCCCTCACTGCAGG + Intronic
996862756 5:128084062-128084084 CACGGCTGTGCCCTCGGTGCCGG + Exonic
998097371 5:139403854-139403876 CACGGCCCCCGCATCGGAACAGG + Intronic
1001928740 5:175658160-175658182 CGCGGCCGCCGCCTCCCCGCGGG + Intronic
1002456016 5:179345649-179345671 CGCCGCCGTCGCCGCGGTGCCGG + Intergenic
1002558518 5:180063264-180063286 CACGGCTGCCGCCTTAGTTCAGG - Intronic
1002722757 5:181273490-181273512 CCCGGCGGCCCCCGCGGTGCAGG - Intergenic
1007558245 6:42783674-42783696 CGAGGCCGCCGGCTCGGAGCGGG + Intronic
1008649065 6:53544942-53544964 CGCCGCCGCCGCATCGGAGCGGG - Exonic
1015626346 6:135183112-135183134 CTCGGCCGCCCCCGCGGGGCGGG + Intronic
1019474251 7:1236437-1236459 CGCCGCCGCCGCCGCGGGGCTGG + Exonic
1020098646 7:5382294-5382316 CACTGCCGCCCCCTCTCTGCAGG + Intronic
1020418128 7:7969164-7969186 CACCCCCGCCGCCTCGGCGAGGG - Exonic
1026852825 7:73735626-73735648 CACAGCCCCCGCCTCAGTGAAGG - Intergenic
1027263376 7:76480550-76480572 CACGGCCACAGCCGCGGGGCTGG - Exonic
1029472792 7:100765152-100765174 CAGGGCCGGCGCCTTAGTGCTGG + Intronic
1029506479 7:100966467-100966489 GACGGCCGGCGCCGCGCTGCTGG + Exonic
1029569918 7:101362757-101362779 CACTGCCGCCTCCTCGGCCCCGG + Intergenic
1031406719 7:121395923-121395945 CCCGGCCGCCGCCCCGGCGTGGG - Intronic
1034257095 7:149730547-149730569 TACTGCAGCGGCCTCGGTGCAGG + Exonic
1034266954 7:149785684-149785706 CACGGCCAGCGCTTTGGTGCAGG - Intergenic
1034342728 7:150368716-150368738 CGCGGCCGCGGCCTGGGGGCGGG - Intronic
1034977671 7:155457775-155457797 CGCGGCCGCCGCCCCGCTGCGGG - Intergenic
1035580524 8:737179-737201 TGCGGCCGCCGCTTGGGTGCTGG - Intronic
1038883623 8:31640133-31640155 CGCGGGAGCCGCCTCGTTGCCGG - Intronic
1039454392 8:37697653-37697675 CACGGCTGCCGGCTCCGGGCTGG - Exonic
1039463104 8:37762492-37762514 GATGGCCGCCGCCTGGGGGCGGG + Intergenic
1039542294 8:38382206-38382228 CTCGGCCTCCGCCTCCGTGCTGG + Exonic
1042040033 8:64580726-64580748 CGCCGCCGCCGCCTCGGCCCCGG - Exonic
1043502787 8:80873795-80873817 CGCCGCCGCCGCCTCGTCGCCGG - Intronic
1045547365 8:103140795-103140817 CGCCGCCGCCGCCTCCTTGCGGG + Exonic
1049109600 8:140635124-140635146 CGCGGCGGCCGCCTCGGCCCCGG + Intronic
1049769851 8:144374712-144374734 CCCGCCCGCCGCCTCAGGGCAGG - Intronic
1058885808 9:109320594-109320616 CGCGGCCTCGGCCTCGGCGCGGG - Exonic
1060970569 9:127735180-127735202 CGCGGCCGCCGCCTGGGACCTGG - Exonic
1061196878 9:129111410-129111432 GACGGCCGCCATGTCGGTGCGGG - Exonic
1061257448 9:129460789-129460811 CCCGGCCGCTGCCTGGGTTCTGG + Intergenic
1062294642 9:135817941-135817963 GACGGCCGCCGGCACGGGGCTGG - Intronic
1189407118 X:40735355-40735377 CCCCGCCGCCGCCTCCGGGCGGG + Exonic
1192230957 X:69264611-69264633 CCAGGCTGCCGCCTCGTTGCTGG - Intergenic
1197199009 X:123732827-123732849 CACGCCCGCCGCCCGGGTGGGGG + Intronic
1200068790 X:153517842-153517864 CACGGCCGCCGCCGCGGCCTCGG - Intronic