ID: 950138377

View in Genome Browser
Species Human (GRCh38)
Location 3:10599170-10599192
Sequence AAGGTTATTCAGCAGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 175}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950138377_950138391 25 Left 950138377 3:10599170-10599192 CCCTGCCCCTGCTGAATAACCTT 0: 1
1: 0
2: 0
3: 22
4: 175
Right 950138391 3:10599218-10599240 CAAAATCTGGAGGCTGGGTGTGG 0: 1
1: 1
2: 16
3: 131
4: 1083
950138377_950138387 15 Left 950138377 3:10599170-10599192 CCCTGCCCCTGCTGAATAACCTT 0: 1
1: 0
2: 0
3: 22
4: 175
Right 950138387 3:10599208-10599230 GCCTTCAGAACAAAATCTGGAGG 0: 1
1: 0
2: 2
3: 13
4: 161
950138377_950138389 19 Left 950138377 3:10599170-10599192 CCCTGCCCCTGCTGAATAACCTT 0: 1
1: 0
2: 0
3: 22
4: 175
Right 950138389 3:10599212-10599234 TCAGAACAAAATCTGGAGGCTGG 0: 1
1: 0
2: 5
3: 29
4: 293
950138377_950138382 -7 Left 950138377 3:10599170-10599192 CCCTGCCCCTGCTGAATAACCTT 0: 1
1: 0
2: 0
3: 22
4: 175
Right 950138382 3:10599186-10599208 TAACCTTCAGTAGCTACCCACGG 0: 1
1: 0
2: 1
3: 12
4: 113
950138377_950138392 26 Left 950138377 3:10599170-10599192 CCCTGCCCCTGCTGAATAACCTT 0: 1
1: 0
2: 0
3: 22
4: 175
Right 950138392 3:10599219-10599241 AAAATCTGGAGGCTGGGTGTGGG 0: 1
1: 1
2: 6
3: 36
4: 346
950138377_950138386 12 Left 950138377 3:10599170-10599192 CCCTGCCCCTGCTGAATAACCTT 0: 1
1: 0
2: 0
3: 22
4: 175
Right 950138386 3:10599205-10599227 ACGGCCTTCAGAACAAAATCTGG 0: 1
1: 0
2: 1
3: 14
4: 98
950138377_950138390 20 Left 950138377 3:10599170-10599192 CCCTGCCCCTGCTGAATAACCTT 0: 1
1: 0
2: 0
3: 22
4: 175
Right 950138390 3:10599213-10599235 CAGAACAAAATCTGGAGGCTGGG 0: 1
1: 0
2: 1
3: 34
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950138377 Original CRISPR AAGGTTATTCAGCAGGGGCA GGG (reversed) Intronic
901255034 1:7816914-7816936 AATGTCATTCAGCAGGAGAATGG + Intronic
902660296 1:17896191-17896213 AAGTATAGTCAGCAGGGGCCTGG - Intergenic
903222797 1:21878336-21878358 AAGGTTCATGAGCTGGGGCAGGG + Intronic
904160557 1:28519275-28519297 AAGATGATACAGCAGGGGCTGGG + Intronic
904945039 1:34192975-34192997 GAGGATTTTCAGCAGGGGAATGG + Intronic
907136881 1:52148068-52148090 AAAGTTATTAACCAGGAGCATGG - Intronic
907239774 1:53074960-53074982 ATGGTATTTGAGCAGGGGCATGG + Intronic
907460647 1:54603588-54603610 GAGGTCACTCAGCAGGGGTATGG + Intronic
908790794 1:67779378-67779400 AAGGATTTTCAGCAGGTTCAGGG - Intronic
910858843 1:91723593-91723615 CAGGTTATTCAACAAGGACATGG + Intronic
911782177 1:101895139-101895161 AAGGTTATACAGCATGTACAAGG - Intronic
913143835 1:115969667-115969689 AAGGAAATCCAGCAGGGGCCTGG + Intergenic
916697069 1:167249313-167249335 AAAGTTATATAGCAGAGGCAGGG - Intronic
917614104 1:176720656-176720678 GAGGGTATTCATCAGGGGAATGG + Intronic
918102799 1:181391282-181391304 AAGGTTTTTAAGCAGGGGAGTGG - Intergenic
920253589 1:204638935-204638957 AGGGTCATTCAGCAGGCTCACGG - Intronic
922663780 1:227451935-227451957 AGGGTTATGTAGCAGGGGCCAGG + Intergenic
923763292 1:236867986-236868008 TAGGTGATAAAGCAGGGGCAAGG + Intronic
1064181405 10:13119390-13119412 AAGGTTATTCAGCAAGGAAAAGG - Intronic
1064565320 10:16633524-16633546 AAGGTTATTCAGCACTGGTGTGG + Intronic
1065607045 10:27428772-27428794 AAGGTAATGTAGCAGGAGCAAGG - Intergenic
1067897174 10:50195879-50195901 AAGGTTAGTTACCAGGGGCTAGG + Intronic
1067951793 10:50746156-50746178 AAGGTTAGTTACCAGGGGCTAGG - Intronic
1068563377 10:58543118-58543140 AATGTTAATCAGCAGAGACAGGG + Intronic
1074284445 10:112084853-112084875 TAGGTAATTAAGGAGGGGCAGGG + Intergenic
1087849013 11:103006841-103006863 AAGGCTTTTCAGTAGGGGAATGG + Intergenic
1088683033 11:112260699-112260721 ATGTATATTCAGAAGGGGCAGGG - Exonic
1092349939 12:7748053-7748075 AAGATTACTCAGCAGTGGCCGGG - Intronic
1093137361 12:15468304-15468326 TGGGTTATTCAGCAGGGGTGTGG - Intronic
1095590598 12:43899059-43899081 AAGGTTCTTGTGCAAGGGCAGGG - Intronic
1096223918 12:49852289-49852311 AAGGTTATTGAACAGCAGCAGGG + Intergenic
1099075490 12:78102641-78102663 AAGAGTTTTCTGCAGGGGCACGG - Intronic
1101417348 12:104519897-104519919 AAGGCTTTTCTGCAGGTGCAGGG + Intronic
1101476222 12:105051212-105051234 AAGGTCATTCACCAGGGTCAAGG - Intronic
1101724673 12:107379047-107379069 AAGGTCATTCAGCAGGTACATGG - Intronic
1101846519 12:108367460-108367482 AAGGTCTTTCAGCAAAGGCAAGG + Intergenic
1102461319 12:113101595-113101617 AAGGTCATTTAGCAAGCGCAGGG + Intronic
1102978739 12:117225248-117225270 AAGGCTCTTCAGCCGGGGCCAGG + Intronic
1103477972 12:121232564-121232586 AAAGTGTTTCTGCAGGGGCAGGG - Intronic
1107120965 13:36795559-36795581 AAGGTGATTCGGCCGGGGGAGGG - Intergenic
1107273586 13:38650593-38650615 AAAATTCTTCAGCAGTGGCAAGG - Intergenic
1107999597 13:45894108-45894130 AAGGTCATGCAGCAGAGTCAGGG + Intergenic
1113020498 13:105880316-105880338 ATGGTTACTCATCAGGGGGATGG - Intergenic
1114614847 14:24062861-24062883 CAGGTTATTAAGGAGGAGCAGGG - Intronic
1116384179 14:44310505-44310527 AAGGTTAGTGGGAAGGGGCATGG - Intergenic
1117154932 14:52929419-52929441 AAGGATTTTCAGCAGGGGAATGG - Intronic
1122425990 14:101605534-101605556 ATGGTTTTTGAGCAGGTGCAAGG - Intergenic
1127371814 15:58348527-58348549 GAGAATATTCAGCAGGGACAGGG + Intronic
1128803523 15:70513511-70513533 AAGGTTCCTGAGCAGGGGCTGGG - Intergenic
1129074439 15:72980081-72980103 AATGTTCTTCAGCTGGGGAATGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1134117560 16:11560685-11560707 AAGGTTATAGAGAAGGGGAAAGG + Intronic
1138351390 16:56347918-56347940 GAAGATACTCAGCAGGGGCAGGG - Exonic
1139405336 16:66713205-66713227 ATGGTTATTGAGCAGAGGCAGGG + Intergenic
1139707806 16:68753822-68753844 AAAATTATTTGGCAGGGGCAGGG + Intronic
1139940005 16:70598384-70598406 CAGGTTCTTGAGCAGGGGCGCGG - Intronic
1140096365 16:71879086-71879108 AAGGTTTTTAAGCAGGGAGAGGG - Intronic
1142878164 17:2864813-2864835 GAGGTAATTCAGGAGGGGGAGGG - Intronic
1143664736 17:8350674-8350696 AAGATTATTCACCTGCGGCAGGG + Intergenic
1147196733 17:38771451-38771473 ACAGTCATTCAGCAGGGGAAAGG + Intronic
1148397211 17:47318669-47318691 AATGTAAAACAGCAGGGGCAGGG + Intronic
1148494631 17:48045902-48045924 AAGGTTAATCAGCAGGTTCTGGG + Intergenic
1148675548 17:49442725-49442747 AAGGTTTTTGAGCTGGGGAAAGG + Intronic
1151870085 17:76830686-76830708 AAGGAGATTCCGCAAGGGCATGG + Intergenic
1152094837 17:78266984-78267006 CAGGTCCTTGAGCAGGGGCATGG + Intergenic
1152555971 17:81053490-81053512 AAGGACATTGATCAGGGGCATGG + Intronic
1156223090 18:35074254-35074276 AAAGTTATACAGCTTGGGCAGGG + Intronic
1159056359 18:63468756-63468778 AAGGTCATTTGGCAGGGGCGGGG - Intergenic
1160658284 19:285445-285467 AAGATTATTCGGCTGGGGCCAGG + Intronic
1161485901 19:4535503-4535525 AAGGTCACTCAGCAGGGCTATGG - Intronic
1161494170 19:4578696-4578718 AAGGTTATAGAGCAGGGGGAGGG - Intergenic
1162110014 19:8394974-8394996 AAGGCTGTACAGCTGGGGCAAGG + Intronic
1162936343 19:13983496-13983518 CAGGTGGTTCAGCAGGTGCAGGG - Exonic
1163365159 19:16871888-16871910 AAGGTTTGTCAACAGGGACACGG - Intronic
1164911178 19:32013179-32013201 GAGGTTCTTCTGCAAGGGCATGG + Intergenic
925064186 2:916408-916430 AAGGTCCTTCAGCAGTGGAATGG + Intergenic
925434772 2:3827294-3827316 AAGGGGAGGCAGCAGGGGCAGGG + Intronic
925530031 2:4849291-4849313 AAGGTTCTTTTGCAGGGGCAGGG + Intergenic
929077939 2:38093797-38093819 AAGGATATTCTGCAAGGGGAGGG - Intronic
936868968 2:117110099-117110121 AATGTTGGTCAGCAGGGGCAGGG + Intergenic
937230790 2:120397016-120397038 AAGGTGATCCGGCTGGGGCAAGG + Intergenic
937318296 2:120945933-120945955 AAGGTTATGCCTGAGGGGCAGGG - Intronic
938059493 2:128241026-128241048 AAGTTTATTCTGGCGGGGCACGG + Intronic
938717043 2:134030234-134030256 AAGGTCATACAGCAAGGTCATGG - Intergenic
939010712 2:136842955-136842977 TACATTATTCAGAAGGGGCAAGG - Intronic
939020087 2:136948239-136948261 AAGGTTTGTGAGCAGGGGCATGG - Intronic
939928856 2:148207113-148207135 AAGGATGTGCAGGAGGGGCAAGG + Intronic
940715399 2:157217834-157217856 AAGGATTTTCAGCCTGGGCATGG + Intergenic
940856474 2:158732258-158732280 AGGGGCATTCAGAAGGGGCATGG - Intergenic
945566418 2:211406116-211406138 AGGGTTTTTAAGCAGGGGCATGG - Intronic
946707825 2:222476056-222476078 AAGGTTATTTAGCTGGTGGAGGG + Intronic
947168889 2:227290843-227290865 CAGGTTATTCAGAAGGTACAAGG + Exonic
947968875 2:234305179-234305201 AAGCTGATTCAGCAGAGGCAGGG - Intergenic
1170284889 20:14695949-14695971 AAGTTTATAAAGCAGGGGAAAGG + Intronic
1172869432 20:38126606-38126628 CCGGCTATACAGCAGGGGCAGGG - Intronic
1173617780 20:44414135-44414157 AAGGTCACTCAGCAAGGGAAGGG - Intronic
1173890904 20:46509473-46509495 AAGTTTCCTCAGCAGGAGCATGG + Intronic
1174180316 20:48670304-48670326 CAGGGTTCTCAGCAGGGGCAGGG - Intronic
1174582240 20:51580120-51580142 AAGGTTGTTGAGCAGGGGAAAGG - Intergenic
1174799536 20:53551637-53551659 AAGGTTATAAAGCTGGCGCATGG - Intergenic
1174983108 20:55419737-55419759 ATGCTGATTCAGCAGGTGCATGG - Intergenic
1175820360 20:61905801-61905823 AAGGGAATTCAGAAGGTGCAGGG + Intronic
1177530546 21:22353070-22353092 AAGGTTATTCTGTAGGTGAATGG - Intergenic
1178833393 21:36075351-36075373 ATGGTTATTAAGCATGGGGATGG - Intronic
1181845047 22:25700043-25700065 AAGGTGTTTCAGCAGAAGCAAGG - Intronic
1183266582 22:36830265-36830287 AGGATTATTCTGCAGGGCCAGGG + Intergenic
1183447276 22:37866305-37866327 AAGGTTCATCATCAGAGGCATGG - Intronic
1183676025 22:39299352-39299374 GAGGTTTTTGAGCAGGGGCTCGG - Intergenic
950138377 3:10599170-10599192 AAGGTTATTCAGCAGGGGCAGGG - Intronic
951419203 3:22463852-22463874 AAGATTATTCACCTTGGGCAGGG + Intergenic
953691066 3:45120075-45120097 GATGTCATTCAGCAGGTGCATGG - Intronic
953930418 3:47003139-47003161 AAGGGTACTCAGCAGAAGCAAGG - Intronic
954791016 3:53133470-53133492 AAGGTCATTCAGCAAAGGAATGG + Intergenic
955538294 3:59948038-59948060 AAGGTTCTTCAGCAGGTGAATGG - Intronic
956481360 3:69677004-69677026 AAGATTATACAGCTGGTGCAGGG - Intergenic
961054936 3:123779764-123779786 AGAGTTCTTCAGCAGAGGCAGGG + Intronic
962317596 3:134368493-134368515 AAGGTTAAACAGCTGGAGCAGGG - Intronic
964442400 3:156725879-156725901 AAGGTTATTCGGCTGGGTCCTGG + Intergenic
964756103 3:160092094-160092116 AAGGTCAGACAGCAAGGGCAGGG - Intergenic
967991571 3:195135403-195135425 AGAGTCAGTCAGCAGGGGCAGGG + Intronic
968771772 4:2512129-2512151 AAGTTTCTTCAGCAGGCACAAGG - Intronic
969483323 4:7458312-7458334 AGGGTTGTTGAGCAGGGGGAGGG + Intronic
971363010 4:25954029-25954051 AAGGTTACTCAGCAGGCAAAGGG - Intergenic
972401067 4:38704385-38704407 AAGGTTTTGCAGCAGGAGAAAGG + Intergenic
973679984 4:53307342-53307364 AAGGGTTTTAAGCGGGGGCATGG + Intronic
976545415 4:86329709-86329731 AAGGTTATTCAGCAAGCCTAAGG - Intronic
977170975 4:93762528-93762550 AAGGATATTCAGGAGAGGAAAGG + Intronic
977521073 4:98084345-98084367 AATGTTAATCAGTAGGGGAATGG - Intronic
981750688 4:148090424-148090446 AAAGTTATACAGCAGGGCCATGG + Intronic
985903439 5:2814541-2814563 AGGGTCATGCAGCAGGGGCTGGG + Intergenic
986790113 5:11151021-11151043 AAGGTTCATCAACAGGGGCATGG + Intronic
987680428 5:21129528-21129550 AAGGTTATTCAATAGGGAAAGGG - Intergenic
989379465 5:40798650-40798672 AAGGTTAGAAAGCAGTGGCAGGG - Intergenic
994313620 5:98306315-98306337 ATGGTTATGCAACAGGGGGATGG + Intergenic
995569379 5:113463259-113463281 AAGGGTTGTAAGCAGGGGCAAGG + Intronic
996109989 5:119554077-119554099 AAGGGTATTCAGGATGGGCACGG - Intronic
1001017406 5:168153880-168153902 GAGGATGTTCAGCAGGGGCATGG + Intronic
1001853199 5:174987389-174987411 AAGGTTATTCATTAGTAGCAGGG - Intergenic
1002181415 5:177432924-177432946 CAGGTCACACAGCAGGGGCAAGG - Intronic
1002334277 5:178467308-178467330 AAGGGTCTCCACCAGGGGCAGGG - Intronic
1004451517 6:15752287-15752309 AAGGCTATTCAACAGGGGAGGGG + Intergenic
1005094749 6:22102605-22102627 AATGTTCTTCAGCAGGTGAATGG - Intergenic
1006547689 6:34792781-34792803 AGGGTTATTTAGAACGGGCAGGG - Intronic
1007164887 6:39822134-39822156 AAGTCTATGCAGCAGGGGGATGG + Intronic
1007926051 6:45650638-45650660 AGGGTTACTCAGCAGGGACATGG + Intronic
1007947538 6:45839711-45839733 GAGGTGATGGAGCAGGGGCAGGG - Intergenic
1010449984 6:75991603-75991625 AAGGTTGTTCAGAAGGGGGCTGG - Intronic
1011008703 6:82678606-82678628 AAGGGCATTCAGCAGGTTCACGG + Intergenic
1012215030 6:96572365-96572387 ATGCTGCTTCAGCAGGGGCAGGG + Intronic
1013955853 6:115839371-115839393 AGGGATATTTACCAGGGGCAAGG - Intergenic
1015572662 6:134637437-134637459 AAGATTATTTAGCAGGGGGAAGG + Intergenic
1017069849 6:150566019-150566041 AAGGTCATTGAACACGGGCATGG - Intergenic
1018545369 6:164929810-164929832 AAGGTCACTCAGCAGCGGAAAGG - Intergenic
1019575557 7:1735944-1735966 AAGGTCACACAGCAGGCGCACGG + Intronic
1022230396 7:28408397-28408419 AAGGAAATTCAGCAGGGGGATGG + Intronic
1022249042 7:28588770-28588792 AAGAAAATACAGCAGGGGCAAGG - Intronic
1023908914 7:44540431-44540453 AAGGACATGGAGCAGGGGCAGGG + Intronic
1024061995 7:45704872-45704894 GAGGTAATGGAGCAGGGGCAGGG - Intronic
1026228273 7:68461682-68461704 AAAGTCATACAGCAGAGGCAGGG + Intergenic
1026666039 7:72340564-72340586 AAGGTTTTGCAGCAGGAGAAGGG - Intronic
1030376002 7:108754418-108754440 AAGGTTGTGCAGCAGGGCCATGG + Intergenic
1032577534 7:133071478-133071500 AAGGATTTTAAGCAGGGGAATGG + Intronic
1035071459 7:156148170-156148192 ATGGTGATACGGCAGGGGCAGGG - Intergenic
1035071476 7:156148223-156148245 ACGGTGATACGGCAGGGGCAGGG - Intergenic
1036136210 8:6163966-6163988 ATGGTGATTCAGGAGAGGCAGGG - Intergenic
1036537411 8:9663800-9663822 AAGGTCAGTGGGCAGGGGCAAGG + Intronic
1037200359 8:16245062-16245084 AATGTTCTTCAGCAGGTGAATGG - Intronic
1038885520 8:31658780-31658802 AATGTTAATCAGCAGAGGGAAGG + Intronic
1039216934 8:35282402-35282424 AAGGGTATTAAGAAGGGTCATGG - Intronic
1040467869 8:47712017-47712039 AAGGATGGTCAGCAGGGCCAGGG - Intronic
1042552721 8:70008508-70008530 AAGGATTTTAAGGAGGGGCAGGG + Intergenic
1042649923 8:71028458-71028480 ATGGTTAGTCACCAGGGGCCAGG + Intergenic
1043430610 8:80190936-80190958 ATGGTTATTCAGTCTGGGCACGG + Intronic
1047398369 8:124524693-124524715 AAGGTTTTGCAGAAGGGGGAGGG + Intronic
1047890870 8:129307223-129307245 ATGGTTATTTAATAGGGGCAGGG + Intergenic
1049344909 8:142133650-142133672 AAGGTTCTTGAGCAGGGGAGTGG + Intergenic
1049363121 8:142223757-142223779 AAGGTGCTTCTGCAGGTGCAGGG + Intronic
1049431369 8:142566830-142566852 CAGGCTCTTCAGCAGGGCCAAGG - Intergenic
1056624081 9:88239301-88239323 TAGTTTATTCAGGAGGTGCAGGG - Intergenic
1057792085 9:98131051-98131073 GAGGTTATCCTGCAGGGGAAGGG + Exonic
1058607454 9:106738055-106738077 AATGTTATTCAGCAATGGGAAGG + Intergenic
1059420675 9:114189853-114189875 AAGGTGATTCAGTAAGGGGATGG - Intronic
1059532485 9:115048507-115048529 TAGGTTTTCCAGAAGGGGCAGGG + Exonic
1059814196 9:117893195-117893217 AAGGTAAGTCACTAGGGGCAAGG - Intergenic
1060145227 9:121247123-121247145 AAAGTCAGCCAGCAGGGGCAAGG + Intronic
1061938859 9:133873441-133873463 CAGTGTCTTCAGCAGGGGCATGG - Intronic
1186285316 X:8037617-8037639 CAGGTTCTACTGCAGGGGCAAGG - Intergenic
1186906849 X:14119921-14119943 AAGACTATTCAGCAGGGGCTGGG + Intergenic
1189617510 X:42799007-42799029 AAGGTAATTCAGCTTGGACATGG - Intergenic
1192886569 X:75341554-75341576 AAGGTTAGTTAGCAGAGGCTGGG - Intergenic
1195068039 X:101254980-101255002 AAGGATCTTCAGTCGGGGCAAGG + Intronic
1195389694 X:104348592-104348614 AAGGTTTTTAAGCAGGAGAATGG + Intergenic
1196173052 X:112611000-112611022 AGGGATTCTCAGCAGGGGCAGGG + Intergenic
1198587641 X:138140370-138140392 AAGATAATACAGCAGGAGCAAGG + Intergenic
1199594273 X:149494191-149494213 AAGGTACTGCAGGAGGGGCAAGG + Intronic
1200762793 Y:7055350-7055372 AAGGTTTCTCAACAGGGGAAAGG - Intronic
1200833897 Y:7714123-7714145 TAGTGTATTCTGCAGGGGCAGGG - Intergenic
1201692588 Y:16784001-16784023 AAGTTATTTCAGCAGGGGCTTGG - Intergenic