ID: 950132145

View in Genome Browser
Species Human (GRCh38)
Location 3:10554573-10554595
Sequence CATTCCTTCTGGAGGCTGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1174
Summary {0: 1, 1: 3, 2: 36, 3: 196, 4: 938}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950132145_950132151 2 Left 950132145 3:10554573-10554595 CCCCGCAGCCTCCAGAAGGAATG 0: 1
1: 3
2: 36
3: 196
4: 938
Right 950132151 3:10554598-10554620 GCTCTGCCTCGATTTCAGCCCGG 0: 1
1: 0
2: 0
3: 6
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950132145 Original CRISPR CATTCCTTCTGGAGGCTGCG GGG (reversed) Intronic
900703341 1:4061311-4061333 TGTTCCTTCTGGAGGCTCCAGGG - Intergenic
900783757 1:4634469-4634491 CACACCTTCTGGAAGCTGAGAGG - Intergenic
902096055 1:13946956-13946978 CATTCTCTCTGGAGGCTTGGGGG + Intergenic
902221343 1:14967786-14967808 CCTTTCTTCTGGAGGCTCTGGGG - Intronic
902256353 1:15191256-15191278 TGTTCCTTCTGGAGGCTTCAGGG - Intronic
902567237 1:17320111-17320133 TATTCCTTCTGGAAGCTCCAGGG + Intronic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
902963532 1:19981301-19981323 GATTCCTTCTGAGGGCTGTGAGG - Intergenic
903595507 1:24490830-24490852 CATTCCTTCAGGTGGGTTCGTGG - Intergenic
903805246 1:26000586-26000608 TGTTCCTTCTGGAGGATGGGTGG - Intergenic
904028555 1:27519976-27519998 CACTCCTTCGGGAGGCAGCATGG + Intergenic
904648334 1:31985513-31985535 CATTCTTTTTGGTGGCTGTGTGG - Intergenic
904850337 1:33454595-33454617 GGTTCCTTCTGGGGGCTGTGCGG - Intergenic
904916260 1:33972673-33972695 GATTCCTTCTGGAGGCTCTAGGG - Intronic
904982802 1:34521145-34521167 AATTCCTTCTGGAGGCTCCAGGG + Intergenic
905255467 1:36679280-36679302 CATTCCTTCTGGAGTCTCCTTGG + Intergenic
905526368 1:38643028-38643050 CATTCCTTTTGGAGGCTCTTTGG - Intergenic
905541214 1:38762012-38762034 CATTCCCTCTAGAGGCTCCGGGG + Intergenic
905586783 1:39126201-39126223 GATTCCTTGTGAAGGCTGTGAGG + Intronic
905855384 1:41308134-41308156 CATTCCTTCTGGGGGCTCTAGGG + Intergenic
905956020 1:41996814-41996836 CATTCCTTCTGAAGACTCAGGGG + Intronic
906272821 1:44494520-44494542 CATTCATTTTGGTGGCTGCCTGG - Intronic
906356580 1:45111580-45111602 CATTCCTTCTGGAGGCTCTAGGG + Intronic
906877470 1:49554885-49554907 CGTTCCTTCTGGTGGGTTCGTGG + Intronic
907562775 1:55406107-55406129 GGTTCCTCCTGGAGGCTCCGAGG - Intergenic
908179668 1:61591446-61591468 GATTCCTTCTGCGGGCTGTGAGG + Intergenic
909516158 1:76509673-76509695 CATTCCTTCTGGAAGATCCAAGG + Intronic
909608581 1:77531153-77531175 TATTCCTTCTGGTGGGTTCGTGG + Intronic
909686374 1:78353877-78353899 CATTCTTTCTGGAAGCTGTAGGG + Intronic
910365475 1:86460441-86460463 CATTCCTGGTGGAGGGTGGGGGG + Intergenic
910393419 1:86767870-86767892 CATTCTTTCTAGAGGCTCTGAGG + Intergenic
911236209 1:95415165-95415187 CATTCCTTCTGGAGGCTCCAGGG + Intergenic
911252963 1:95599431-95599453 CATTGCTTCTGGAGGCTTTAGGG - Intergenic
911365645 1:96934441-96934463 CATTCCTTCTGCAGGCTCTAGGG + Intergenic
911367318 1:96954287-96954309 CATTCCCTCTGAAGGCTCTGGGG + Intergenic
911462339 1:98206478-98206500 GATTCCTTCTGGAGGCTCTAGGG + Intergenic
911740510 1:101382217-101382239 CATTCGTTCTGGAGACTCCAGGG + Intergenic
912109024 1:106317228-106317250 CATTCCTTCTGAAGGCTTTAGGG - Intergenic
912254960 1:108048910-108048932 CATTCCTTCTGGAGGCTCTAGGG - Intergenic
912881403 1:113419812-113419834 CATTCCTTCTGGAGGCGCTAGGG + Intronic
912959413 1:114181807-114181829 GATTCCTTCTGGGGCCTGTGAGG + Intergenic
913071689 1:115304675-115304697 GCCTCCTTCTGGAGGCTGAGAGG - Intronic
913124627 1:115773492-115773514 CATTCCTCCTGGAGGCTTTCAGG - Intergenic
914419621 1:147517456-147517478 CATTCCTTCTGGTGGGTTCTTGG + Intergenic
914991958 1:152506551-152506573 TATTCCTTCTGGAGGCTCTAGGG + Intergenic
915267854 1:154731652-154731674 CATCTCTTCTGGAGGCAACGGGG + Intronic
916199967 1:162261678-162261700 CGTTCCTTCTGGAGGCTATGGGG - Intronic
916292772 1:163184802-163184824 CATTCCTCCTGGAGGTTCTGGGG - Intronic
916328235 1:163587714-163587736 TATTCCTTCTGGAGGCTCTAGGG + Intergenic
916534963 1:165695261-165695283 GAATCCTTTTGGAGGCTGCCAGG - Exonic
916930769 1:169576099-169576121 CATTCCTTCTGGAGGCTCTGGGG - Intronic
917386523 1:174482204-174482226 CATTCCTTTTGGAGGCTCTGGGG - Intronic
917493017 1:175514356-175514378 CATTCTTTCTGGAGGCTCTCGGG - Intronic
917675144 1:177311744-177311766 CCTTCCTTTTTGAGGCTGCCTGG - Intergenic
917794591 1:178523805-178523827 CATTCCTTCTGGAAGCTCTAGGG + Intronic
917839764 1:178968223-178968245 CCTTCCTTCTGGAGGCTCTAAGG - Intergenic
918295498 1:183152377-183152399 CATTCTATCTGGAGGCTCTGGGG - Intergenic
918696273 1:187550462-187550484 CCTTCCTTCTGGCGGATTCGTGG + Intergenic
918770012 1:188545140-188545162 TGTTCCTTCTGGAAGCTGAGAGG + Intergenic
918793338 1:188858886-188858908 CATTCCTCCTGGTGGGTTCGTGG - Intergenic
919086957 1:192931950-192931972 CATTCCTTCTGGAAGCTTCAGGG + Intergenic
919419584 1:197354592-197354614 TATTCCTCCTGGAGGGTTCGTGG + Intronic
919500849 1:198336682-198336704 GATTCCTTCTGGAGGCTCTAGGG + Intergenic
920136243 1:203771538-203771560 AATTGCTTCTGGAGGGTGAGAGG - Intronic
920665707 1:207961382-207961404 TGTTCCTTCTGGAGGCTCTGGGG + Intergenic
920702127 1:208225819-208225841 GATTCCTTCTGATGGCTGTGAGG - Intronic
921537076 1:216364715-216364737 GGTTCCTTCTGGAGGCTCTGAGG - Intronic
921724448 1:218508264-218508286 CATTCCTCCTGGTGGGTTCGTGG + Intergenic
922564964 1:226595835-226595857 GAGTCCTTCTGGAGGCTCCAGGG - Intronic
922871505 1:228905667-228905689 CATTCCTTTTGGAGGCTCTAGGG - Intergenic
923324655 1:232870756-232870778 TCTTCCTTCTGGTGGCTTCGTGG + Intergenic
923514983 1:234689291-234689313 CATAGTTTCTGGAGGCTGCAAGG + Intergenic
923548337 1:234941211-234941233 CGTTTCTTCTGGAGGCTCCAAGG + Intergenic
924036886 1:239946618-239946640 GGTTCCTTCTGGGGGCTGTGAGG - Intergenic
924041854 1:239991823-239991845 GGTTCCTTCTGGGGGCTGTGAGG + Intergenic
924214754 1:241809523-241809545 CGTTCCTGCTGGAGGCTCCAGGG - Intergenic
924322061 1:242860297-242860319 AGTTCCTTCTGGAGGCTCTGGGG - Intergenic
1063320867 10:5052112-5052134 TATTCCTTCTGGTGGGTGCATGG + Intronic
1063322041 10:5059979-5060001 TATTCCTTCTGGTGGGTGCATGG + Intronic
1063322053 10:5060080-5060102 CATTCCTCCTGGTGGGTTCGTGG + Intronic
1064018488 10:11791102-11791124 CATTCCTTCTGGAAGCTCGAGGG + Intergenic
1064442305 10:15364701-15364723 CATTCCTTCTGGAGGCTCTAGGG + Intronic
1064477577 10:15707441-15707463 CATTCCTTCTGGAAGCTCTTGGG - Intronic
1064618296 10:17186545-17186567 CATTCCTTCTGGAGGTTCTAGGG - Intronic
1065694944 10:28371118-28371140 CATTGCTTCTGGAAGCTCAGTGG + Intergenic
1065983712 10:30929427-30929449 CATTCCTCCTGGTGGGTTCGTGG + Intronic
1066665013 10:37774133-37774155 CATTTCTTCTGGTGGCTGTCAGG - Intergenic
1067309815 10:45102298-45102320 CATTCCTTCTGGAAGTTTCAGGG + Intergenic
1067980688 10:51081116-51081138 CATTCCTTCTGGAGGCTCTAGGG + Intronic
1068105948 10:52616537-52616559 CCTTCCTTTTGGAGGCTGTAAGG + Intergenic
1068859242 10:61830078-61830100 GATTCCTTCTGCAGGCTGTGAGG - Intergenic
1069280661 10:66650643-66650665 TATTCCTTCTGGTGGGTTCGTGG + Intronic
1069344920 10:67457675-67457697 CGTTCCTTCTGGAGGCTTTAGGG + Intronic
1069869548 10:71524860-71524882 CGTTCCTTCTGGAGGCTCCAAGG - Intronic
1069971209 10:72171281-72171303 CATTCCTTGCGGAGGCTCCAGGG + Intronic
1070566555 10:77607709-77607731 GGTTCCTTCTGGAGGCTCTGAGG - Intronic
1072200012 10:93149883-93149905 CATTCCTTCTGGAGGCTCTAAGG + Intergenic
1072304125 10:94090527-94090549 CCTTCCTTATGGAAGGTGCGGGG + Intronic
1072489881 10:95894604-95894626 CATTCCTTGTTGTGGCTGAGTGG - Intronic
1072669936 10:97421971-97421993 GATTCCTTCTGGAGGCAGAGGGG + Intronic
1072910522 10:99496932-99496954 GGTTCCTTCTGGAGGCTCCAGGG - Intergenic
1073265057 10:102222481-102222503 CATTTCTTCTGGAGGTGGCATGG - Intergenic
1073298516 10:102456184-102456206 CATCCCTTCTGGAGGCTCCAGGG - Intergenic
1073360088 10:102891283-102891305 CATTCCTGGTGGAGTCGGCGCGG + Intronic
1073395525 10:103214214-103214236 CATTCCTTCTGGAGACTCTGGGG - Intergenic
1073396298 10:103220948-103220970 CAGTACTTCAGGAGGCTGAGTGG + Intergenic
1073615494 10:104990825-104990847 CATTCCTTCTGGAGGCTCCAGGG - Intronic
1074389109 10:113042184-113042206 CATTCCTTCCAGAGCCTGTGTGG + Intronic
1074732619 10:116394340-116394362 TCTTCCTTCTGGTGGCTTCGTGG - Intergenic
1074771373 10:116736738-116736760 TATTCCTTCTGGAGGCTCTAGGG - Intronic
1075262335 10:120973999-120974021 CATTCCTTCTGTAGGCTCTAGGG + Intergenic
1075699421 10:124459537-124459559 CATTCCTTCTGGAGGCTCTAGGG + Intergenic
1076273743 10:129178688-129178710 GGTTCCTTCTGGAGGCTCAGAGG + Intergenic
1076303074 10:129442425-129442447 GGTTCCTTCTGGAGGCTCCAAGG - Intergenic
1076431988 10:130410505-130410527 TGTTCCTTCTGGAGGCTCCAGGG + Intergenic
1076432260 10:130412622-130412644 CATTCATCCTGGAGGCTACAGGG + Intergenic
1076827500 10:132976720-132976742 CCTTCCTTCTGGGGGCTCCAGGG + Intergenic
1077167367 11:1149871-1149893 CCTTCCTTTTGGGGGCTGCTTGG + Intergenic
1077288138 11:1776646-1776668 GGTTCCTTCTGGAGGCTCCAGGG + Intergenic
1077447255 11:2602186-2602208 GGTTCCTTCTGGAGGCTTCAGGG - Intronic
1077485309 11:2835795-2835817 CCTTCCTCATGGAGGCGGCGGGG + Intronic
1077546293 11:3171615-3171637 GGTTCCTTCTGGAGGCTCTGGGG + Intergenic
1078024375 11:7680656-7680678 GATTCTTTCTGGAGGCTCTGAGG - Intergenic
1078424934 11:11241824-11241846 AGTTCCTTCTGGAGGCTTAGAGG - Intergenic
1078874060 11:15376286-15376308 CATTCCCTCTGGAGTCTGAGGGG + Intergenic
1079946683 11:26751626-26751648 CATTCCTTCTAGAGGCTCCAGGG - Intergenic
1080131506 11:28801057-28801079 GATTCCTCCTGGAGGCTCCAGGG + Intergenic
1080228410 11:29987093-29987115 TATTCCTTCTGGAGGCTCTAGGG - Intergenic
1080799198 11:35593809-35593831 GCTTCCTTCTGGAGGCTCTGGGG + Intergenic
1081046268 11:38278030-38278052 CATTCCTCCTGGTGGGTTCGTGG + Intergenic
1081421080 11:42875137-42875159 CATTCCTTCTGGTGGGCTCGTGG - Intergenic
1081602582 11:44505549-44505571 CATTCCTCCTGAAGGCTCCAGGG - Intergenic
1081653113 11:44838744-44838766 CGTTCCTTTTGGAGGCTCCAGGG - Intronic
1081678244 11:44983587-44983609 GGTTCCTTCTGGAGGCCCCGGGG - Intergenic
1082924767 11:58532957-58532979 CATTCCTCCTGGTGGATTCGTGG - Intronic
1083149329 11:60782079-60782101 AGTTCCTTCTGGAGGCTCCAGGG + Intergenic
1083362055 11:62116603-62116625 CACTCCCTCTGGAGGCTGGGAGG + Intergenic
1083402093 11:62430600-62430622 CATTCTTTCTGGAGTCTCCAGGG + Intergenic
1083785098 11:64940369-64940391 CACTCCTTCTGGGAGCTGGGGGG + Intronic
1083983157 11:66191102-66191124 TGCTCCTTCTGGAGGCTGCAAGG + Intronic
1084487476 11:69457447-69457469 CATTCCTTCTGAAGACTTCAGGG - Intergenic
1084624980 11:70299555-70299577 CTTCCCTTCTGGATGCTCCGGGG + Intronic
1084643982 11:70443714-70443736 CCTTCCTGCTGGAGGCTCCCGGG - Intergenic
1084696681 11:70759941-70759963 GGTTCCTTCTGGAAGCTCCGAGG - Intronic
1084724143 11:70929463-70929485 CATTCCTCCTGGAGGCAGTAAGG + Intronic
1085299653 11:75450610-75450632 GCTTTCTTCTGGAGGCTGCAAGG - Intronic
1085455002 11:76660668-76660690 CATTCCCGCTGGGGGCTGAGAGG + Exonic
1085673158 11:78488474-78488496 CATTCCTCTTGGAGGCTTCAGGG - Intronic
1085979783 11:81710354-81710376 CATTTCTTCTGGAGGCTCTAAGG + Intergenic
1086311167 11:85537639-85537661 CATTCCTTCTGGTGGGTTCGTGG - Intronic
1087157775 11:94921712-94921734 CCTTCCTTCTGGAGGCTCTAGGG + Intergenic
1087271780 11:96119441-96119463 CCTTCCTTCTGGAGGCTCTAGGG - Intronic
1087629812 11:100636892-100636914 CATTTCTCCTGGTGGCTGAGAGG - Intergenic
1087683656 11:101240473-101240495 CATTCCTCCTGGTGGGTTCGTGG + Intergenic
1088161648 11:106878835-106878857 CATTACTTCTGGAAGCTCCAGGG - Intronic
1088254138 11:107887078-107887100 GATTCCTTCTGGATGCTCTGTGG - Intronic
1088502335 11:110494951-110494973 AATTCCTTCTGGAGGCTCTGAGG + Intergenic
1088893786 11:114063247-114063269 CTTTCCTTCTGGGCTCTGCGTGG - Exonic
1088966551 11:114727992-114728014 GATTCCTTCTGGAGACTGTACGG + Intergenic
1088981997 11:114872222-114872244 CATTCCTTCTGGAGGCTTCAGGG - Intergenic
1089336773 11:117730366-117730388 CATTCTTTCTGGAGGCTGTAGGG - Intronic
1089571837 11:119416356-119416378 CAGGCCTTGTGGAGGCTGTGGGG - Intergenic
1089592679 11:119554627-119554649 CATTACTTCTGACGGCTGCGTGG - Intergenic
1090557969 11:127897678-127897700 CTTTCCTTCTGGTGGGTTCGTGG + Intergenic
1090583713 11:128187452-128187474 GGTTCCTTCTGAGGGCTGCGAGG - Intergenic
1090700136 11:129287006-129287028 CCTTCCCTCTGGAGCCTTCGTGG - Intergenic
1091363029 11:134993276-134993298 CACTCCTTCTGGAGGCTTTGGGG - Intergenic
1091891498 12:4058588-4058610 AATTCCTTCTGGGGGCTCTGAGG + Intergenic
1091996820 12:5000426-5000448 CATTCTGTCTGGAGGCTCCATGG + Intergenic
1092340092 12:7668246-7668268 CATTTCTTCTGGAGGCTCTGGGG - Intergenic
1092519990 12:9260739-9260761 CATTCCTGCTGGAGCTTGAGGGG - Intergenic
1093002388 12:14011912-14011934 CACTCCATCTGAAGGCTGCAGGG - Intergenic
1093172497 12:15875633-15875655 CCTTCCTTCTGGTGGGTTCGTGG - Intronic
1093421230 12:18977273-18977295 GGTTCCTTCTGGAGGCTCGGAGG + Intergenic
1093516347 12:19990962-19990984 CATTTCTTCTGGAGGCTTGAGGG - Intergenic
1093684210 12:22038166-22038188 AGTTCCTTCTGGAGGCTCCAGGG + Intergenic
1093786631 12:23199302-23199324 GATTCCTTCTGGAGGTTTAGGGG - Intergenic
1093827595 12:23713266-23713288 TATTCCTTCTGGAGGCTCTGAGG - Intronic
1093908633 12:24720892-24720914 TATTCCTTGTGGAGGCTCCAAGG - Intergenic
1094110652 12:26858775-26858797 CGTTCCCTCTGGAGGCTCTGGGG - Intergenic
1094440281 12:30468075-30468097 GATTCTTTCTGGAGGCTCTGAGG + Intergenic
1094732941 12:33199569-33199591 CATTCCTCCTGGTGGGTTCGTGG - Intergenic
1096085781 12:48864321-48864343 CAGTGCTGCTGGAGGCAGCGTGG - Intronic
1096222009 12:49836113-49836135 TGTTCCTTCTGGAGGCTTCAGGG + Exonic
1096759988 12:53833224-53833246 GATTCCTTCTGAGGGCTGTGAGG - Intergenic
1097976616 12:65693330-65693352 CATACCTTCTGGAGGCTGGAGGG + Intergenic
1098030602 12:66249597-66249619 CATTCTTTCTGGAGGCTGTTGGG + Exonic
1098498594 12:71165415-71165437 CATTCCTCCTGGTGGGTTCGTGG + Intronic
1098516830 12:71387257-71387279 CATTTCTTCTGGAGGCTCTAAGG - Intronic
1098879975 12:75907190-75907212 GATTCCTTCTGAGGGCTGTGAGG + Intergenic
1098999008 12:77154995-77155017 CATTCTTTCTGGAGGCTGTAGGG + Intergenic
1099046355 12:77725816-77725838 CATTCCTTCTGGAAGATCTGTGG + Intergenic
1099257517 12:80332065-80332087 CATTCCTTCTGGAGGCTCTAAGG - Intronic
1099916343 12:88898898-88898920 CATTCCTTCTGGAGACTTCAGGG + Intergenic
1100130431 12:91486452-91486474 CATTCCTTCTGACTGTTGCGTGG - Intergenic
1100580068 12:95930357-95930379 GGTTCCTTCTGGAGGCTCTGAGG + Intronic
1101031211 12:100662070-100662092 CAGGACTTCTGGAGGCTGTGTGG + Intergenic
1101258848 12:103008581-103008603 CGTTCCTTCTGTAGGCTCCAGGG + Intergenic
1101430354 12:104621705-104621727 CGTTCCTTCTGGAGGCTCCAAGG - Intronic
1101571105 12:105954516-105954538 GGTTCCTTCTGGAGGCTCAGAGG + Intergenic
1101998467 12:109541736-109541758 CACTCCCTCTGGAGGCTCTGGGG + Intergenic
1102014175 12:109636929-109636951 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
1102525300 12:113508389-113508411 CATTCATTCTGGAGGCTCTAGGG - Intergenic
1102585982 12:113923322-113923344 GGTTCTTTCTGGGGGCTGCGAGG - Intronic
1102591966 12:113963107-113963129 CAGTCCTTCTGGAAGCTCTGTGG - Intronic
1102593305 12:113973693-113973715 GCTTCCCTCTGGAGGCTGCAGGG + Intergenic
1102784381 12:115592387-115592409 CATTTCTTCTGAAGGCTGGCAGG + Intergenic
1103485942 12:121282660-121282682 CGTCCCTTCTGAAGGCTCCGAGG - Intronic
1103896301 12:124275516-124275538 GGTTCCTTCTGGAGGCTCTGGGG - Intronic
1103952183 12:124557340-124557362 GGTTCCTTCTGGAGGCTCTGCGG + Intronic
1104005046 12:124885913-124885935 CACTCCCTCTGAAGGCTCCGAGG + Intergenic
1104011093 12:124930723-124930745 TGTTCCTTCTGGAGGCTCTGGGG + Intergenic
1104018426 12:124975726-124975748 CGTTCCTTCTAGCGGCTGCCTGG - Intronic
1104099301 12:125591257-125591279 CATTCCTTCTGGAAGCTCTAGGG + Intronic
1104177299 12:126345308-126345330 CATTCTTTCTGAAGGCTTCAGGG + Intergenic
1104433588 12:128737561-128737583 CATTCCTTCTAGGGGCTCCAGGG + Intergenic
1105239159 13:18595189-18595211 CATTCCTTCTGGGCTCTGCTTGG + Intergenic
1106642812 13:31601965-31601987 GGTTCCTTCTGAGGGCTGCGAGG + Intergenic
1106951613 13:34890724-34890746 GGTTCCTTCTGAAGGCTGTGAGG - Intergenic
1107201206 13:37720117-37720139 CATTCCTTCTGGAAGCTCAGAGG - Intronic
1107630364 13:42336433-42336455 CTTTCCTTCTGGAGGCTCTGAGG - Intergenic
1107884172 13:44860677-44860699 CATTCCTCCTGGAGGCTCTAAGG + Intergenic
1107884917 13:44867265-44867287 CATTCCTTCTGGAGGCTCCGGGG + Intergenic
1108149420 13:47517103-47517125 GTTTCTTTCTGGAGGCTGCAGGG + Intergenic
1108763115 13:53593918-53593940 CATTCCTCCTGGTGGGTTCGTGG - Intergenic
1108855382 13:54787001-54787023 CCTTCCTTCTGGTGGGTTCGTGG + Intergenic
1108883730 13:55154135-55154157 GATTCCTTCTGGAGGCTCAGGGG - Intergenic
1108970970 13:56376249-56376271 CATTTCTTCTGGAGGCTTCAGGG - Intergenic
1109103657 13:58220498-58220520 CATTCCTTCTGAAGGCTCTAAGG - Intergenic
1109147330 13:58795950-58795972 CATTCCTTCTGCAGGCTGTAGGG - Intergenic
1109884518 13:68524953-68524975 TATTCCTTCTGGTGGGTTCGTGG - Intergenic
1110481452 13:75982357-75982379 GGTTCCTTCTAGAGGCTCCGAGG - Intergenic
1110508654 13:76321854-76321876 TATTCCTTCTTCAGGCTGTGAGG - Intergenic
1110550363 13:76805148-76805170 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
1110609654 13:77474714-77474736 CATTCCTCCTGGTGGGTTCGTGG + Intergenic
1110865724 13:80393360-80393382 AATTCCTTCTGGAGGCTCAAGGG - Intergenic
1110887585 13:80658109-80658131 CATTCCTTCCGGTGGGTTCGTGG + Intergenic
1111281617 13:86032645-86032667 CATTCCATCTGGAGGCAGTTGGG + Intergenic
1111454421 13:88461795-88461817 GATTCCTCCTGAAGGCTGTGAGG + Intergenic
1111676075 13:91390537-91390559 GGTTCCTCCTGGAGGCTCCGAGG + Intergenic
1111785042 13:92776120-92776142 CTTTCCTTCTGGAGGTTCCAGGG + Intronic
1111797491 13:92941433-92941455 CATTCCTTCTGGAAGCTCTGGGG - Intergenic
1112069020 13:95827488-95827510 GATACCTTCTGAGGGCTGCGAGG - Intronic
1112191349 13:97180931-97180953 CATTCCTTCTGGAGGCTCTAAGG + Intergenic
1112407200 13:99131575-99131597 CATTCCTCCTGGAGGCTCTCGGG - Intergenic
1112408699 13:99143541-99143563 GGTTCCTTCTGGAGGCTCTGGGG - Intergenic
1112635053 13:101207951-101207973 CATTCCTTCCGGTGGGTTCGTGG - Intronic
1112987385 13:105467970-105467992 CATGCCTTCTGGAGGCTCCAGGG + Intronic
1113684863 13:112276043-112276065 CATTCCTTCAGGATGCAGCCAGG + Intergenic
1113684867 13:112276077-112276099 CATTCCTTCAGGATGCAGCTAGG + Intergenic
1113684949 13:112276641-112276663 CATTCCTTCAGGATGCAGCCAGG + Intergenic
1113685006 13:112277014-112277036 CATTCCTTCTGGATGCAGCCAGG + Intergenic
1113685411 13:112279427-112279449 CATTCCTTCAGGATGCAGCCAGG + Intergenic
1113685864 13:112282010-112282032 CATTCCTTCAGGAGGGAGCCAGG + Intergenic
1113685946 13:112282452-112282474 CATTCCTTCAGGAGGGAGCCAGG + Intergenic
1113686559 13:112285919-112285941 CATTCCTTCAGGATGCAGCCAGG + Intergenic
1113686993 13:112288400-112288422 CATTCCTTCAGGAGGGAGCCAGG + Intergenic
1113687252 13:112289896-112289918 CATTCCTTCAGGATGCAGCCAGG + Intergenic
1113687951 13:112293839-112293861 CATTCCTTCAGGAGGGAGCCAGG + Intergenic
1113688198 13:112295234-112295256 CATTCCTTCAGGAGGGAGCCAGG + Intergenic
1113688521 13:112297036-112297058 CATTCCTTCAGGAGGGAGCCAGG + Intergenic
1113689076 13:112300163-112300185 CATTCCTTCAGGAGGGAGCCAGG + Intergenic
1113690308 13:112307029-112307051 CATTCCTTCAGGAGGGAGCCAGG + Intergenic
1113691458 13:112313894-112313916 CATTCCTTCAGGATGCAGCCAGG + Intergenic
1113691593 13:112314883-112314905 CATTCCTTCAGGATGCAGCCAGG + Intergenic
1113691675 13:112315495-112315517 CATTCCTTCAGGATGCAGCCAGG + Intergenic
1113691693 13:112315597-112315619 CATTCCTTCAGGATGCAGCCAGG + Intergenic
1113691725 13:112315801-112315823 CATTCCTTCAGGATGCCGCCAGG + Intergenic
1113691858 13:112316716-112316738 CATTCCTTCAGGATGGTGTGAGG + Intergenic
1113691936 13:112317226-112317248 CATTCCTTCAGGATCCTGCCAGG + Intergenic
1113691994 13:112317634-112317656 CATTCCTTCTGGATGGAGCCAGG + Intergenic
1113692073 13:112318176-112318198 CATTCCTTCAGGATGCAGCCAGG + Intergenic
1113692080 13:112318244-112318266 CATTCCTTCAGGATGCAGCCAGG + Intergenic
1113692098 13:112318345-112318367 CATTCCTTCAGGATGCAGCCAGG + Intergenic
1113692116 13:112318446-112318468 CATTCCTTCAGGATGCAGCCAGG + Intergenic
1113692135 13:112318547-112318569 CATTCCTTCAGGATGCAGCCAGG + Intergenic
1113692153 13:112318649-112318671 CATTCCTTCAGGATGCAGCCAGG + Intergenic
1113692172 13:112318750-112318772 CATTCCTTCAGGATGCAGCCAGG + Intergenic
1113692190 13:112318852-112318874 CATTCCTTCAGGATGCAGCCAGG + Intergenic
1113692220 13:112319056-112319078 CATTCCTTCAGGATGCAGCCAGG + Intergenic
1114566640 14:23638119-23638141 CATTCCTTCTGGAGGGTTTGTGG - Intronic
1114571530 14:23672587-23672609 TATTCCTTTTGGAGGCTCCAAGG + Intergenic
1114603141 14:23972385-23972407 CATTCCTCCTGGTGGGTTCGTGG + Intronic
1116001909 14:39252445-39252467 CATTCCTTCAGGAGGCTCTAGGG - Intronic
1116084293 14:40216423-40216445 TCTTCCTTCTGGAGGGTTCGTGG + Intergenic
1116552631 14:46261326-46261348 CATTCTTTCTGGAGGATGCCTGG - Intergenic
1116784583 14:49273228-49273250 CATTCCTTTTTGTGGCTGCACGG + Intergenic
1117321914 14:54632641-54632663 CATTCCTTTTGCTGGCTGCATGG + Intronic
1117615966 14:57533972-57533994 CATTCTTTTTGATGGCTGCGTGG + Intergenic
1117626845 14:57649323-57649345 CATTCCTTCTGGAGGTTCCAGGG + Intronic
1117838796 14:59835956-59835978 CATTCCTTCTGGAGGTTCTAGGG + Intronic
1118014333 14:61643094-61643116 CACTCCTCCTGGAGGCTACAGGG + Intronic
1119372610 14:74160280-74160302 CATTCCTTCTGAGGGCTGTGAGG - Intronic
1119677690 14:76568145-76568167 CATTCCTTCTGAAGGCTCTAAGG - Intergenic
1120215599 14:81678474-81678496 TATTCCTTCTGGTGGGTTCGTGG + Intergenic
1120503620 14:85326746-85326768 CATTCCTTCTAAAGGCTCTGGGG - Intergenic
1120777550 14:88454178-88454200 CATTCCTCTTGGAGGCTGTAGGG + Intronic
1120927458 14:89811710-89811732 CATTCCTGCTGGAGGCTCAAGGG - Intronic
1121051309 14:90820583-90820605 CCTTCCTTCTGAAGGCAGTGAGG + Intergenic
1121154362 14:91668805-91668827 TCTTCCTTCTGGTGGGTGCGTGG - Intronic
1121168074 14:91827357-91827379 CATTACTTCTGGAGGCTCTATGG + Intronic
1121454377 14:94028916-94028938 CATTCCTTTTGGCGGGTGCGGGG + Intronic
1121476612 14:94213750-94213772 CATTCCATCTAGAGGCTCTGGGG - Intronic
1121583733 14:95048853-95048875 GGTTCCTTCTGGAGGCTCCGAGG + Intergenic
1121717026 14:96083680-96083702 CACTCCTTCTGGAGGCTCTAGGG - Intronic
1121742675 14:96265086-96265108 CATTCCTTCTGGAGGCTCCAGGG - Intronic
1121942191 14:98081719-98081741 CATTCCTTCTGGAAGCTCCGGGG - Intergenic
1122005662 14:98701504-98701526 CTTCCCTTCTGGAGGCTGGTGGG + Intergenic
1122145741 14:99687959-99687981 CATTCCTTCTGGCACCTGCAGGG - Intronic
1122435146 14:101690193-101690215 CATTCCTCCTGGTGGGTTCGTGG - Intergenic
1122514690 14:102298863-102298885 CATTCCTCCTGGTGGGTTCGTGG - Intronic
1122637353 14:103136351-103136373 CACTCCTTCTGGAGGCTCTAGGG + Exonic
1123492092 15:20788895-20788917 CATTCCTTCTGGGCTCTGCTTGG - Intergenic
1123548596 15:21357985-21358007 CATTCCTTCTGGGCTCTGCTTGG - Intergenic
1123825426 15:24077696-24077718 CATTCCTCCTGGTGGGTTCGTGG + Intergenic
1124069651 15:26379604-26379626 CATTCCTTTTGGAAGCTCTGGGG + Intergenic
1124273874 15:28309523-28309545 CATCCCTTCAGGACGGTGCGGGG - Intronic
1124642749 15:31406684-31406706 CATTCCTTCTGGAGGCTCTAAGG + Intronic
1124667521 15:31605920-31605942 CATTTCTGCTGGAGCCTGTGGGG + Intronic
1124694674 15:31854132-31854154 CATTCCTTCTGGATGCTCCAGGG + Intronic
1124984242 15:34590647-34590669 CATTTCTTCTCGTGGCTGCACGG + Intergenic
1125278018 15:38013882-38013904 CATTCCTTCTGCAGGCTCTAGGG + Intergenic
1125356288 15:38820258-38820280 CATTCTTTTTGGAGGGTGCAGGG + Intergenic
1126188142 15:45850741-45850763 TGTTCCTTCTGGTGGCTTCGTGG + Intergenic
1126260913 15:46690007-46690029 GGTTCCTTCTGGAGGCTCCAAGG + Intergenic
1127362242 15:58254481-58254503 AGTTCCTTCTGGAGGCTCTGAGG + Intronic
1127633567 15:60848509-60848531 CATTCCTTCTGAAGGCTTCAGGG - Intronic
1127799398 15:62464846-62464868 CATTCCTTCTGATGGCTGAGGGG + Intronic
1127892821 15:63270161-63270183 GGTTCCTTCTGGAGGCTGTAGGG - Intergenic
1127912212 15:63426670-63426692 CATTCCTTCTGGAGGCTCTAGGG + Intergenic
1128598421 15:68975006-68975028 CATTCCTCCTGGTGGGTTCGTGG + Intronic
1128878841 15:71224661-71224683 CACTCCTTCTGGGGGCTTTGAGG + Intronic
1129157199 15:73725784-73725806 AGTTCCTTCTGGAGGCTCCAAGG - Intergenic
1129612043 15:77068817-77068839 CATTCTTTTTTGTGGCTGCGTGG + Intronic
1129789126 15:78328967-78328989 GATTCCTTCTGAGGGCTGTGAGG + Intergenic
1130348430 15:83069081-83069103 CGTTCCTTCTGGTGGGTTCGTGG + Intergenic
1131385071 15:91998946-91998968 CATTCCTTCTAACGGCTGCTCGG - Intronic
1131472686 15:92710433-92710455 TATTCCTTCTGGCGGCTTCGTGG + Intronic
1131505874 15:93018649-93018671 GGTTCCTTCTGGAGGCTCCGAGG + Intronic
1131660594 15:94511608-94511630 CATTCCTTCTGGAGGCTCCAGGG + Intergenic
1132029607 15:98429143-98429165 GGTTCCTTCTGGAGGCTCCAGGG + Intergenic
1132248042 15:100312397-100312419 CATTCCTTCTGGAGGTTCCAGGG - Intronic
1202956930 15_KI270727v1_random:85216-85238 CATTCCTTCTGGGCTCTGCTTGG - Intergenic
1132613690 16:830029-830051 CCTTCCTTCTTGTGGCTGAGTGG + Intergenic
1132674593 16:1116465-1116487 CTTTCCTGCTGGAGGTTGTGAGG + Intergenic
1132678991 16:1132027-1132049 CATGCCTTCCGGAGGCCGCAGGG + Intergenic
1133037581 16:3042738-3042760 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
1133166082 16:3948430-3948452 CATTCCTTCTGGTGGCTGCCTGG + Intergenic
1133384304 16:5356250-5356272 GATTCCTTCTGGAGGCTCTGAGG - Intergenic
1133684362 16:8151646-8151668 CATTCCTTTTAATGGCTGCGTGG + Intergenic
1133723215 16:8514311-8514333 CATTTCTTCTGGAGGCTCTAGGG + Intergenic
1133782728 16:8952463-8952485 CATTCCTTCTGGAGGTTCTAGGG + Intronic
1133912290 16:10077166-10077188 TGTTCTTTCTGGAGGCTGCAGGG - Intronic
1134289498 16:12892370-12892392 GATTCCTTCTGGAGGCTCCAAGG + Intergenic
1134404673 16:13946016-13946038 CATTCCTCCTGGAGGCTCTAGGG + Intronic
1134414813 16:14034236-14034258 GGTTCCTTCTGGAAGCTGTGAGG + Intergenic
1134760606 16:16711101-16711123 CATTATTTCTGGAGGCTCTGGGG + Intergenic
1134783326 16:16918400-16918422 CATTCCATCTGGAGGCTTGAGGG + Intergenic
1134905848 16:17978874-17978896 CGTTCCTTCTGGAGGCTGTAGGG - Intergenic
1134985453 16:18648072-18648094 CATTATTTCTGGAGGCTCTGGGG - Intergenic
1135178498 16:20252506-20252528 CATTCCCTCTGGAGGCTCCAGGG + Intergenic
1135463133 16:22662316-22662338 CATTCTTTCTGGAGGCTCTCAGG + Intergenic
1135467272 16:22697896-22697918 CATTCCTTCTGGGGGCTTTAAGG + Intergenic
1135624147 16:23981181-23981203 CCTTCCTTCTGGAGGCTCTAGGG + Intronic
1135912515 16:26574252-26574274 CATGCCTTCTAGAGGCTTTGGGG - Intergenic
1135942555 16:26835543-26835565 CATTCCTCCTGGTGGGTTCGTGG + Intergenic
1136086749 16:27890721-27890743 CATTCCTTCTGGATGTTCCACGG - Intronic
1136102301 16:28005074-28005096 GATTCCTTCTGAGGGCTGTGGGG + Intronic
1136146964 16:28321502-28321524 CCTCCCTTCTGGAGGCTGGAGGG + Exonic
1136366203 16:29810333-29810355 CTTTCCTTCTGGAGGCTCCTTGG - Exonic
1137474824 16:48798652-48798674 CATTCCTTCTGGAAGCTTCAGGG + Intergenic
1137696145 16:50463428-50463450 CATTCTTTTTGGAGCCAGCGGGG - Intergenic
1137941848 16:52695731-52695753 CATTCCCTCTGGAGCCTGCAAGG + Intergenic
1138402306 16:56756474-56756496 CATTCTTTTTGATGGCTGCGTGG + Intronic
1138506983 16:57483250-57483272 CATTCCTTCTGGAGGATGGTGGG - Intronic
1139246398 16:65448662-65448684 CATTCCTTCTGGAGGCATTTGGG - Intergenic
1140282376 16:73566435-73566457 GATTCCTTCTGGAGGCTCCGAGG + Intergenic
1140338587 16:74135498-74135520 GGTTCCTTCTGAAGGCTGTGGGG + Intergenic
1140413346 16:74755074-74755096 GGTTCCCTCTAGAGGCTGCGAGG - Intronic
1140414924 16:74767700-74767722 CATTCCTTCTGGATGCTCTAGGG - Intronic
1140838906 16:78820792-78820814 CGTTCCTTCTGGAAGCTATGAGG + Intronic
1140889585 16:79273533-79273555 TGTTCCTTCTGGAGGCTGTGGGG + Intergenic
1141190745 16:81822935-81822957 GGCTCCTTCTGGAGGCTCCGAGG - Intronic
1141191092 16:81825059-81825081 TGTTCCTTCTGGAGGCTCCAAGG - Intronic
1141326410 16:83063782-83063804 GGTTCCTTCTGGAGGCTCCAAGG + Intronic
1141599039 16:85114182-85114204 CAGTCCCTCCGGAGGCTCCGGGG - Intergenic
1141750153 16:85953058-85953080 GGTTCCTTCTGGAGGCTCCAGGG + Intergenic
1141788183 16:86215687-86215709 GGTTCCTTCTGGAGGCTCCAGGG + Intergenic
1142283350 16:89160726-89160748 GGTTCCTTCTGGAGGCTCCTGGG - Intergenic
1142335030 16:89482916-89482938 GGTTCCTTCTGGAGGCTCCAGGG - Intronic
1142738003 17:1913810-1913832 CGTTCCTTCTGGAGGCTCTCGGG - Intergenic
1143267883 17:5654003-5654025 TGTTCCTCCTGGAGGCTGCAGGG - Intergenic
1143981011 17:10869929-10869951 CATTCAATCTGGTGGCTGTGGGG - Intergenic
1144020029 17:11232716-11232738 GGTTCCTTCTGAAGGCTGTGAGG - Intergenic
1144047816 17:11469383-11469405 CATTCTTTCTGGAGGCTCTAGGG - Intronic
1144291790 17:13833613-13833635 CATTCCTTCTGGAGGCTCTGGGG - Intergenic
1144395223 17:14836756-14836778 CATTCCTTCTGAAGGCTCTAGGG - Intergenic
1144464193 17:15483543-15483565 GGTTACTTCTGAAGGCTGCGAGG - Intronic
1144709521 17:17392174-17392196 CATTCCTCCTGGTGGGTTCGTGG - Intergenic
1145112553 17:20176599-20176621 TGTTCCTTCTGGAGGCTTCAGGG + Intronic
1145805588 17:27726390-27726412 TTTTCCTTCTGGTGGCTTCGTGG - Intergenic
1145807063 17:27742051-27742073 GTTTCCTTCTGGAGGCTCCAGGG + Intergenic
1145834603 17:27944782-27944804 GGTTCTTTCTGGAGGCTCCGAGG - Intergenic
1146299533 17:31677452-31677474 GATTCCCTCTGGAGGCTCTGGGG + Intergenic
1147209671 17:38865105-38865127 CATTCCTTCTGTAGGCTTTAGGG - Intergenic
1147398998 17:40167892-40167914 CATGCCCTGTGGAGGCAGCGGGG - Exonic
1147805556 17:43128232-43128254 CATTCCTCCTGGTGGGTTCGTGG - Intergenic
1148885646 17:50770517-50770539 GATTCCTTCTGGAGGCTCTGAGG + Intergenic
1148993190 17:51684240-51684262 CATTCTTTCTGGAGGCTGTAGGG - Intronic
1149017618 17:51926570-51926592 TATTCCTTCTGGAAGCTCCAAGG + Intronic
1149624394 17:58069846-58069868 CCTTCCTGCTAGAGGCTGAGTGG + Intergenic
1149841938 17:59973002-59973024 CATTGCCTCTGGAGGCTGTAGGG - Exonic
1150710892 17:67530027-67530049 GGTTCCTTCTGGAGGCTGTGGGG + Intronic
1151306454 17:73265713-73265735 GGTTCCTTCTGGAGGCTCTGAGG - Intergenic
1151434712 17:74087850-74087872 CGTTCCTTCTGGAGGCTTCGGGG + Intergenic
1151950775 17:77352500-77352522 CATTCCTCCTGGGGGTTCCGAGG + Intronic
1151991485 17:77577758-77577780 AGTTCCTTCTGGAGGCTGTAGGG + Intergenic
1152066249 17:78114139-78114161 CATTCCTCCCGGAGGCTTCGGGG + Intronic
1152137121 17:78511032-78511054 CACTCCTTCTAGAGGCTCCGGGG - Intronic
1152196725 17:78922938-78922960 AGTTCCTTCTGGGGGCTGTGAGG - Intronic
1152294985 17:79461923-79461945 GGTTCCTTCTGGAGGCTTTGAGG - Intronic
1152613076 17:81325025-81325047 GGTTCCTTCTGGAGGCTCGGAGG + Intronic
1152970275 18:154783-154805 CATTCCTTCTAGAGGCTCTGAGG - Intergenic
1153407081 18:4753024-4753046 TCTTCCTTCTGGTGGCTTCGTGG + Intergenic
1153711403 18:7803259-7803281 CATTGCTTCTGGAGGCTCTCAGG + Intronic
1154088113 18:11327234-11327256 CATTCCTTCAGGAGGCTGTAGGG - Intergenic
1154098120 18:11439840-11439862 CATTCCTTTTTGTGGCTGAGTGG - Intergenic
1154255135 18:12775960-12775982 CATTCCTCCTGGTGGGTTCGTGG + Intergenic
1154449634 18:14463451-14463473 CATTCCTTCTGGGCTCTGCTTGG - Intergenic
1154488805 18:14903061-14903083 CACTCCTTCTGGAGGCTCTTGGG + Intergenic
1155026607 18:21946312-21946334 CCTTCCTTCTGGAGGCTGCAGGG + Intergenic
1155109492 18:22699839-22699861 CATTCCTTCTGGAGGCTCCAGGG + Intergenic
1155267940 18:24112086-24112108 CAAGCCCTCTGGAGGCTGTGGGG + Intronic
1155288680 18:24319151-24319173 CATTCCTTCTGGAGGCTCTAAGG + Intronic
1155498352 18:26464221-26464243 CCTTCCTTCTGGAGGCTCTGGGG + Intronic
1155810214 18:30223570-30223592 AATTGCTTATAGAGGCTGCGGGG - Intergenic
1155927653 18:31674028-31674050 CAGTCCCTCTGGAGGCTCTGGGG - Intronic
1156079648 18:33317250-33317272 CATTCCTCCTGGTGGGTTCGTGG - Intronic
1156093064 18:33494655-33494677 GATTCCTTCTGGAGGCTCCTAGG + Intergenic
1156652067 18:39236250-39236272 CGTTCCTTCTGGTGGGTTCGCGG - Intergenic
1156964840 18:43078616-43078638 CATTCCTCCTGGAGCCTTCAGGG + Intronic
1157663663 18:49467448-49467470 GGTTCCTTCTGAGGGCTGCGAGG + Intergenic
1157935054 18:51863738-51863760 CATTCCTCCTGGTGGGTTCGTGG + Intergenic
1157974440 18:52310791-52310813 GATTCCTGCTGGAGGCTCTGAGG + Intergenic
1158222781 18:55167342-55167364 TGTTCCTTCTGGAGGCTCTGGGG + Intergenic
1158460557 18:57642737-57642759 CGTTCCTTCTGGTGGGTTCGTGG + Intergenic
1158483354 18:57842645-57842667 GGTTCCTTCTGGAGGCTGTTGGG + Intergenic
1158619819 18:59023270-59023292 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
1159248096 18:65836106-65836128 CATTCTTTCTGGAGGCTTCGGGG - Intronic
1159289383 18:66396206-66396228 CATTCCTCCTGGTGGGTTCGTGG - Intergenic
1159424872 18:68272220-68272242 TGTTCCTTCTGGAGGCTCTGAGG - Intergenic
1159462835 18:68742145-68742167 GATTCCTCCTGGAGGCTCTGAGG + Intronic
1159680268 18:71341604-71341626 GGTTCCTTCTGAAGGCTGAGAGG + Intergenic
1159877480 18:73828569-73828591 CATCTCTTCTCGAGGCTACGCGG + Intergenic
1160139386 18:76307543-76307565 CCTTCCTTCTGGAGGCTCTAGGG + Intergenic
1160454125 18:78985671-78985693 CCTTGCTTCTGGACGCAGCGTGG + Intronic
1160701472 19:509521-509543 CACTCCCTCTGGAGGCTCCAGGG + Intronic
1160835672 19:1123432-1123454 CATTCCCTCTGTGGGCTGTGCGG + Intronic
1161018728 19:1997563-1997585 CATGCCTGCTGGAGGCTGGCAGG - Intronic
1161066734 19:2242323-2242345 CATTCCTTCTGGAGGCTCTGGGG + Intronic
1161761927 19:6179993-6180015 CATTCCTTCTAGAGGCTCTTGGG + Intronic
1161874052 19:6893870-6893892 CGTTCCTTCTGGATGCTGTACGG + Intronic
1163281338 19:16319870-16319892 GGTTCCCTCTGGAGGCTCCGAGG + Intergenic
1163369047 19:16891925-16891947 GGTTCCCTCTGGAGGCTGTGAGG - Exonic
1163623672 19:18375581-18375603 GGTTCCTTCTGGAGGCTGTCAGG + Intronic
1163749775 19:19069509-19069531 GGTTCCTTCTGGAGGCTCTGAGG + Intronic
1164036234 19:21458249-21458271 CATTCCTTCTGGGCTCTGCCTGG + Intronic
1165155584 19:33785229-33785251 CATTCCCTCTAGAGGCTCCAGGG - Intergenic
1165538274 19:36468663-36468685 CAGCCCTTCTGGAGCCTGAGTGG + Intronic
1165882705 19:39054792-39054814 CCTGCCTTCTGGAGGCTCGGGGG + Intergenic
1165909340 19:39215187-39215209 CCTTCCTTCTGGAGGCTCCAGGG + Intergenic
1166253784 19:41588070-41588092 CGTTCTTTCTGGAGGCTCCAGGG + Intronic
1166321168 19:42019803-42019825 AGTTCCTTCTGGAGGCTCCAGGG - Intronic
1166530326 19:43538939-43538961 CAATCCTTCTGGAGGCTCTAAGG - Intergenic
1166530716 19:43541701-43541723 CGTTCCTTCTGGAGGCTTGAGGG - Intergenic
1166817940 19:45558007-45558029 AATTCCTTCTGATTGCTGCGTGG - Intronic
1167180738 19:47901532-47901554 CATTCCCTCTGGAGGCTCTGGGG - Intergenic
1167192468 19:48001016-48001038 CATTCCTTCTGGAGGCTGTAGGG + Intronic
1167529019 19:50003223-50003245 GATTCCTTCTGGAGGCCGGAGGG - Intronic
1167625945 19:50589335-50589357 CATTTCTTCTGGAGGCTCTAGGG - Intergenic
1167717317 19:51152112-51152134 GGTTCCTTCTGGAGGCTCCAGGG + Intronic
1168646895 19:58065147-58065169 CATTCCTTCTGGAGGCTCTAGGG + Intronic
1168701550 19:58442645-58442667 CATTCCTCCTGGTGGGTTCGTGG + Intergenic
925227742 2:2200354-2200376 CCTTCCTTGTGGAGGCTCCAAGG + Intronic
925497244 2:4465832-4465854 CTTCCCTTCTGGAGGCTGTATGG - Intergenic
925601474 2:5612417-5612439 AATTCCTTCTGCAGGCTCTGAGG - Intergenic
926296146 2:11570158-11570180 CAGTACTTTGGGAGGCTGCGGGG + Intronic
926572543 2:14545097-14545119 CATCCCTTCTGGAGGCTCTAAGG - Intergenic
927479706 2:23442570-23442592 TGTTCCTTCTGGAGGCTCCGGGG - Intronic
927676759 2:25111862-25111884 CATTCCTTCTGGGGGTTCTGGGG - Intronic
928100309 2:28433248-28433270 CATTTCTTCTGGAGGCTCCAGGG - Intergenic
928493294 2:31805351-31805373 GGTTCCTTCTGGAGGCTCTGAGG - Intergenic
928564735 2:32533784-32533806 CATTGCTTCTGGAGGCTCTTAGG - Intronic
928600260 2:32897517-32897539 CACTCCTTCTGGAGGCTTTTGGG - Intergenic
929571896 2:43027923-43027945 GGTTCCTTCTGGAGGCTCCAGGG + Intergenic
929581505 2:43084314-43084336 CAATCCTGCTGGAGCCTGCAGGG - Intergenic
929827206 2:45318196-45318218 GGTTCCTTCTGGAGGCTCCAGGG - Intergenic
930331999 2:49996734-49996756 CATTCCTTCTGGAGGCTTTAGGG - Intronic
930776918 2:55182035-55182057 CATTCCTTCTGGAGGCTCTAAGG - Intronic
930800367 2:55437600-55437622 TATTCCTTCTGGAGGTTCTGAGG - Intergenic
930834456 2:55778220-55778242 GATTTCTTCTGGAGGCTCCAAGG - Intergenic
930968207 2:57358601-57358623 TGTTCCTTCTGGAGGCTCTGAGG - Intergenic
931095766 2:58939004-58939026 CCTTTCTTCTGGAGGCTGTTGGG - Intergenic
932263695 2:70347947-70347969 GATTCCTTCTGGAGGCTCTAGGG + Intergenic
932373044 2:71208887-71208909 CTTTCCTTCTGGAGGCTCTAGGG - Intronic
932602214 2:73135558-73135580 CGTTCCTTCTGGAGGCTCTGGGG + Intronic
933077279 2:77944801-77944823 CATTCCTTCTGGAGAGTTCAGGG + Intergenic
933319511 2:80756121-80756143 CATTCTTTCTAGTGGCTGTGTGG + Intergenic
933415965 2:81986131-81986153 CATTCCTTCTGCTGGGTTCGTGG - Intergenic
934729878 2:96649770-96649792 CATTCCTTCTGTAGGCCTCAAGG - Intergenic
934732746 2:96669715-96669737 CTTCCCTGCTGGAGGCTGTGTGG - Intergenic
935012110 2:99145089-99145111 CATTCCTTCTGGAGGCTCTAGGG + Intronic
935079478 2:99778156-99778178 CATCCCTTCTGGATCCTGCCTGG + Intronic
935374021 2:102377266-102377288 CTTTACTTCTGGAGGCTGTAGGG + Intronic
935391592 2:102558842-102558864 CAATCCTTCTGGAGGCTCTAAGG - Intergenic
935503256 2:103868230-103868252 CATTCTTTCTAGAGGCTCCAGGG - Intergenic
936062751 2:109306386-109306408 GATTCCTCCTGGAGGCTTCCCGG + Intronic
936593797 2:113828666-113828688 CATTCCTTCTGGAGGCTCTGGGG + Intergenic
936865240 2:117070725-117070747 CATTCCTTCTGGCGGGTTCGTGG + Intergenic
937065995 2:119018139-119018161 CGTTCCTTCTGGAGGCTCTTGGG - Intergenic
937113317 2:119384375-119384397 TGTTCCTTCTGGAGGCTGTAGGG - Intergenic
938801757 2:134770382-134770404 CATTCTTTCTGGAGGCTCTAAGG + Intergenic
939194631 2:138956675-138956697 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
939233762 2:139464976-139464998 CATTCCTTCTGAAGGCTCTAAGG - Intergenic
939778898 2:146419884-146419906 CATTCCTTCTGAAGGCTCTAGGG + Intergenic
940041130 2:149362046-149362068 CATTCCTTATGGAGGCTCTAAGG - Intronic
940122805 2:150286425-150286447 CACTCCCTCTGAAGGCTCCGGGG + Intergenic
940357003 2:152754405-152754427 CATTCCTTTTTAAGGCTGCATGG + Intronic
940699102 2:157019607-157019629 TTTTCTTTCTGGAGGCTGTGGGG - Intergenic
940897500 2:159094813-159094835 CTTTCCTCCTAGAGGCTGTGTGG - Intronic
941874272 2:170417592-170417614 GGTTCCTTCTGGAGGCTCTGAGG + Intronic
942073387 2:172335397-172335419 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
942330725 2:174821210-174821232 CATTTCTTCTGGAGGCTTAGGGG + Intronic
942351899 2:175061454-175061476 TGTTCCTTCTGGAGGCTCTGGGG - Intergenic
942770627 2:179514150-179514172 CATTCCTTCTGGAGGCTTTAAGG + Intronic
943024366 2:182609527-182609549 CATTCCTCCTGGTGGGTTCGTGG - Intergenic
943375923 2:187076422-187076444 CATTCCTTCTGCAGGCTCTAGGG - Intergenic
943778372 2:191793224-191793246 CATTCCTTCTGGAGCCTCCAGGG + Intergenic
944278877 2:197871592-197871614 GGTTCCTTCTGGAGGCTCTGAGG + Intronic
944463089 2:199972576-199972598 CGTTCCTTCTAGAGGCTCTGGGG - Intronic
944466699 2:200008536-200008558 TATTCCTTCTGGAGGCTCTGGGG - Intronic
944606128 2:201352964-201352986 CATTCCTTCCGGAGGCTCCAGGG - Intronic
944688157 2:202136139-202136161 TATTCCTTCTGGTGGGTTCGTGG + Intronic
944876876 2:203971420-203971442 CAGTCCTTCTGGAGGCTCCAGGG + Intergenic
944903429 2:204238894-204238916 GGTTCCTTCTGGAGGCTTCAGGG - Intergenic
945027508 2:205633040-205633062 GGTTCCTTCTGGAGGCTCCTAGG + Intergenic
945664071 2:212720295-212720317 TCTTCCTTCTGGTGGCTTCGTGG + Intergenic
945869294 2:215208806-215208828 CATTCCTCCTGGTGGGTTCGTGG - Intergenic
945872679 2:215245102-215245124 CCTTCCTTCTGGTGGGTTCGTGG + Intergenic
946707539 2:222473268-222473290 TATTTCTTCTGGAGGCTGGAGGG + Intronic
947932195 2:233973338-233973360 GACTCCCTCTGGAGGCTGTGCGG + Intronic
947989326 2:234474341-234474363 GGTTCCTTCTGGAGGCTCCAGGG - Intergenic
948002841 2:234582299-234582321 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
948024168 2:234763842-234763864 CATTCATTCTGAGGGCTGGGAGG + Intergenic
948051739 2:234983852-234983874 AGTGCCTTCTGGAGGCTCCGAGG - Intronic
948095052 2:235326910-235326932 CGTTCCTTCTGGAGGCTTTCAGG - Intergenic
948254571 2:236556600-236556622 CCTTCCTTCTGGAGGCTTTGGGG - Intergenic
948371902 2:237494984-237495006 CATTCCAGCTGGAGGCTGGAGGG + Intronic
948390213 2:237606495-237606517 GGCTCCTTCTGGAGGCTCCGAGG - Intergenic
948398062 2:237662077-237662099 GGTTCCTTCTGGAGGCTCTGAGG + Intronic
948419963 2:237851971-237851993 CATTCCTTCTGGAAGCTCTAGGG - Intergenic
948434954 2:237946834-237946856 CATTCCTTCTGGAGGCTTCAGGG + Intergenic
948536959 2:238653618-238653640 CATTCCTTCTGGAGGCCCTAGGG - Intergenic
948652658 2:239458145-239458167 GATTCCTTCTGGAGGTTCCGAGG + Intergenic
1169389457 20:5177789-5177811 AATTCCATCTGGAGGCTGGGAGG - Intronic
1169659969 20:7967694-7967716 CATTCCTTCTGGAGGCTTCAGGG - Intergenic
1169804675 20:9547226-9547248 GATTCCTTCTGGAAGCTCTGAGG - Intronic
1172018513 20:31895734-31895756 CATTCCTTTTGGAGGCTCTATGG - Intronic
1172046302 20:32083032-32083054 GGTTCCTTCTGGAGGCTTCAGGG + Intronic
1172361515 20:34316060-34316082 GGTTCCTTCTGGAGGCTCTGAGG - Intergenic
1172786351 20:37471356-37471378 GATTCCTTCTGGGGGCTGTGAGG - Intergenic
1172908945 20:38391630-38391652 CATTCCTTCAGGAAGCTCTGGGG + Intergenic
1173000752 20:39103865-39103887 CACTCCCTCTGGAGGCTGTAGGG + Intergenic
1173052345 20:39575575-39575597 CATTCCTTCTGGAGGCTCCAGGG - Intergenic
1173281986 20:41636874-41636896 TATTCCTTCTGGAGGCTGTAGGG - Intergenic
1173428313 20:42961998-42962020 CATTCCTTCTGGAGGCTGTAGGG - Intronic
1173474928 20:43352238-43352260 CATTCCTTCTGGAGACTCTAGGG - Intergenic
1173823037 20:46030835-46030857 CATTCCTCCTGGGGGCTGAGTGG + Intronic
1173941829 20:46917560-46917582 CATTCCTTGGAGATGCTGCGGGG + Intronic
1174092452 20:48059956-48059978 CATTCCTTCTGGTGGGTTCGTGG - Intergenic
1174128735 20:48327106-48327128 CAGTCCTTCCGGAGGCTCCAGGG - Intergenic
1174165759 20:48582517-48582539 GCTTCCTTCAGGAGGCTCCGGGG - Intergenic
1174419812 20:50392031-50392053 AGTTCCTTCTGGAGGCTTCAGGG - Intergenic
1174466539 20:50722056-50722078 GGTTCCTTCTGGAGGCTCTGAGG - Intergenic
1174552882 20:51374328-51374350 CCTTCCTTCTGGAGGCTCTAGGG + Intergenic
1174661318 20:52215485-52215507 CATTCCTTCTGGAGGCTCTGGGG - Intergenic
1174734343 20:52951042-52951064 CATTCCTTCTGTGGTCTGTGTGG - Intergenic
1174907130 20:54563142-54563164 GGTTCCTACTGGAGGCTGTGAGG - Intronic
1175231213 20:57474558-57474580 CACTCCTTCTGGAGGTTATGGGG - Intergenic
1175334265 20:58184952-58184974 CATCCCTTCTGGAGGCTCTGGGG - Intergenic
1175536851 20:59720764-59720786 AGTTCCTTCTGGAATCTGCGAGG - Intronic
1175658404 20:60791953-60791975 CATGTCTTCTGGAGGCTCCAGGG + Intergenic
1175717313 20:61263772-61263794 GGTTCCTTCTGGAGGCTCCTGGG + Intronic
1175850006 20:62085185-62085207 AGCTCCTTCTGGAGGCTCCGAGG - Intergenic
1176389347 21:6155684-6155706 CCATCCTTCTGGAGGCTTCCCGG - Intergenic
1176663591 21:9663500-9663522 CATTCCTCCTGGTGGGTTCGTGG + Intergenic
1176893877 21:14352204-14352226 GATTCCTTCTGGAGGCTTTGAGG + Intergenic
1176932827 21:14833310-14833332 GATTCCTTCTGAGGGCTGTGAGG + Intergenic
1177377665 21:20294314-20294336 CATTCATTCTTGAGGCTCTGGGG + Intergenic
1177783494 21:25644366-25644388 CATTCCTTCTGGAGGTTCTAGGG + Intronic
1177934569 21:27327808-27327830 GTTTCCTTCTGAAGGCTGTGAGG - Intergenic
1178039052 21:28619156-28619178 GTTTCCTTCTGAGGGCTGCGAGG - Intergenic
1178895070 21:36551114-36551136 GGTTCCTTCTGGAGGCTCCAAGG - Intronic
1178933365 21:36838865-36838887 CACTCCCTCTGGAGGCTCCAGGG - Intronic
1179036258 21:37760852-37760874 CATACATTCTGGAGGCGGGGTGG + Intronic
1179114801 21:38480390-38480412 GGTCCCTTCTGGAGGCTGTGAGG - Intronic
1179537691 21:42062963-42062985 GGTTTCCTCTGGAGGCTGCGAGG + Intronic
1179879914 21:44289180-44289202 CACTCCCTCTGGAGGCTCCAGGG + Intronic
1180128788 21:45811301-45811323 CATCCCTTCTGGAGGCTCACGGG + Intronic
1180731717 22:17987363-17987385 CCTTCCTCCTGGAGGCAGCAGGG + Intronic
1181899565 22:26142046-26142068 CAGTCCCTCTGGAGGCTGGCTGG - Intergenic
1181911633 22:26242966-26242988 GATTCCTTCTGGAGGTTCTGAGG + Intronic
1182919908 22:34069701-34069723 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
1183514922 22:38259626-38259648 TACTCCTTCTGGAGGCTCTGGGG - Intronic
1184069517 22:42139517-42139539 TCTTCCTTCTGGTGGGTGCGTGG - Intergenic
1184096156 22:42317633-42317655 CATTCCCGCTGGGGGCTGGGGGG + Intronic
1184249425 22:43251676-43251698 GTTTCCTTCTGGAGGCTCCAGGG - Intronic
1184374628 22:44103874-44103896 GGTTCCTTCTGGAGGCTCCAGGG - Intronic
1184393978 22:44221819-44221841 GATTCCTTCTGGAGGCTCTGAGG + Intergenic
1184489941 22:44802690-44802712 CACTCCCCCTGGAGGCTGCGGGG + Intronic
1184529277 22:45044205-45044227 GGTTCCTTCTAGAGGCTGCAGGG - Intergenic
1184821816 22:46915182-46915204 CATTCATTCTGGCAGCTGCGTGG + Intronic
1184901607 22:47449845-47449867 GCTTCCTTCTGAAGGCTTCGGGG + Intergenic
1184951498 22:47845878-47845900 GATTCCTTCTGGAGGCTCCAGGG + Intergenic
1184993433 22:48185574-48185596 GGTTCCTTCTGGAGGCTCCTGGG - Intergenic
1185169547 22:49284782-49284804 CATTCTTTTTCGAGGTTGCGTGG + Intergenic
1185188706 22:49418928-49418950 CACTCCTTCTGGAGGCTCTAGGG + Intronic
1185226946 22:49658557-49658579 CGTTCCCTCTGGAGGCTCCAAGG + Intergenic
949092243 3:42037-42059 CAGTCCTTCTGGAGGCTGTAAGG + Intergenic
949362175 3:3243619-3243641 CACTCCCTCTGGAGGCTATGTGG - Intergenic
949383401 3:3470638-3470660 CATACATTCTGGATGCTGTGTGG - Intergenic
949695239 3:6686876-6686898 CGTTCTTTCTGGAGGCTCCAGGG + Intergenic
949890011 3:8726676-8726698 CATTCCTTCTGGAGGTTCTAGGG - Intronic
949907085 3:8866657-8866679 CATTCCCTCTGGAGGCTCTAGGG - Intronic
950068801 3:10135736-10135758 TGTTCCTTCTGGTGGCTGCGTGG + Intergenic
950132145 3:10554573-10554595 CATTCCTTCTGGAGGCTGCGGGG - Intronic
950812663 3:15664364-15664386 TGTTCCTTCTGGTGGCTGCTAGG + Intergenic
951051366 3:18097621-18097643 CATTCCTTCTGGATGCTCTAGGG + Intronic
951551742 3:23881962-23881984 TATTCCTTCTGGTGGGTTCGTGG + Intronic
951787832 3:26442612-26442634 CATTCCTTCTGGAGGCTCTGAGG + Intergenic
951820067 3:26798409-26798431 GGTTCCTTCTGGAGGCTCTGAGG - Intergenic
952025341 3:29073967-29073989 TATTCCTTCTGGAGGCTCTAAGG + Intergenic
952360637 3:32626780-32626802 CATTCCTCCCGGCGGCTTCGTGG - Intergenic
952430116 3:33214829-33214851 CATTCCTCCAGGAGGCTCCTGGG - Intronic
952457246 3:33484795-33484817 CCTTCCTTCTGGAGGCTCTAGGG + Intergenic
952478113 3:33732092-33732114 TTTTCCTTCTGGAGGCTCTGAGG - Intergenic
953124331 3:40077112-40077134 CTTTCCTTCTGGCGGGTTCGTGG + Intronic
953423174 3:42770757-42770779 CATTCCTCCTGGTGGGTTCGTGG - Intronic
953775553 3:45813569-45813591 GGTTCCTTCTGGAGGCTCTGAGG - Intergenic
953805766 3:46066062-46066084 CATTCCTGGTGGAGGGAGCGAGG + Intergenic
954299415 3:49691492-49691514 CATACCTGCTGGTGGCTGCTGGG - Exonic
955142186 3:56280238-56280260 CATTCCTTCTGGAAGCTCTCAGG - Intronic
955412464 3:58664766-58664788 CCTTGCTTCTGGAGGCTCAGAGG - Intronic
955417861 3:58709513-58709535 TCTTCCTTCTGGTGGGTGCGTGG - Intergenic
955632124 3:60985864-60985886 TGTTCCTTCTGGAGGCTCCAGGG + Intronic
956152048 3:66253599-66253621 TATGCCTTCTGGAAGCTGCAAGG - Intronic
956183791 3:66543906-66543928 TATTCCTTCTGGTGGGTTCGTGG + Intergenic
956295032 3:67703167-67703189 GATTCCTTCTGAAGACTTCGAGG - Intergenic
957049784 3:75402541-75402563 CATTCCTTTTGGAGGTTTCAAGG - Intergenic
957541918 3:81582414-81582436 CATTTCTTCTGGAGGCTGTAAGG - Intronic
957631750 3:82724866-82724888 CACTCCTTCTGGAAGCTTCATGG - Intergenic
958195979 3:90243494-90243516 CATTCCTTCTGGAGACTTCAAGG + Intergenic
958419165 3:93912129-93912151 CATTCCTTCTGGAGACTTCAAGG + Intronic
958730557 3:97956322-97956344 CATTCCTTCAGGAGGCTGTAGGG - Intronic
958810600 3:98857188-98857210 CATTCCTCCTGGTGGGTTCGTGG + Intronic
958882453 3:99688315-99688337 CATTCCTTCTGGTGGCTCCTGGG + Intronic
959231936 3:103665951-103665973 CATTCCTTCTGGAGGCACCAGGG + Intergenic
960085911 3:113591188-113591210 CTGTACTTCTGGAGGCTGCAGGG - Intronic
960196630 3:114776503-114776525 CATTCCTTCTGGATGCTCTAGGG - Intronic
960227399 3:115184419-115184441 CATTCCTTCTGGTGGGCTCGTGG + Intergenic
960434488 3:117609070-117609092 TATTCCTTCTGGTGGGTTCGTGG + Intergenic
961604357 3:128082737-128082759 CATGCCTCCTGGAGGGTGCCGGG - Intronic
961638862 3:128352239-128352261 CATTCCTACAGGATGCTGTGAGG - Intronic
961660169 3:128464382-128464404 CACTCCCTCTGGAGGCTGCAGGG - Intronic
961700629 3:128742093-128742115 TATTCCTTCTGGTGGGTTCGTGG + Intronic
961882096 3:130068977-130068999 CATTCCTTTTGGAGGTTTCAAGG - Intergenic
962200867 3:133400197-133400219 CATTGGTCCTGGAGGCTGGGGGG - Exonic
962363252 3:134759103-134759125 CATTCCTTCTGAAGGCTCTAGGG - Intronic
962374321 3:134847521-134847543 CACACCTTCTGGTGGCTGCAGGG + Intronic
962877258 3:139544701-139544723 CATTCCCTCTGGAGGCTCTAGGG + Intergenic
962908144 3:139823938-139823960 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
963075672 3:141344262-141344284 GTTTCCTTCTGGAGGCTTAGGGG + Intronic
963268197 3:143259946-143259968 GCTTCCTTCTGGAGGCTTTGAGG + Intergenic
964206427 3:154179967-154179989 GTTTCCTTCTGGAGGCTGTAGGG + Intronic
964441071 3:156710750-156710772 CATTCATTCTGGAAGCTCTGGGG - Intergenic
964479483 3:157127570-157127592 CATTCCTTCTGGAGGCTCTAGGG + Intergenic
964558498 3:157967120-157967142 CAGTCCTTCTAGAGGCTCTGAGG + Intergenic
964608985 3:158589792-158589814 CATTCCTTCTGGAGTTTATGGGG + Intronic
964723758 3:159793551-159793573 GATTCCTTCTGGAGGCTCTAGGG + Intronic
964977907 3:162641070-162641092 CATTCCTCCTGGTGGGTTCGTGG - Intergenic
965245554 3:166262607-166262629 GATTGCTTCTGGAGGCTACATGG + Intergenic
965422557 3:168480269-168480291 CATTCTTCCTGGAGGCTCTGAGG + Intergenic
965622827 3:170657889-170657911 GGTTCCTTCTGGAGGCTGTAGGG + Intronic
965627803 3:170699306-170699328 ATTGCTTTCTGGAGGCTGCGGGG + Intronic
965658096 3:171011474-171011496 GGTTCCTTCTGGAGGCTTTGAGG - Intronic
966711136 3:182974001-182974023 CACTCCTTTGGGAGGCTGAGAGG + Intronic
967164195 3:186765974-186765996 TGTTCCTTCTGGAGGCTCCAGGG - Intergenic
967288936 3:187900627-187900649 AGTTCCTTCTGGAGGCTGTAGGG + Intergenic
967547614 3:190750329-190750351 GATTCCTTCTGGAGGCTTTAGGG + Intergenic
967784154 3:193471859-193471881 CATTCCTGCAGGGGGCTGGGTGG + Intronic
967894673 3:194386277-194386299 CATTCCTGCCGGAGGCTCCAGGG + Intergenic
968472284 4:787660-787682 CACTCCCTCTGGAGGCTCTGGGG - Intronic
968635088 4:1674135-1674157 GCCTCCTTCTGGAGGCTGAGGGG + Intronic
968751815 4:2393978-2394000 CGTGCCTTCTGGAGGCTCCAGGG + Intronic
969051508 4:4376602-4376624 CATGCCCTCTGAAGGCTCCGGGG + Intronic
969092456 4:4705179-4705201 GGTTCCTTCTGGAGGCTGTGAGG - Intergenic
969094218 4:4719858-4719880 GATTTCTTCTGCAGACTGCGGGG - Intergenic
969240970 4:5897273-5897295 CCTTCCTTCTGGAGGCTCCAGGG - Intergenic
969843858 4:9904277-9904299 GGTTCCTTCTGGAGGCTCCAGGG + Intronic
969916418 4:10495954-10495976 CACTCCTTCTGGAGGCTCCAGGG - Intronic
970010886 4:11457875-11457897 GGTTCCTTCTGGGGGCTACGAGG + Intergenic
970016503 4:11518032-11518054 GGTTCCTTCTGGGGGCTGTGAGG - Intergenic
970018093 4:11535138-11535160 CATTCCTTCTGTAGGCTGTGTGG - Intergenic
970027362 4:11637471-11637493 CATTCATTCTGGATGCTGTGGGG + Intergenic
970639591 4:18049576-18049598 GATTCCTTCTGTAGGCTGCGAGG + Intergenic
970718796 4:18960445-18960467 GATTCTTTCTGGAGGCTACTGGG + Intergenic
971039970 4:22741183-22741205 TATTCCTTCTGGAGGCTCTCAGG - Intergenic
971209044 4:24598714-24598736 CATTCCTTCTGGTGGGTTCGTGG + Intergenic
971367962 4:25992798-25992820 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
971447122 4:26762885-26762907 CATTCCTTCTGGAGGGTCATGGG - Intergenic
971635248 4:29048461-29048483 CATTCCTCCTGGTGGGTTCGTGG - Intergenic
971689330 4:29812468-29812490 CATTCCTGCTGGAGGCTGTAGGG + Intergenic
971797957 4:31253293-31253315 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
971893789 4:32563015-32563037 CATTCCTTCTAGAGGTTTCAGGG + Intergenic
972102138 4:35433021-35433043 CGTTCCTTCTAGAGGCTGTATGG - Intergenic
972180611 4:36460333-36460355 GATTCTTTCTGGAGGCTTCAGGG + Intergenic
972476811 4:39458513-39458535 CACTCCTACTGGAGACTGCCAGG + Exonic
972575096 4:40344144-40344166 CATTCCTTCTGGAGACTCCAGGG - Intronic
972752268 4:42002607-42002629 CATTCCTTTTTGTGGCTGCATGG + Intronic
973322943 4:48828719-48828741 TATTCCTTCTGGTGGGTTCGTGG - Intronic
974089737 4:57299316-57299338 CATTCCTCCTGGTGGGTTCGTGG + Intergenic
974159885 4:58124826-58124848 CATTCCTTCTGGTGGGTTCGTGG + Intergenic
974199563 4:58621556-58621578 ACTTACTTCTGGAGGCTGTGGGG - Intergenic
974523055 4:63010385-63010407 CAGTCCTCCTGGGTGCTGCGTGG + Intergenic
974527521 4:63062490-63062512 CATTCCTTCTGGTGGGTTCTTGG - Intergenic
975160873 4:71122037-71122059 TATTCCTTCTGGTGGGTTCGTGG - Intergenic
975196162 4:71526776-71526798 CATTCCTTCTCGAGGCTCTAGGG + Intronic
975419847 4:74150153-74150175 TATTCCTTCTGGAGGCTCTAAGG - Intronic
975517886 4:75267147-75267169 TATTCCCTCTGGAGGCTCTGGGG - Intergenic
975798448 4:78033760-78033782 CATTCCTTCTGGAGACTCTAGGG - Intergenic
976399961 4:84596375-84596397 TGTTCCTTCTGCAGGCTGCAGGG + Intronic
976830693 4:89310393-89310415 CACTCTTTCTGGAGACTGAGGGG + Intergenic
977015109 4:91682727-91682749 CATTATTTCTGGAGGCTCCAGGG + Intergenic
977100578 4:92808187-92808209 TGTTCCTTCTGGAGGCTTCAAGG - Intronic
977443036 4:97094679-97094701 GATTCCATCTGGAGGCAGAGTGG + Intergenic
977883745 4:102235473-102235495 CATTCCTCCTGGTGGATTCGTGG - Intergenic
979604509 4:122623478-122623500 CATTCTTTCTGAAGGCTCCAGGG - Intergenic
979845835 4:125510551-125510573 CATTCCTTCTGAAGGCTCTAGGG + Intergenic
979949358 4:126873581-126873603 CATTCCTCCTGGTGGGTTCGTGG + Intergenic
980015675 4:127647323-127647345 CATTCCTTTTGGAGGCTCCAGGG + Intronic
980263486 4:130484922-130484944 CATTCCTTTTTATGGCTGCGTGG - Intergenic
980328536 4:131380086-131380108 CATTCCTTCCGGTGGGTTCGTGG - Intergenic
980739405 4:136930087-136930109 CCTTCCTTCTGGTGGGTTCGTGG - Intergenic
980774633 4:137421991-137422013 TCTTCCTTCTGGTGGCTTCGTGG - Intergenic
980844300 4:138305630-138305652 GGTTCCTTCTGAAGGCTGTGAGG + Intergenic
980848580 4:138353918-138353940 CACTCCTTCTGGAGGCTCTAGGG + Intergenic
981291132 4:143076899-143076921 CATTCCTTCTGGAGGCTTAAGGG - Intergenic
981713691 4:147732623-147732645 CATTCCTCCTCGAGGCAGCGCGG + Intronic
982308849 4:153962845-153962867 GGTTCCTTCTGGAGGCTCTGAGG - Intergenic
982320619 4:154073188-154073210 CATTCCTTCTGGAGGCTCAAGGG - Intergenic
982770315 4:159391027-159391049 TCTTCCTTCTGGAGGGTTCGTGG - Intergenic
982834875 4:160110988-160111010 TGTTCCTTCTGGAGGCTGAGAGG + Intergenic
983672197 4:170250945-170250967 CACACCTTCTGGAGGCTGTGGGG - Intergenic
984099513 4:175468350-175468372 CATTACTTTGGGAGGCTGAGGGG - Intergenic
984285353 4:177721727-177721749 CATTCCTTCTGGAGGCTCTAGGG - Intergenic
984329646 4:178298251-178298273 GAGGCCTTCTTGAGGCTGCGAGG + Intergenic
984468948 4:180140815-180140837 CAGTGCTTTTGGAGGCTGAGTGG + Intergenic
984728822 4:183046397-183046419 CATTCCTCCTGGTGGGTTCGTGG - Intergenic
984799392 4:183699681-183699703 CGTTCCTTCTGGAGGCTCTCAGG + Intronic
985090479 4:186357899-186357921 CCTTCCTTCTGGAGGCTCCTGGG - Intergenic
985198682 4:187461581-187461603 CGTTCCTTCTCGAGGCTCTGCGG + Intergenic
985322859 4:188734173-188734195 CATTCCTTCTGGTGGGTTCATGG + Intergenic
985411716 4:189692433-189692455 CATTCCTCCTGGTGGGTTCGTGG - Intergenic
985443819 4:190007883-190007905 CATTCCTTTTTGTGGCTGAGTGG - Intergenic
985689259 5:1298193-1298215 CCTTCCTGCTGCAGGCTCCGTGG + Intergenic
986082296 5:4407728-4407750 GCTTCCTTCTGGAGGCTGTGGGG + Intergenic
986231566 5:5868961-5868983 TACTCCTCCTGGAGGCTGTGGGG + Intergenic
986246495 5:6011931-6011953 CCTTCCTTCTGGCTGCTGCATGG + Intergenic
986290064 5:6392707-6392729 CACTCCTTCTGGGGGCTGCGGGG + Intergenic
986649876 5:9952836-9952858 TATTCCTTCTGGAGGCTCTCAGG + Intergenic
986993457 5:13579598-13579620 TATTCCTTCTGGTGGGTTCGTGG - Intergenic
987103243 5:14611488-14611510 CGTTCCTTCTGGAGGCTATGGGG - Exonic
987214125 5:15715015-15715037 CGTTCCTTCTAGAGGCTCAGGGG - Intronic
988188309 5:27897099-27897121 CATTCTTTCTGGAGACTCCAAGG - Intergenic
988452534 5:31357638-31357660 CATTCCTTCTGGAATCTCCAGGG + Intergenic
988692032 5:33581988-33582010 AATTCCTTCTGAAAGCTGGGAGG - Intronic
988754339 5:34230240-34230262 CATTCCTTCTATAGGCTCTGTGG - Intergenic
988932833 5:36053765-36053787 CATTTCTTCTGGAGGCTCTGGGG + Intronic
989213225 5:38878337-38878359 CATTCATGCTGGGGGCTGGGGGG + Intronic
989543291 5:42642793-42642815 GGTTCCTTCTGGAGGCTCTGAGG + Intronic
989729676 5:44633687-44633709 CATTCCTTCTGGAGGCTTCAGGG - Intergenic
989963976 5:50448060-50448082 TATTCCTTCTGGTGGATTCGTGG + Intergenic
990233812 5:53744825-53744847 CATTCCTTTTGATGGCTGCATGG - Intergenic
990506673 5:56452006-56452028 AGTTCCTTCTGGAGGCTCAGAGG - Intergenic
990575879 5:57123048-57123070 CATTCCCTCTGGAGGATCCAGGG - Intergenic
990592607 5:57281595-57281617 CATTCCTTCTGGAGGCTCTAGGG - Intergenic
990665573 5:58068525-58068547 CATTCCTCCTGGTGGGTTCGTGG + Intergenic
990706527 5:58536036-58536058 CATACCTTCTGGTGGCTGCTGGG + Intergenic
990737335 5:58878576-58878598 CATTCCTTCTGGAAGTTCTGGGG - Intergenic
991122170 5:63029211-63029233 TATTCCTTCTGGAGACTCCAGGG - Intergenic
991217504 5:64172375-64172397 CATTCCTTGTGGGGGGTGGGGGG - Intronic
991404212 5:66285941-66285963 CATTCCTTCTGGAGGCTCTAGGG + Intergenic
991503512 5:67301183-67301205 GGTTCCTTCTGAAGGCTGTGAGG - Intergenic
991508540 5:67351547-67351569 GGTTCCTTCTGGAGACTCCGAGG + Intergenic
991599339 5:68336856-68336878 CATTCCTTCTGGAGACTCTAAGG - Intergenic
991621203 5:68547121-68547143 GGTTCCTTCTGAAGGCTGTGAGG + Intergenic
991701007 5:69316500-69316522 CGTTCCTTCTGGAGGTTCAGTGG - Intronic
991742116 5:69691087-69691109 CATTCCTTCTATAGGCTCTGTGG - Intergenic
991755577 5:69864121-69864143 CATTCCTTCTATAGGCTCTGTGG + Intergenic
991793690 5:70270827-70270849 CATTCCTTCTATAGGCTCTGTGG - Intergenic
991821506 5:70566391-70566413 CATTCCTTCTATAGGCTCTGTGG - Intergenic
991834904 5:70739269-70739291 CATTCCTTCTATAGGCTCTGTGG + Intergenic
991908383 5:71535674-71535696 GGTTCCTTCTGGAGGCTCTGAGG + Intronic
991977766 5:72199741-72199763 CTTTCCTCCTGGAGGCGGTGGGG - Exonic
992124457 5:73626288-73626310 CCTGGGTTCTGGAGGCTGCGGGG + Exonic
992356202 5:75986451-75986473 GATTCCTTCTGGAGGCTCTGAGG - Intergenic
992523791 5:77585633-77585655 CATTCCTTTTTATGGCTGCGTGG - Intronic
992713011 5:79479577-79479599 CACTCCTTCAGGAGGCTGTAGGG - Intronic
992887051 5:81169396-81169418 CATACTTTCTGGAGGCTCTGGGG + Intronic
993180297 5:84543919-84543941 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
993202051 5:84829572-84829594 CATTCCTCCTGGTGGGTTCGTGG + Intergenic
993282302 5:85940296-85940318 CATTCCTTCTGGAGGCACTAGGG + Intergenic
993382655 5:87225262-87225284 CATTCTTTCTGGAGGCTGAAAGG - Intergenic
993945406 5:94111828-94111850 CCTTCCTTGTGAAGGCTGCCTGG + Intergenic
994164688 5:96596393-96596415 CGTTCCTTCTGGAGGTTCTGAGG - Intronic
994227152 5:97265708-97265730 CATTGCTTCTAGAAGCTCCGAGG + Intergenic
994250658 5:97533086-97533108 GGTTCCTTCTGGAGGCTCTGGGG + Intergenic
994383206 5:99096489-99096511 GATTCCTTCTGGTGGCTGTAGGG + Intergenic
994411277 5:99410083-99410105 CCTTCCTTCTGGTGGGTTCGTGG + Intergenic
994482552 5:100355164-100355186 CCTTCCTTCTGGTGGGTTCGTGG - Intergenic
994751333 5:103740601-103740623 CATTCCTTTTGGAGGCAGTAGGG - Intergenic
994851721 5:105063376-105063398 GATTCCTTCTGGAGGCTGCAAGG - Intergenic
995060147 5:107804775-107804797 CATTCCTTATGGAGGCTCTAGGG + Intergenic
995137454 5:108695411-108695433 CCTTCCTTCTGGAGGCTCTACGG - Intergenic
995262119 5:110116362-110116384 CATTCCTTCTGGAGGCTCTAGGG + Intergenic
995405948 5:111796095-111796117 CATGCCTTCTGGAGGCTCTATGG + Intronic
995735199 5:115293497-115293519 CATTCATTCTGGAAGCTTCAGGG + Intronic
995756835 5:115514404-115514426 AATTCCTTCTGGAGGCTCTGAGG + Intergenic
996643024 5:125780165-125780187 CATTCCTTCTGGGGGATTTGGGG + Intergenic
996960798 5:129246763-129246785 CATTCCTTATAGAGGCTCTGAGG - Intergenic
997120570 5:131168613-131168635 CATTCCTTCTGGATGCTCTAGGG + Intronic
997693700 5:135845121-135845143 GATGCCTTCTGGAGGCTCCGAGG + Intronic
998094642 5:139390384-139390406 CATTCCTTCTGGTGGTTGAGTGG - Intergenic
998773242 5:145569998-145570020 GATTCCTTCAGAGGGCTGCGAGG + Intronic
999447327 5:151650496-151650518 CCTTCCTTCTGGTGGCTGCATGG - Intergenic
999615689 5:153420742-153420764 AATTCCTTCTGGAGGCTCTAGGG + Intergenic
1000278846 5:159764530-159764552 CATTCATTCCAGAGGCTGCTGGG - Intergenic
1000399300 5:160808893-160808915 GGTTCCTTCTGGGGGCTGTGAGG + Intronic
1000889146 5:166783676-166783698 TCTTCCTTCTGGTGGGTGCGTGG + Intergenic
1001706338 5:173743734-173743756 CATTCCTCCTGGAGGCTTTAGGG - Intergenic
1001798619 5:174523907-174523929 CATTCCTCCTGGAGGCTGTGGGG + Intergenic
1001907523 5:175485349-175485371 CCTTCCTTCTGGAGGCTCTAGGG + Intronic
1002086279 5:176777599-176777621 GGTTCCTTCTGAAGGCTGTGAGG - Intergenic
1002086679 5:176780298-176780320 CATTCCTTCTAGAGGCTCCAGGG - Intergenic
1002329496 5:178431669-178431691 GCTTCCTTCTGGAGGCTCCAGGG - Intronic
1002447678 5:179299640-179299662 CATTCCTTCTGGAAGCTCTAAGG + Intronic
1003147368 6:3520025-3520047 GGTTCCTTCTGGAGGCTCCAAGG - Intergenic
1003373505 6:5551717-5551739 GGTTCCTTCTGGAGGCTCTGGGG + Intronic
1003429336 6:6024683-6024705 CTTTCCTTCTGAGGGCTGTGAGG + Intergenic
1004163656 6:13236466-13236488 GGTTCCTTCTGAGGGCTGCGAGG + Intronic
1004222418 6:13758267-13758289 TGTTCCTTCTGGAGGCTTCAAGG - Intergenic
1004232266 6:13844106-13844128 GGTTCCTTCTGGAGGCTCTGAGG - Intergenic
1004318812 6:14616133-14616155 GAATCCTTCTGGAGGCTCCAGGG + Intergenic
1004361716 6:14977146-14977168 GGTTCCTTCTGGAGGCTCCGAGG + Intergenic
1004505323 6:16242483-16242505 GATTCCTTCTGAGGGCTGGGAGG + Intronic
1004576488 6:16900660-16900682 CGTTCCTTCTGGAGGCTCTAGGG - Intergenic
1004665361 6:17744415-17744437 CCTTCCTTCTGGTGGGTTCGTGG + Intergenic
1004861242 6:19806374-19806396 CATTCCTTCTGGTGGGTTTGTGG + Intergenic
1005027062 6:21473447-21473469 GATTCCTTCTGAGGGCTGTGAGG + Intergenic
1005424312 6:25685129-25685151 CATTCCTTCTGGAGGTTCTCGGG - Intronic
1005552524 6:26937095-26937117 CATTCCTTCTATAGGCTCTGTGG - Intergenic
1005935651 6:30518938-30518960 CGTTCCTTCTGGTGGGTTCGTGG - Intergenic
1006591881 6:35164268-35164290 CAGTCCATCTGGAGGCTTTGGGG - Intergenic
1006944546 6:37776747-37776769 ATTTCCTTCTGGAGGCTCTGGGG + Intergenic
1007973480 6:46076583-46076605 TTTTCCTTCTGGAGGCTCTGGGG - Intronic
1008132438 6:47734087-47734109 CATTCCTTCTGGATGCTCCAGGG - Intergenic
1008376802 6:50801267-50801289 CATTCCTTTTTATGGCTGCGTGG + Intergenic
1008538470 6:52526004-52526026 GATTCCTTCTGAGGGCTGTGAGG - Intronic
1008861249 6:56152145-56152167 CATTCTTTCTGGAGGCTCTAGGG + Intronic
1009026226 6:58003558-58003580 CATTCTTTCTGGAGGCTCTAGGG + Intergenic
1009667616 6:66704385-66704407 CATTCCTCCTGGTGGGTTCGTGG + Intergenic
1009868266 6:69424942-69424964 CAGTCCTTCCGGGGGCTGGGCGG + Intergenic
1010302054 6:74272764-74272786 CATTTCTTCTGGAGGCTGTAAGG + Intergenic
1011135122 6:84092026-84092048 CATTCCATCTGGAGGCTCTCAGG + Intergenic
1011292368 6:85790122-85790144 GATTCCTTCTGAAGGCTCTGAGG - Intergenic
1011541777 6:88438055-88438077 GGTTCCTTCTGGAGACTCCGAGG - Intergenic
1011797929 6:90978036-90978058 GCTTCCTTCTGGAGGCTGTGGGG - Intergenic
1011879772 6:92010878-92010900 CCTTCCTTCTGGTGGGTTCGTGG + Intergenic
1011974897 6:93283552-93283574 CGTTCCTTCTGGTGGGTTCGTGG - Intronic
1011997828 6:93615510-93615532 GATTCCTCCTGGAGGCTCCAGGG - Intergenic
1012279592 6:97313012-97313034 GGTTCCTTCTGGAGGCTGCATGG - Intergenic
1012972894 6:105750502-105750524 GATTCTTTCTGCAGGCTGTGAGG + Intergenic
1013455911 6:110329627-110329649 CAGCGCTTCTGAAGGCTGCGAGG + Intronic
1013526536 6:110979695-110979717 CATTCCACCTGGAGGCTTCAGGG - Intergenic
1013817181 6:114112403-114112425 CATTCCTTCTGGAGGCACTAAGG - Intronic
1013863334 6:114662214-114662236 GACTCCTTCTGAAGGCTGTGAGG + Intergenic
1013945322 6:115716083-115716105 TCTTCCTTCTGGTGGCTTCGTGG + Intergenic
1014220121 6:118791538-118791560 CACTCCTTTTGAGGGCTGCGAGG + Intergenic
1015436339 6:133193506-133193528 AGTTCCTTCTGGAGGCTCTGAGG - Intergenic
1016150032 6:140729165-140729187 CATTCCTTCTGGAAGCTCTAGGG + Intergenic
1016237371 6:141884656-141884678 CATTCCTTCTGAATTCTGTGAGG - Intergenic
1016396430 6:143628396-143628418 CATTCCTTCTGGAGGCACTGGGG + Intronic
1016879906 6:148900832-148900854 CGTTCCTTCTGGAAGCTCTGGGG + Intronic
1016940508 6:149479509-149479531 CATTCTGTCTGTAGGCTCCGGGG - Intronic
1017330541 6:153193348-153193370 CAGGCCTTCTGAAGGCTGCCCGG + Intergenic
1017409582 6:154153835-154153857 CACTCCTTGTGGAGGCTCTGGGG - Intronic
1017647415 6:156551835-156551857 GATTCTTTCTGGAGGCTTTGGGG - Intergenic
1017878921 6:158546257-158546279 CATTCCTACTGCAGCCTGAGGGG - Intronic
1018146695 6:160898155-160898177 GATTCCTTCTGGGGGCTGTGAGG - Intergenic
1018209786 6:161469711-161469733 CATTCCTTCTGGAGGCTGTGGGG - Intronic
1018230460 6:161670350-161670372 GCTTCCTTCTGGAGGCTCTGAGG + Intronic
1018508223 6:164494296-164494318 TGTTCCTTCTGGAGGCTGCAGGG - Intergenic
1018541339 6:164883033-164883055 GGTTCCTTCTGGGGACTGCGAGG + Intergenic
1018883944 6:167916078-167916100 GATTCCTTCTGGGGGCTCTGAGG + Intronic
1018967241 6:168498592-168498614 CCTTCCTGCTGCAGGCTGAGTGG + Intronic
1019009029 6:168826326-168826348 GTTTCCTCCTGGAGGCTCCGTGG + Intergenic
1019148913 6:169991341-169991363 GGTTCCTTCTGGAGGCTCCTGGG - Intergenic
1019176947 6:170164814-170164836 GGTTCCTTCTGGAGGCCGCAGGG - Intergenic
1019503469 7:1377491-1377513 GGCTCCTTCTGGAGGCTGCAGGG + Intergenic
1019883194 7:3881434-3881456 CATTCCTTTTTGTGGCTGCATGG + Intronic
1019930542 7:4220088-4220110 CTTTGCTTCTGGCGGCTGCAGGG + Exonic
1020892241 7:13892836-13892858 GGTTCCTTCTGGAGGCTCCAGGG - Exonic
1021084792 7:16409241-16409263 CATTCCTTCTGGAAGATTTGGGG - Intronic
1021113772 7:16725506-16725528 CATTCCTTCTGGATGCTCTAGGG + Intergenic
1021131828 7:16921169-16921191 GATTCCTTCTGGAGGCTCCAGGG + Intergenic
1021362656 7:19734699-19734721 CATTCTTTCTGGAGGCTCCAGGG - Intronic
1021574064 7:22091529-22091551 TATTCCTTCTGGTGGATTCGTGG - Intergenic
1021602674 7:22379845-22379867 CATGCCTTTTGGAGGCTGAGAGG + Intergenic
1021629358 7:22629286-22629308 TATTCCCTCTGGAGGCTCCAGGG - Intronic
1022067937 7:26879972-26879994 CATTCCTTCTGGAGGCTCCAGGG - Intronic
1022074390 7:26953256-26953278 TGTTCCTTCTGGAGGCTCTGAGG + Intronic
1022209782 7:28197047-28197069 CATTCTTTCTGGAGGCTCTAGGG + Intergenic
1022247596 7:28575571-28575593 CCTTCCTGCTGGAGACAGCGGGG + Intronic
1022363479 7:29685452-29685474 CCTTCCTGCTGGAGACAGCGAGG - Intergenic
1022427809 7:30285073-30285095 CCTTCCTGCTGGAGCCAGCGAGG + Exonic
1022448096 7:30486313-30486335 CATTCCTTCTGGAGGGTCTGTGG - Intergenic
1022450197 7:30506843-30506865 CATTCCTTCTGGTGGGTTTGTGG + Intronic
1022450234 7:30507115-30507137 CATTCCTTCTGGTGGGTTTGTGG + Intronic
1022488102 7:30795724-30795746 CATTCCTTCTGGAGCCTCTAGGG + Intronic
1022697895 7:32728286-32728308 CCTTCCTGCTGGAGCCAGCGAGG + Intergenic
1022727011 7:32990368-32990390 TGTTCCTTTTGGAGGCTGCCGGG - Intronic
1022834848 7:34103589-34103611 CATTCCTCCTTGAGGCAGAGGGG + Intronic
1022911483 7:34903026-34903048 CATTCCTTCTGGAGGTTCTGAGG - Intergenic
1023052980 7:36269046-36269068 GTTTCCTTCTGGAGTCTGCATGG + Intronic
1023520676 7:41047231-41047253 CAGTCCTCCTGGATGCTGCCTGG + Intergenic
1023574643 7:41613805-41613827 CATTCCTTCTGAAGGCTCCAGGG + Intergenic
1023658557 7:42450507-42450529 CATTCCTTTTGGAGGCTCTAGGG - Intergenic
1023864212 7:44231221-44231243 CATGCCCTCTGGCGGCTGCAGGG + Intronic
1024443266 7:49446369-49446391 CATTCCTCCTGGTGGGTTCGAGG - Intergenic
1024835502 7:53513486-53513508 TATTTCTTCTGGAGGCTGTAGGG + Intergenic
1024907082 7:54397929-54397951 CCTTCTTTCTGGAGGCTCCAGGG + Intergenic
1025046571 7:55697265-55697287 TGTTCCTTTTGGAGGCTGCCGGG + Intergenic
1025251149 7:57352456-57352478 GGTTCCTTCTGGAGGCTTCAGGG + Intergenic
1026120349 7:67531479-67531501 CATTCCTTCTGGAGGTTTTTGGG + Intergenic
1026236801 7:68534404-68534426 CATTCCTCCTGGTGGGTTCGTGG + Intergenic
1026502359 7:70953448-70953470 CATTCCTTCTGGAAGCTCTTGGG - Intergenic
1026512526 7:71038805-71038827 CCTTCCTTCTGGTGGGTTCGTGG - Intergenic
1026539234 7:71265967-71265989 CCTTCCTTCTGGAAGCTCCAAGG + Intronic
1027388628 7:77683010-77683032 GATTCCTTCTGAGGGCTGTGAGG + Intergenic
1027435530 7:78160157-78160179 CATTGCTACTGGGGGCAGCGTGG + Exonic
1027649656 7:80850955-80850977 CAGTCCCTCTGGAGGCTTTGGGG + Intronic
1027693917 7:81384728-81384750 CATTCCTTCTGGATCCTCCAGGG + Intergenic
1027875862 7:83767216-83767238 GATTCTTTCTGGAGGCTCCAAGG + Intergenic
1027943641 7:84717763-84717785 CATTCCTTCTGGAGGTTCTAGGG - Intergenic
1028572493 7:92306267-92306289 CATTCCTTTTGGAGGCTCCAGGG + Intronic
1028853353 7:95561888-95561910 GATTCTTTCTGGGGGCTGTGAGG - Intergenic
1028937746 7:96485342-96485364 CATTCCTTCTCAAGGCTTCAGGG + Intronic
1028983976 7:96995862-96995884 GATACCTTCTGGAGGCTTAGTGG - Intergenic
1029904103 7:104072751-104072773 CGTTCCTTCTGGTGGGTTCGTGG - Intergenic
1029972973 7:104807344-104807366 GATTCCTTCTGGTGGCTGTGAGG - Intronic
1030318148 7:108137364-108137386 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
1030386377 7:108872394-108872416 GATTCCTTCTGGAGGCTCTTAGG + Intergenic
1030397796 7:109010062-109010084 CATGCCTTCTGGAGGATTCCTGG + Intergenic
1030446598 7:109653100-109653122 CATTCCTTCTGGAGATTGTAAGG - Intergenic
1030557551 7:111045741-111045763 CATTCCTTTTGGAGGCTCTAGGG - Intronic
1030772076 7:113487520-113487542 CATTCCTCCTGGTGGGTTCGTGG + Intergenic
1031132084 7:117844202-117844224 CATTTCTTCTGGAGGTTCCATGG - Intronic
1031137471 7:117900774-117900796 CATTCCTTCTGGAGGCTCTAGGG + Intergenic
1031201965 7:118699804-118699826 CATTCCTTCTGAAGGCTCCAGGG - Intergenic
1031513134 7:122673067-122673089 CATTCCTTCTGGTGGGTTCGTGG + Intronic
1031681973 7:124686550-124686572 TGTTCCTTCTGGAGGCTCCAGGG - Intergenic
1032016520 7:128383645-128383667 CATTCCTCCTGGAGGCTCTAGGG - Intergenic
1032611941 7:133424321-133424343 CATTCCTTCTGGTGGGTTCGTGG - Intronic
1032894242 7:136233292-136233314 CATTCTTTCTGGAGGCTTCAGGG - Intergenic
1033065248 7:138147281-138147303 TATTCCTTCTGGTGGGTTCGTGG - Intergenic
1033657137 7:143381762-143381784 CATACCTTCCGGGGGCGGCGGGG - Exonic
1033814672 7:145057429-145057451 CATCCCTTCTGGAGGCTCTGGGG + Intergenic
1033951203 7:146787499-146787521 CCTTCCTTCTGGTGGGTTCGTGG + Intronic
1034220514 7:149441461-149441483 TATTCCTTCTGGAGGATGTTCGG + Intronic
1034353077 7:150429831-150429853 GGTTCCTTCTGGAGGCTCCAAGG - Intergenic
1034472950 7:151265370-151265392 GGTTCCTTCTGAAGGCTGTGAGG - Intronic
1034540644 7:151755939-151755961 GGTTCCTCCAGGAGGCTGCGGGG + Intronic
1034685764 7:152970014-152970036 CATTGCTGCAGGAGGCTGCTTGG - Intergenic
1037232967 8:16681859-16681881 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
1037420667 8:18698577-18698599 TATTCCTTCTGGAGGCTCGAGGG - Intronic
1037574055 8:20184424-20184446 CATTCCTTCTGGAGATTCTGGGG + Intergenic
1038030920 8:23638425-23638447 CAGTCTCTCTGGAGGCTGCAGGG - Intergenic
1038403958 8:27308121-27308143 CATTCCTTTTGGAGGCTCCAGGG - Intronic
1039073852 8:33670993-33671015 TATTTCTTATGGAGGCTGTGGGG - Intergenic
1039134563 8:34306208-34306230 TATTCCTTCTGGAGGCTTCGGGG + Intergenic
1039135369 8:34316699-34316721 CATTTCTTCTGGAGGCTTCAGGG + Intergenic
1039581983 8:38674584-38674606 CACTCCCTCTGGAGGCGGCAGGG + Intergenic
1040015114 8:42693299-42693321 CATTCCTGCTGTAGCCTGCCTGG - Intergenic
1040896556 8:52374405-52374427 GCTTCCTTCTGGAGGCTCCGAGG - Intronic
1040908582 8:52494590-52494612 GGTTCCTTCTGGAGGCTCCAGGG - Intergenic
1041440311 8:57888070-57888092 TGGTCCTTCTGGAGGCTGAGGGG - Intergenic
1041660102 8:60392954-60392976 GGTTCCTTCTGGGGGCTGTGAGG - Intergenic
1041865431 8:62567728-62567750 CATTCCTTCTGGAGGCCATAGGG - Intronic
1042062894 8:64840395-64840417 AGTTCCTTCTGGAGGCTCTGGGG - Intergenic
1042069487 8:64915148-64915170 CATTTCTTCTGGAGGCTCCAGGG - Intergenic
1042874183 8:73425443-73425465 GGTTCCTTCTGAAGGCTGTGAGG - Intronic
1043270603 8:78328955-78328977 TATTCCTTCTGGTGGGTTCGTGG + Intergenic
1043741006 8:83811349-83811371 CATTCCTTCTGGAAAGTTCGTGG - Intergenic
1044237838 8:89852412-89852434 CATTCCTTCTGGAGGCTCCAGGG + Intergenic
1044405054 8:91817471-91817493 CATTCCTCCTGGTGGGTTCGTGG - Intergenic
1044457007 8:92400822-92400844 CATTCCTTCTGGTGGGTTCATGG + Intergenic
1044464662 8:92489198-92489220 GGTTCCTTCTGGAGGCTCTGAGG + Intergenic
1044478752 8:92660029-92660051 CATTCCTTCAGGAGGCTCTCCGG - Intergenic
1044725906 8:95193999-95194021 CATTCCTTCCAGAGGCTCCGGGG - Intergenic
1044826990 8:96208192-96208214 CACTCCTTCTGGAAGCTTTGGGG + Intergenic
1044879408 8:96707800-96707822 CATTCCTTCTGGAGGCTCTAGGG + Intronic
1045391247 8:101716969-101716991 TGTTCCTTCTGGAGGCTGTTGGG - Intronic
1045486158 8:102633287-102633309 GATTCCTTCTGGAGGCTCTAAGG - Intergenic
1045504106 8:102766629-102766651 CATTCCTTCTGGAGGTGCTGGGG + Intergenic
1045662937 8:104456837-104456859 CATTTCTTCTGGAAGCAGTGTGG - Intronic
1046070595 8:109248221-109248243 CATTCATTCTGGAGGCTCTAGGG - Intronic
1046380707 8:113446290-113446312 GATTCTTTCTGGAGGCTCTGGGG - Intergenic
1046497911 8:115037625-115037647 CATTCCTCCTGGTGGGTTCGTGG - Intergenic
1046507797 8:115158678-115158700 CATTCCTCCTGGTGGGTTCGTGG + Intergenic
1046526208 8:115385123-115385145 CATTCCCTCTGGAGGCTCTAGGG - Intergenic
1046692249 8:117298956-117298978 CATTCCTTCTGGAGGCTCCAGGG - Intergenic
1047054761 8:121151723-121151745 CACTCCTTCTGGAGGCTCCAGGG + Intergenic
1047295874 8:123570151-123570173 GGTTCCTTCTGGAGGCTGTAGGG - Intergenic
1047324719 8:123825264-123825286 GGTTCCTTCTGGAGGCTCTGGGG - Intergenic
1047407166 8:124595397-124595419 CATTCCTTCTGGAGGCTGCAGGG + Intronic
1047559546 8:125971895-125971917 GATTCCTTCTGCAGGCTGTGAGG + Intergenic
1047584636 8:126257940-126257962 CATTGCTTCTGGAGGCTCTGGGG + Intergenic
1047655236 8:126970220-126970242 CATTCCTCCTGGAGGCTCCATGG + Intergenic
1047814303 8:128445796-128445818 GGTTCCTTCTGCAGGCTGTGAGG + Intergenic
1047905924 8:129473252-129473274 CATTCTTTCTGGAGGCTCTGGGG - Intergenic
1047964940 8:130039521-130039543 TGTTCCTTCTGGAGGCTCCAGGG - Intergenic
1048217881 8:132513386-132513408 CATTTCTTCTGGAGGCTGTAGGG + Intergenic
1048440103 8:134453444-134453466 CATCCCTTCTGGAGGCTCCAGGG + Intergenic
1048509988 8:135053685-135053707 TGTTCCTTCTGGAGGCTCCAAGG - Intergenic
1048582258 8:135739328-135739350 TATTCCTTCTGAGGGCTGCCAGG - Intergenic
1048752898 8:137699811-137699833 CAAGCTTTCTGGAGGCTGAGGGG + Intergenic
1048867549 8:138771915-138771937 CACGCTTCCTGGAGGCTGCGGGG - Intronic
1048965475 8:139611530-139611552 CACTTCTGGTGGAGGCTGCGAGG - Intronic
1049003561 8:139841080-139841102 CATTCCTCCTGGAAGCTCCAGGG + Intronic
1049827059 8:144675748-144675770 CATTCCTTCCGGTGGGTTCGTGG + Intergenic
1050920794 9:11198117-11198139 TATTCCTTCTGGTGGGTTCGTGG - Intergenic
1051301741 9:15658758-15658780 CATTCCTTCTGGAGACTCTAGGG - Intronic
1051310635 9:15767253-15767275 TATTCCTTCCGGAGGCTGTAAGG + Intronic
1051314019 9:15809642-15809664 CATTCCTCCTGGTGGCTTCATGG + Intronic
1051510644 9:17874283-17874305 CATTCCTTCTGGAGGCTCTAGGG - Intergenic
1051724302 9:20072818-20072840 GCTTCCTTCTGAAGGCTGTGAGG - Intergenic
1051784653 9:20729221-20729243 GATTCCTTCTGGAGGCTCTGTGG + Intronic
1052278143 9:26702078-26702100 CATTCCTTCTGGAGGCTCAAAGG - Intergenic
1052684954 9:31743934-31743956 CATTCTTTCTGGAGGCTCTAAGG + Intergenic
1052988549 9:34505213-34505235 CATTCCCTCTTGAGGCTCCAGGG + Intronic
1053049854 9:34951596-34951618 TATTCCTTCTGGAGGCTCTTGGG - Intergenic
1053214733 9:36260987-36261009 CCTTCCTACTGGAGGCTGCCAGG + Intronic
1053624894 9:39859554-39859576 GATTCCTTCTGGTGGGTTCGTGG + Intergenic
1053879975 9:42583674-42583696 GATTCCTTCTGGTGGGTTCGTGG - Intergenic
1053892688 9:42710637-42710659 GATTCCTTCTGGTGGGTTCGTGG + Intergenic
1054219002 9:62391144-62391166 GATTCCTTCTGGTGGGTTCGTGG - Intergenic
1054231714 9:62518025-62518047 GATTCCTTCTGGTGGGTTCGTGG + Intergenic
1054734469 9:68736573-68736595 CACTCCTTCTGGAGGCTCCAGGG + Intronic
1054736822 9:68761575-68761597 CCTTCCTTTTGGAGGCTCTGGGG + Intronic
1054760537 9:69000524-69000546 GATTCCTTCTGAGGGCTGTGAGG + Intronic
1055054953 9:72014983-72015005 GATTCCTTCTGAGGGCTGTGAGG + Intergenic
1055363783 9:75523055-75523077 CATTCTTTCTAGAGGCTCCAGGG - Intergenic
1055722063 9:79186198-79186220 CATTCCTTCTGGAAGCTCTGGGG + Intergenic
1055740181 9:79379823-79379845 GGTTCCTTCTGGAGGCTCCAGGG + Intergenic
1056198358 9:84250420-84250442 CATTCCTTCTGGAGGCTCTGGGG - Intergenic
1056366991 9:85915466-85915488 CACTCCTGCTGGAGGCTCCAGGG - Intergenic
1056478839 9:86980495-86980517 CATTCCTTCTGGAGGCTTTGGGG + Intergenic
1056656308 9:88512215-88512237 CATTGCAGCTGGAGGCTGCCTGG + Intergenic
1056730022 9:89157415-89157437 CATTTGTTCTGGAGGCTTCCGGG - Intronic
1056897426 9:90564013-90564035 CAATCTTTCTGAAGGCTGGGAGG + Intergenic
1056942113 9:90964766-90964788 CCCGCCTTCTGTAGGCTGCGTGG + Intergenic
1056983780 9:91342153-91342175 CATTCCTTCTGGAGGCACTAGGG + Intronic
1057166524 9:92931528-92931550 GGTTCCTTCTGGAGGCTTTGGGG - Intergenic
1057860595 9:98637735-98637757 CTTTCCTTCTGGAGGCTTTAGGG - Intronic
1057954793 9:99398939-99398961 CATTCCTTTTGGAGACTCCAGGG - Intergenic
1057994150 9:99804808-99804830 CATTCCCTCTGGAGGCTCTTTGG - Intergenic
1058116558 9:101091407-101091429 CATGTCTTCTGGAGGCTCTGGGG + Intronic
1058175333 9:101729365-101729387 CATTCTTTCTGGAGCCTCTGAGG + Intronic
1058256131 9:102766303-102766325 CATTCCTTCTGGAGGCTCTGGGG - Intergenic
1058286712 9:103187849-103187871 CATTCCTCCTGGTGGGTTCGTGG - Intergenic
1058365331 9:104201781-104201803 CATTCCTTCCGGTGGGTTCGTGG - Intergenic
1058862299 9:109128087-109128109 GGTTCCTTCTGGAGGCTCCAGGG - Intergenic
1058918279 9:109588348-109588370 GATTCCTTCTGAAGGCCGTGAGG - Intergenic
1058974581 9:110114158-110114180 GGTTCCTTCTGGAGGCTTTGAGG + Intronic
1059432459 9:114258388-114258410 CCTTCCATGTGGAGGCTGCTGGG + Intronic
1059591293 9:115665644-115665666 GAATCCTTCTGGAGGCTTTGAGG + Intergenic
1059704794 9:116812501-116812523 CATTCCTTCTGGAGGCCTTAGGG - Intronic
1060921442 9:127423312-127423334 CATTCCTTCTGGAGGTTCCAGGG - Intergenic
1061035813 9:128113876-128113898 TGTTCCTTCTGGAGGCTCCAGGG - Intergenic
1061229645 9:129307460-129307482 CATTCCTTCTGGAAGCTCTAGGG - Intergenic
1061615959 9:131779092-131779114 CATTCCTTCTGGAGCCTCTAGGG - Intergenic
1061776128 9:132965740-132965762 GGTTCCTTCTGGAGTCTCCGAGG - Intronic
1062127773 9:134873326-134873348 GGTTCCTTCTGGAGGCTTCTGGG + Intergenic
1062146047 9:134990313-134990335 TCTTCCTTCTGGAGGGTTCGCGG + Intergenic
1062155237 9:135044600-135044622 GCTTCCTTCTGGAGGCTCTGGGG + Intergenic
1062387463 9:136318654-136318676 CCCTACTTCTGCAGGCTGCGGGG - Intergenic
1062414114 9:136439357-136439379 CCTCCCTTCCGGCGGCTGCGGGG + Exonic
1203733563 Un_GL000216v2:113925-113947 GGTTCCTTCTGGAGGCTCCAGGG - Intergenic
1203670880 Un_KI270755v1:10549-10571 CATTCCTCCTGGTGGGTTCGTGG + Intergenic
1185501478 X:599960-599982 GATTCCTCCTGGAGGCGTCGAGG + Intergenic
1185666645 X:1770553-1770575 GGTTCCTTCTGGAGGCTCAGAGG - Intergenic
1185882606 X:3754869-3754891 GGTTCTTTCTGGAGGCTGTGGGG - Intergenic
1186117717 X:6322360-6322382 CATTCCTTTTGGAGGCTCTAGGG - Intergenic
1186169802 X:6864640-6864662 CGTTCATTCTGGAGGCTCTGGGG + Intergenic
1186200354 X:7149725-7149747 AATTCCTTCTGAGGGCTGTGAGG + Intergenic
1186295525 X:8144540-8144562 CATTCCTCCTGGTGGGTTCGTGG + Intergenic
1186501614 X:10055347-10055369 CATTCCTTCTGGAGGTTCTGGGG - Intronic
1186650252 X:11551853-11551875 GGTTCCTTCTGAAGGCTGTGGGG - Intronic
1186703181 X:12113405-12113427 CATTCCTTCTGGAGGCTCTCAGG + Intergenic
1186765123 X:12762935-12762957 GAATCCTTCTGAAGGCTGTGAGG - Intergenic
1186769414 X:12803134-12803156 TATTCCTTTTGGAGGCTGCAGGG + Intronic
1186891296 X:13961535-13961557 TATTCCTTCTGGAGGCTTCAGGG - Intergenic
1187306806 X:18102518-18102540 TGTTCCTTCTGGAGTCTTCGGGG - Intergenic
1187333884 X:18365022-18365044 CATTCCTTTTGGAGGCTCTAGGG + Intergenic
1187558806 X:20379591-20379613 AATTCCTTCCGGAGGCTTCAGGG + Intergenic
1187576866 X:20566110-20566132 CATTCCTTCTGGAGGCTCTAGGG + Intergenic
1187583844 X:20638249-20638271 CATTTCTTCTGGAGGCTTTAGGG - Intergenic
1187705686 X:22007222-22007244 GGTTCCTTCTGGAGGCTCCTGGG + Intergenic
1187971013 X:24658468-24658490 CATTTCTTCTGGAGGCTCTAGGG + Intronic
1188092975 X:25986219-25986241 ATTTCCTTCTGGAGGCTGTAAGG - Intergenic
1188268938 X:28114522-28114544 TATTCCTTCTGGAGACTGGAGGG - Intergenic
1188277137 X:28214357-28214379 CATTCCTTCTGGAGACTCTAGGG - Intergenic
1188326170 X:28804481-28804503 CATTCCTTTAGGAGGCTCCAGGG + Intronic
1188355271 X:29183006-29183028 CTTTCCTTCTGGAGGCTCTAAGG - Intronic
1189187799 X:39069279-39069301 TATTCCTTCTGGTGGGTTCGTGG + Intergenic
1189220789 X:39369935-39369957 GGTTCCTTCTGGAGGCTCTGAGG - Intergenic
1189355494 X:40307177-40307199 GATTCCTTCAGGAGGCTCTGGGG - Intergenic
1189360313 X:40344870-40344892 CATTCCTCCTGGAGGCTCTAGGG + Intergenic
1189559527 X:42177806-42177828 GGTTCCTTCTGAAGGCTGTGCGG + Intergenic
1189947566 X:46194749-46194771 GGTTCCTTCTGGAGGCTCTGAGG - Intergenic
1189958585 X:46303259-46303281 CATTCTTTCCGGAGGCTCTGGGG - Intergenic
1190102093 X:47529615-47529637 GGTTCCTTCTGGGGGCTGTGAGG + Intergenic
1190118623 X:47642185-47642207 CGTTCCTTCTGGAGGCTCTAGGG - Intronic
1190373691 X:49767225-49767247 CATTCCTAATGGGGGCTGAGGGG + Intergenic
1190517007 X:51234255-51234277 CATTCCTTCTGGAGGCTCTAGGG - Intergenic
1190528579 X:51352467-51352489 CATTTCTTCTGGAGGCTTCTGGG + Intergenic
1190576685 X:51846450-51846472 CATTACTTCTGGAGGCTTTTGGG - Intronic
1190825488 X:54014343-54014365 CATGGCTTCTGGAGGCAGCCAGG - Intronic
1191189657 X:57653055-57653077 CCTTCCTTCTGGATGCTCCAGGG - Intergenic
1191870894 X:65743927-65743949 CATTTCTTCTGGAGGCTCTAGGG - Intergenic
1192223120 X:69210750-69210772 CATGCCTTCCTGAGGCTGCCTGG - Intergenic
1192617554 X:72643517-72643539 GATTCCTTCTGGAGGCTCCAGGG + Intronic
1194340286 X:92698730-92698752 TATTCCTTCTGGTGGGTTCGTGG + Intergenic
1195381486 X:104275137-104275159 GATTTCTTCTGGAAGCTGTGGGG + Intergenic
1195604355 X:106785597-106785619 CACTCCTTCTGGAGGCACCAGGG - Intronic
1195643069 X:107198646-107198668 CATTCCTCCTGGTGGGTTCGTGG - Intronic
1196323446 X:114371820-114371842 CATTCCTTCTAGAGGCTCTAGGG + Intergenic
1197140412 X:123111647-123111669 CATTCCTTCTGGAGGTTCTAGGG + Intergenic
1197863746 X:130996892-130996914 GGTTCCTTCTGGAGGCTCTGAGG - Intergenic
1198959231 X:142166453-142166475 GATTCCTTCTGAGGGCTGTGAGG + Intergenic
1199510026 X:148611509-148611531 CATTCCTTCTGGAGGCTCTAGGG + Intronic
1199512254 X:148635386-148635408 CGTTCCTTCTGAAGGCTCCAGGG - Intronic
1199670988 X:150148159-150148181 GATTTCTTCTGAAGGCTGTGAGG + Intergenic
1199675670 X:150187237-150187259 CATTCCTTCTAGAGGCTCTAGGG + Intergenic
1199703079 X:150399717-150399739 GATTCCTTCTGGAGGCTCTGAGG - Intronic
1199764318 X:150929876-150929898 CATTCCTGCTGGAGGCCTAGGGG + Intergenic
1199981253 X:152921674-152921696 GGTTCCTTCTGGAGGCTTTGAGG + Intronic
1200320831 X:155187287-155187309 CATTCCTTCTAGAAGCTCCAGGG - Intergenic
1200648654 Y:5815482-5815504 TATTCCTTCTGGTGGGTTCGTGG + Intergenic
1200782387 Y:7228446-7228468 GGTTCTTTCTGGAGGCTGTGGGG + Intergenic
1201595813 Y:15667577-15667599 CATTCCTCCTGGTGGGTTCGTGG - Intergenic
1201907462 Y:19100358-19100380 CATTCCTTCTGGTGGGTTTGTGG + Intergenic
1202090565 Y:21184051-21184073 CATTCCTTCTGGTGGGTTTGTGG - Intergenic
1202627446 Y:56874493-56874515 GGTTCCTTCTGGAGGCTCCAGGG + Intergenic