ID: 950134058

View in Genome Browser
Species Human (GRCh38)
Location 3:10568194-10568216
Sequence GACAGCTCGCTTACCTCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 79}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950134049_950134058 29 Left 950134049 3:10568142-10568164 CCTGACACTGTAGGTCCTGCAGC 0: 1
1: 0
2: 1
3: 14
4: 149
Right 950134058 3:10568194-10568216 GACAGCTCGCTTACCTCTGCCGG 0: 1
1: 0
2: 0
3: 8
4: 79
950134048_950134058 30 Left 950134048 3:10568141-10568163 CCCTGACACTGTAGGTCCTGCAG 0: 1
1: 0
2: 1
3: 12
4: 124
Right 950134058 3:10568194-10568216 GACAGCTCGCTTACCTCTGCCGG 0: 1
1: 0
2: 0
3: 8
4: 79
950134054_950134058 7 Left 950134054 3:10568164-10568186 CCTTAGGTGCAGGGCTGCTGCCA 0: 1
1: 0
2: 1
3: 24
4: 229
Right 950134058 3:10568194-10568216 GACAGCTCGCTTACCTCTGCCGG 0: 1
1: 0
2: 0
3: 8
4: 79
950134053_950134058 14 Left 950134053 3:10568157-10568179 CCTGCAGCCTTAGGTGCAGGGCT 0: 1
1: 0
2: 0
3: 22
4: 193
Right 950134058 3:10568194-10568216 GACAGCTCGCTTACCTCTGCCGG 0: 1
1: 0
2: 0
3: 8
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950134058 Original CRISPR GACAGCTCGCTTACCTCTGC CGG Intronic
908323836 1:63004146-63004168 GACAGGTTTCTTACCACTGCTGG + Intergenic
909565422 1:77048317-77048339 GACAGCTCACTTACAGCTTCAGG - Intronic
911056841 1:93716015-93716037 TGCAGCTCGCAAACCTCTGCTGG - Intronic
919727065 1:200891381-200891403 CGCAGCTCGCTCACCCCTGCGGG + Intronic
920701242 1:208219402-208219424 GACAGCTCGCTGCCTTCTCCTGG - Intronic
922542930 1:226432916-226432938 GGCTGCTGGCTTACCTCTGCAGG + Intergenic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1065231876 10:23606727-23606749 GAAAGCTCGCGCACCCCTGCAGG - Intergenic
1066428162 10:35327991-35328013 GCCAGCTGGCTTACCTCTCAAGG - Intronic
1072304028 10:94089232-94089254 GACAGCCTGCTTCCCTCTCCTGG - Intronic
1074315642 10:112359631-112359653 GACACCTGGCTTACCTCCGTAGG + Intergenic
1075080787 10:119382169-119382191 GCCAGCTCCCTCCCCTCTGCAGG + Intronic
1076191887 10:128488965-128488987 GACAACTCGATTCACTCTGCTGG - Intergenic
1080027020 11:27625831-27625853 GACAGCTGGCTTGCATCTTCTGG - Intergenic
1080823997 11:35832601-35832623 GAGAGCTCCCTTACCTCTTCTGG + Intergenic
1081507880 11:43737022-43737044 GACAGCTGCCTTTCCTCTGAGGG - Intronic
1093078057 12:14777355-14777377 AACGGCTTGCTTATCTCTGCAGG - Intronic
1096241598 12:49962735-49962757 GACAGCCCGCTTTTCTCTGGTGG - Intronic
1097284865 12:57869440-57869462 TGCAGCTCGCCTTCCTCTGCTGG + Intergenic
1098977591 12:76919622-76919644 GCAAGCTGGCTTTCCTCTGCAGG + Intergenic
1101893063 12:108732480-108732502 GACAGTTCTCTTACCTCTTTGGG + Intergenic
1103983802 12:124754053-124754075 GACAGCTTCTTCACCTCTGCAGG + Intergenic
1104055321 12:125225696-125225718 TGCAGCTCACTTACCTCCGCGGG + Intronic
1105828750 13:24145406-24145428 GACAGCTTCCTTTCCCCTGCAGG - Intronic
1115829789 14:37324645-37324667 GACAGCTTGTTTTCCTCTACAGG + Intronic
1118387909 14:65271923-65271945 GATACCTCACTTACCTCTCCTGG - Intergenic
1121528783 14:94638221-94638243 GGCAGATCGCTTTCCTCTGTTGG + Intergenic
1123035022 14:105468479-105468501 GCCAGTTTGCTTAGCTCTGCCGG - Intronic
1123897363 15:24841987-24842009 GCCAGCTCACTTACATCTGTGGG + Intronic
1124831570 15:33154206-33154228 GGCAGCTCTCTCTCCTCTGCAGG + Exonic
1128157736 15:65402337-65402359 GCCAGCCCCCTTACCTCTGTGGG + Exonic
1136545257 16:30950790-30950812 GGCTGCTCCCTTCCCTCTGCAGG - Intronic
1139315950 16:66068963-66068985 TAAAGCTGGCTGACCTCTGCAGG + Intergenic
1140874286 16:79136599-79136621 GGCAGGTAGCTTTCCTCTGCTGG - Intronic
1158638081 18:59178790-59178812 AACAGCTTTCTTACCTCTGGTGG + Intergenic
1159211873 18:65333542-65333564 ATCAGCAAGCTTACCTCTGCTGG + Intergenic
1161150038 19:2702710-2702732 GAGCGCTCGCTCCCCTCTGCGGG + Intergenic
1161957709 19:7505851-7505873 GACAGCTCCCTCACCCCTTCTGG - Intronic
1163795154 19:19333748-19333770 GTCGCCTTGCTTACCTCTGCTGG + Intronic
1165176152 19:33931289-33931311 GACAGCTCGCATCCCTCTCCTGG + Intergenic
1166074092 19:40403862-40403884 GACACCTCGCCGCCCTCTGCAGG - Exonic
926724389 2:15986262-15986284 GACAGCAAGTTCACCTCTGCGGG - Intergenic
936400628 2:112161902-112161924 GACAGCTGCCTGTCCTCTGCAGG - Intronic
938698431 2:133855166-133855188 CACAGCTGGCTTGGCTCTGCAGG - Intergenic
938795781 2:134717966-134717988 GTCAGCACACTTGCCTCTGCTGG - Intronic
940574493 2:155483554-155483576 GCCTGCTCCCTTATCTCTGCTGG - Intergenic
945941925 2:215959063-215959085 CTCAGCTCTCTTCCCTCTGCTGG + Intronic
946159615 2:217828182-217828204 CACAGCATGCTTCCCTCTGCTGG - Intronic
1176093645 20:63329783-63329805 GCCACCTCGCCTGCCTCTGCTGG - Intronic
1180946229 22:19695286-19695308 CACTGCTCGCTGACCTTTGCTGG - Intergenic
1183199677 22:36377200-36377222 GAGAACTCGCTGTCCTCTGCGGG - Intronic
1183297911 22:37043054-37043076 GGCAGCTCTCCTATCTCTGCCGG - Intergenic
950134058 3:10568194-10568216 GACAGCTCGCTTACCTCTGCCGG + Intronic
953029923 3:39172656-39172678 GATGGCTCCCTTTCCTCTGCTGG + Intergenic
953658746 3:44874754-44874776 AACTGCTCTCTTGCCTCTGCCGG + Intronic
953919629 3:46943076-46943098 GAGAGTTCACTGACCTCTGCTGG + Intronic
954917913 3:54164377-54164399 AACAGCTCCCTTGCCACTGCAGG - Intronic
960659355 3:120041194-120041216 GACATCTGCCTTACTTCTGCTGG + Intronic
961675054 3:128559741-128559763 GGCAGGGCGCTTACCTCTGCGGG + Intergenic
963904402 3:150762399-150762421 GACAGCCCACGTACCTCCGCCGG - Intronic
964439352 3:156689900-156689922 AGCAGATGGCTTACCTCTGCTGG - Intronic
973769683 4:54195206-54195228 GACAACTTGCTCACCTCTCCTGG + Intronic
974596130 4:64016292-64016314 GCCAGCTCACTCACATCTGCAGG + Intergenic
978380090 4:108117771-108117793 GGCAGCTCGCCAGCCTCTGCAGG + Intronic
979202732 4:117997848-117997870 GACAGCTCACTTACCTTTCCTGG + Intergenic
987722376 5:21654662-21654684 AACAGCTGGAATACCTCTGCAGG + Intergenic
990198284 5:53343151-53343173 GACAAGTCTCTTTCCTCTGCTGG - Intergenic
996816105 5:127574014-127574036 GACAGCTGGCTTGACTCTGCAGG + Intergenic
1003845646 6:10171526-10171548 GACAGCGTGCTCACCTCTGAGGG + Intronic
1004566585 6:16803712-16803734 GAGAGCCCGCTCTCCTCTGCAGG + Intergenic
1012991665 6:105932372-105932394 GACAGCTCGCTTGCTTTTGCTGG - Intergenic
1013164771 6:107579866-107579888 GACAGCTCACACACCTCTGATGG - Intronic
1018576225 6:165262813-165262835 TACAGATCATTTACCTCTGCAGG - Intergenic
1019819771 7:3234002-3234024 GACAGCTCACATACTTTTGCTGG + Intergenic
1022983737 7:35629091-35629113 GCCAGCTGGCTCACCTCTGCCGG - Intergenic
1024499941 7:50093936-50093958 GACAGCTCTCCTGCATCTGCTGG - Intronic
1026700220 7:72634728-72634750 CTCAGCTTGCTTACATCTGCAGG - Intronic
1034158999 7:148978611-148978633 GACAGCTCCCTGCCCTGTGCGGG - Intergenic
1042896631 8:73677249-73677271 GACAGCTCTCATACCGCTGGTGG + Intronic
1044467730 8:92526318-92526340 CCCACCCCGCTTACCTCTGCTGG + Intergenic
1050456052 9:5835557-5835579 CCCAGCTCACTTTCCTCTGCTGG - Intergenic
1050610866 9:7351372-7351394 GACAGCTTGATTTTCTCTGCAGG - Intergenic
1051331488 9:16028940-16028962 GACAGCTCTCCAGCCTCTGCCGG + Intronic
1052080611 9:24201813-24201835 GACAGCTGACTCAACTCTGCTGG - Intergenic
1052420809 9:28241400-28241422 GATACCTCGGTTACCACTGCAGG - Intronic
1062042562 9:134410878-134410900 GACAGCGAGCTTACTGCTGCAGG - Intronic
1187588680 X:20692005-20692027 GCCTGCTGGCCTACCTCTGCAGG - Intergenic
1192214142 X:69146271-69146293 GACAGCATTGTTACCTCTGCTGG + Intergenic