ID: 950138503

View in Genome Browser
Species Human (GRCh38)
Location 3:10599794-10599816
Sequence TTCTATAAGGGGGTGGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 655
Summary {0: 1, 1: 0, 2: 2, 3: 59, 4: 593}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950138492_950138503 4 Left 950138492 3:10599767-10599789 CCCTGTGCTCATGGAATGGAGCT 0: 1
1: 0
2: 1
3: 27
4: 207
Right 950138503 3:10599794-10599816 TTCTATAAGGGGGTGGGGGGTGG 0: 1
1: 0
2: 2
3: 59
4: 593
950138489_950138503 29 Left 950138489 3:10599742-10599764 CCAGAACTGCATGAGAAAAATAA 0: 1
1: 0
2: 3
3: 40
4: 361
Right 950138503 3:10599794-10599816 TTCTATAAGGGGGTGGGGGGTGG 0: 1
1: 0
2: 2
3: 59
4: 593
950138493_950138503 3 Left 950138493 3:10599768-10599790 CCTGTGCTCATGGAATGGAGCTC 0: 1
1: 0
2: 0
3: 15
4: 160
Right 950138503 3:10599794-10599816 TTCTATAAGGGGGTGGGGGGTGG 0: 1
1: 0
2: 2
3: 59
4: 593

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950138503 Original CRISPR TTCTATAAGGGGGTGGGGGG TGG Intronic
901156129 1:7140413-7140435 TCCTATAAGGGCTTGGGGGAGGG - Intronic
901523871 1:9806998-9807020 TACAGTAAGGGCGTGGGGGGGGG + Intronic
902757806 1:18560646-18560668 TTTTTTATGGGGGTGGTGGGGGG - Intergenic
903462875 1:23531353-23531375 TTCTTTCCGGGGGGGGGGGGGGG - Intergenic
904309676 1:29620798-29620820 TTAGATAAGGGGGTCGGGGTGGG - Intergenic
904845431 1:33410093-33410115 TTCCATAAAGGAGTGGGGGCAGG - Intronic
905866017 1:41377232-41377254 TGCTATAAGGAGGTGAGGGAGGG + Intronic
905975292 1:42169859-42169881 TTCTGGAAGTGGGTGAGGGGTGG - Intergenic
906260014 1:44379913-44379935 TTGGACATGGGGGTGGGGGGAGG - Intergenic
906398680 1:45489203-45489225 TTCAAGAAGGGAGTGGGGGGCGG - Intronic
906533005 1:46534127-46534149 CTGAATAAGGGGGTGGGGGTGGG - Intergenic
906787499 1:48628823-48628845 ATCCATGTGGGGGTGGGGGGTGG - Intronic
907189348 1:52635355-52635377 TTCTCTGGTGGGGTGGGGGGTGG - Intronic
907417463 1:54324419-54324441 TTCTGTAGGGGTGTGGGGGTGGG - Intronic
907434197 1:54433706-54433728 TAAGATAAGGGGGTGGGGCGCGG + Intergenic
907446778 1:54513195-54513217 TAGTAGAAGGGGGGGGGGGGGGG + Intergenic
907501134 1:54881965-54881987 TCCTATCAGAGGGTGGAGGGAGG + Intronic
908327603 1:63038599-63038621 TTTTAAAACGGGGTGGGTGGGGG + Intergenic
908534343 1:65065290-65065312 TTCTATAAAGGGAAGGAGGGGGG - Intergenic
908579453 1:65499316-65499338 TTTTTTAAGGGTGTGTGGGGTGG + Intronic
908910014 1:69062342-69062364 TTATATAAGGAGGTGGGAGGAGG + Intergenic
910102624 1:83594606-83594628 TGCTGTCAGGGGGTGGGGAGGGG + Intergenic
910194247 1:84624176-84624198 TTTTTTTGGGGGGTGGGGGGTGG + Intergenic
911005100 1:93212491-93212513 GTCTATCAGAGGGTGGAGGGTGG - Intronic
912626601 1:111210143-111210165 CTATATATGGGGGTGGGGTGAGG - Intronic
913249524 1:116901008-116901030 TTTGATATTGGGGTGGGGGGTGG - Intergenic
914246130 1:145886872-145886894 TTCTATGCGGGGGCGGGGGCGGG - Intergenic
915320422 1:155053112-155053134 CTTTAGAATGGGGTGGGGGGGGG - Intronic
915490698 1:156248535-156248557 TTGTATTCGGGGGGGGGGGGGGG - Intergenic
915718342 1:157965133-157965155 TTCAATAAGAGGGTGGGGCTTGG + Intergenic
915980036 1:160414803-160414825 TCCTATGAGGGGGTGGGGCCGGG + Intronic
916246365 1:162692182-162692204 TTCTAAACGGTGGTGGGAGGAGG - Intronic
916446428 1:164876528-164876550 ATCTATAAGTGGGGGCGGGGCGG + Intronic
916965901 1:169942911-169942933 TTTTTTAAAGGGGTGGGGGGGGG - Intronic
917129308 1:171724315-171724337 TCCTGTCATGGGGTGGGGGGAGG + Intronic
918224228 1:182465455-182465477 GCCTATCATGGGGTGGGGGGAGG + Intronic
918379045 1:183936597-183936619 TTTTTTAATGGGGTGGGAGGTGG - Exonic
918440353 1:184560545-184560567 TACAAGAAAGGGGTGGGGGGAGG - Intronic
919879419 1:201892029-201892051 AACTATGAGGGGTTGGGGGGAGG + Exonic
919958613 1:202442961-202442983 CACTATAAAGTGGTGGGGGGTGG + Intronic
922064046 1:222118763-222118785 ATTTATCAGGGGGTGGGGGGAGG - Intergenic
923326235 1:232882702-232882724 GACTATAATGGGGTGGGAGGAGG - Intergenic
923485795 1:234429755-234429777 TTCTAAAGGTGGGGGGGGGGGGG + Intronic
924017746 1:239745644-239745666 TTCTAAAGGGTGGTGGGGGCGGG - Intronic
924131505 1:240914061-240914083 TTCTGTTGTGGGGTGGGGGGAGG - Intronic
924167297 1:241297466-241297488 TACTGTAAGGGGATGGGGCGGGG + Intronic
924302619 1:242654773-242654795 GCCTGTCAGGGGGTGGGGGGCGG + Intergenic
924381750 1:243471600-243471622 TGCTATCAGGGGTTGGGGGGTGG + Intronic
1063425307 10:5945955-5945977 TTCTAAATGGTGGGGGGGGGCGG - Intronic
1064168193 10:13004563-13004585 TTCCATCTTGGGGTGGGGGGTGG - Intronic
1065023985 10:21524581-21524603 TTCACTAAGGCGGGGGGGGGGGG + Intronic
1065227699 10:23562273-23562295 TTTTTTTGGGGGGTGGGGGGAGG + Intergenic
1065720298 10:28622431-28622453 TTTTAAAACGGGGGGGGGGGGGG - Intronic
1065726888 10:28676434-28676456 TGTCAAAAGGGGGTGGGGGGTGG - Intergenic
1066154979 10:32666525-32666547 GCCTATCATGGGGTGGGGGGAGG - Intronic
1067057302 10:43059615-43059637 TCCCATAAGGGGGTGGGGCTAGG + Intergenic
1067837913 10:49652913-49652935 TTAGATAAGGGGGTGGGGAAAGG - Intronic
1068083232 10:52346321-52346343 TTTTTTTGGGGGGTGGGGGGCGG - Intergenic
1068608174 10:59029264-59029286 GCCTATCATGGGGTGGGGGGAGG - Intergenic
1068800532 10:61135315-61135337 TTCTAAATGGGGGAGGGGAGGGG + Intergenic
1069049634 10:63778939-63778961 TTCCATAATGGGGTGGGGGTGGG - Intergenic
1069213027 10:65785310-65785332 TTCTCTAAGATGGTGGGGTGGGG + Intergenic
1070656518 10:78275354-78275376 TTCTCCAAGGGGGTAGGGAGGGG + Intergenic
1070736715 10:78868051-78868073 TGGTAGTAGGGGGTGGGGGGCGG - Intergenic
1070797137 10:79223399-79223421 TTGTATGTGGGGGTGGGGGCCGG - Intronic
1071053922 10:81486825-81486847 ATATATATGGGGGTGGGGGTGGG + Intergenic
1071073567 10:81725213-81725235 TCCTATCAGAGGGTGGAGGGTGG - Intergenic
1071118311 10:82249430-82249452 TCCTAAAAGATGGTGGGGGGTGG - Intronic
1071311759 10:84349499-84349521 TTGTAGACGGGGGTGGGCGGGGG - Intronic
1071727752 10:88217024-88217046 CTCAATTAGGGGGTGAGGGGTGG + Intergenic
1072604865 10:96972027-96972049 TTCTAGAGAGGGGTGGGGTGGGG + Intronic
1072887320 10:99290052-99290074 ATCTATAAGTGGGCGGGGAGGGG - Intergenic
1072932182 10:99675548-99675570 TTTTTTAGGGGGGTGGGGTGGGG + Intronic
1073088346 10:100910705-100910727 TACTATTTGGGGGTGGGAGGTGG + Intergenic
1073286906 10:102395091-102395113 TTGTATTAGGTGGGGGGGGGGGG + Intronic
1073606502 10:104900885-104900907 CTCTATCTTGGGGTGGGGGGAGG + Intronic
1073642208 10:105264135-105264157 ATATAAAGGGGGGTGGGGGGAGG + Exonic
1074280238 10:112044581-112044603 GTCTGTCATGGGGTGGGGGGAGG + Intergenic
1074398212 10:113117965-113117987 TTATTTATGGGGGCGGGGGGTGG - Intronic
1074706952 10:116141579-116141601 TTTTTTGAGGGGGTGGTGGGCGG + Intronic
1074760199 10:116661772-116661794 TTTTAAAAAAGGGTGGGGGGGGG - Intergenic
1074815637 10:117139578-117139600 TTTTTAAAGGGGGTGGGTGGGGG + Intergenic
1075277842 10:121111068-121111090 TTCAATAAGGAGGTAGGGAGGGG - Intergenic
1075528974 10:123210978-123211000 GCCTATCAGAGGGTGGGGGGTGG - Intergenic
1075933686 10:126321891-126321913 TTCTACCTGGGGGTCGGGGGGGG + Intronic
1076334485 10:129696315-129696337 TTATATCAGGGGGTGGGGAATGG + Intronic
1076456277 10:130600424-130600446 ATCTGTAAAGGGGTGGGTGGAGG - Intergenic
1077063011 11:625990-626012 TTCTGTAAGGGGTAGTGGGGAGG - Intronic
1077487805 11:2847100-2847122 TTCTGCAAGGGGGTGGGGGTGGG - Intronic
1077714839 11:4570120-4570142 TGTTATAAGGGTGTTGGGGGAGG + Intergenic
1077874994 11:6296518-6296540 TTTTATTTGGGGGTGGGGTGGGG - Intergenic
1078921712 11:15836914-15836936 TTAGATAAGGGGATGAGGGGAGG + Intergenic
1079004022 11:16779967-16779989 CTCTAAAACGGGGAGGGGGGGGG + Intronic
1079362075 11:19777577-19777599 TTCCTAAAGGGGATGGGGGGCGG - Intronic
1079429892 11:20379494-20379516 TTCTAAAATTGGGTGGGGCGGGG - Intronic
1080043681 11:27785890-27785912 TTCTAATCGGGGGGGGGGGGTGG + Intergenic
1080701983 11:34651676-34651698 TTCTATTGTGAGGTGGGGGGAGG + Intronic
1080945446 11:36968197-36968219 TTCTGTGGTGGGGTGGGGGGAGG + Intergenic
1080982722 11:37428045-37428067 TCCTATTGTGGGGTGGGGGGAGG - Intergenic
1082016642 11:47493711-47493733 TTTTACAAGGGAGTGGGGGTGGG + Intronic
1082196903 11:49317190-49317212 TGCTATAAAGAGATGGGGGGAGG - Intergenic
1082662492 11:55929252-55929274 TTCTAAATGGGGGTGGGGTTGGG - Intergenic
1082824289 11:57566945-57566967 TTCTAGGAGGGGGGGGGGGGCGG - Intronic
1083443596 11:62692472-62692494 TACTGTGAGGGGGTGGGGTGAGG + Exonic
1083629901 11:64090087-64090109 TTCTAGAATGGGGCTGGGGGAGG + Intronic
1083641007 11:64145299-64145321 TTCTGCAAGGAGGTGGCGGGAGG - Intronic
1084097205 11:66919434-66919456 TTCTTTAAGGGTGTGGGCGAAGG - Intronic
1084499746 11:69528396-69528418 ATGTATAAAGGGGTGGGGTGGGG + Intergenic
1084930229 11:72549523-72549545 TTCTATAGGGGTGTGTGGGTAGG - Intergenic
1085639970 11:78187529-78187551 TTCTGGAAGGGGCTGGGGGATGG - Intronic
1086453499 11:86939771-86939793 TTTTTTAAAGGGGTGGGTGGGGG + Intronic
1086466813 11:87062418-87062440 ATCTATGCGGGGGGGGGGGGGGG - Intronic
1086800190 11:91163773-91163795 TTCTCTAATGGTGTGGGGGGAGG - Intergenic
1087002796 11:93437744-93437766 TTCTTGGCGGGGGTGGGGGGGGG - Exonic
1087811031 11:102609283-102609305 GGCTAGAAGGGGGTTGGGGGTGG + Intronic
1088380379 11:109186436-109186458 GCCTATCATGGGGTGGGGGGAGG - Intergenic
1088982606 11:114876973-114876995 TTCTATGAGGAGGTTGGGGTAGG - Intergenic
1090252938 11:125263902-125263924 GCGTATAAGGGGGTGCGGGGAGG + Intronic
1090388211 11:126368922-126368944 TTCTCCAACGGGGTGGGGGAGGG - Intronic
1090691998 11:129193301-129193323 ATCTTTATGGGGGGGGGGGGGGG + Intronic
1090770647 11:129916749-129916771 TTCTATAAGGTGGAGGGGGTTGG - Intronic
1090991919 11:131825378-131825400 TTTTGTATGGTGGTGGGGGGTGG + Intronic
1092890474 12:12965052-12965074 TACTATAAAGGGGTCGGGGTTGG - Intergenic
1095499268 12:42818745-42818767 TTTTCTTAGGCGGTGGGGGGGGG - Intergenic
1095672045 12:44873867-44873889 TTTTATAAGAGGGTGGGGCTTGG - Intronic
1095706672 12:45244396-45244418 CTCTATTTGGGGGGGGGGGGTGG + Intronic
1095766590 12:45901842-45901864 TTCTGTAAGGTGGGGGGTGGGGG + Intronic
1096756268 12:53802412-53802434 TTCAATCATGGGGTGGGGCGAGG + Intergenic
1098732919 12:74061539-74061561 GTCTGTCATGGGGTGGGGGGAGG + Intergenic
1099224312 12:79950781-79950803 TTTTGTAGGGGGGTGGGGGCAGG + Intergenic
1099319609 12:81129774-81129796 GCCTATCATGGGGTGGGGGGAGG - Intronic
1099715331 12:86286737-86286759 GCCTACAAGGGGGTGGGGGTGGG - Intronic
1100533022 12:95478114-95478136 TTTTTTTGGGGGGTGGGGGGAGG - Intronic
1101418832 12:104532317-104532339 TCTTATAACGGGGTGGGGGTGGG - Intronic
1101833553 12:108278406-108278428 TTCTGCTAGGGGGTTGGGGGCGG + Intergenic
1102078049 12:110075456-110075478 AGCAATAAGGTGGTGGGGGGGGG - Intergenic
1102165443 12:110802547-110802569 GTGTATAAGGGGGTCTGGGGAGG + Intergenic
1102887724 12:116534218-116534240 TTCTATGTTGGAGTGGGGGGAGG + Intergenic
1103748199 12:123140568-123140590 TTCTGTTAGGGGGTGGGGCAGGG - Intronic
1103946513 12:124530276-124530298 CTCTAGTCGGGGGTGGGGGGTGG + Intronic
1104063487 12:125287218-125287240 TCTTATAAGAGGGTGGTGGGAGG - Intronic
1106136216 13:26975692-26975714 TTCTATCAGCGGGTAGGGTGGGG - Intergenic
1106296734 13:28420990-28421012 TTCCATCCGGGGATGGGGGGTGG - Intronic
1106697112 13:32187022-32187044 TCCTCTAAAGGGGTGGGTGGAGG - Intronic
1107111894 13:36707155-36707177 CACTTTAAGGGGGTGGGGAGGGG + Intergenic
1108265427 13:48702252-48702274 GTCTGTCATGGGGTGGGGGGAGG + Intronic
1108446032 13:50509992-50510014 TTCTTGAAGGGAGTGGGAGGAGG + Intronic
1109361368 13:61298923-61298945 TGCTATACTGGGGTGGTGGGGGG - Intergenic
1109470452 13:62797973-62797995 TTCATTGAGGGGTTGGGGGGCGG + Intergenic
1109692861 13:65915838-65915860 GTCCATAAAAGGGTGGGGGGCGG + Intergenic
1110115807 13:71815315-71815337 TTAAAAAAGGGGGTGGGCGGGGG + Intronic
1110130869 13:72008406-72008428 TCCTGTCATGGGGTGGGGGGAGG - Intergenic
1111646617 13:91039414-91039436 GCCTTTAAGGGGGTGGGGGGAGG + Intergenic
1111654813 13:91139260-91139282 TTCTTTATGGGGGTGGGGAGAGG + Intergenic
1112106329 13:96243890-96243912 TTTTTTGAGGGGGTGGGGTGTGG + Intronic
1112208095 13:97345760-97345782 CTCTCTAAGGGGGTGGGGTGGGG - Intronic
1112638772 13:101247802-101247824 GCCTATCAGGAGGTGGGGGGAGG - Intronic
1112880772 13:104104066-104104088 TTTTTTGAGGGGGTGGGGGATGG + Intergenic
1114078291 14:19176681-19176703 TTCTACAGGGAGGTGGGAGGAGG - Intergenic
1114125199 14:19717870-19717892 TTCTACAGGGAGGTGGGAGGAGG + Intergenic
1115313866 14:32006300-32006322 CTCTGGAAGGGGGTGGGCGGAGG - Intergenic
1116371028 14:44132725-44132747 TTCTATAAGGGAGAGGAGGTAGG - Intergenic
1116874616 14:50098601-50098623 AACTATATGGGGGTAGGGGGTGG - Intergenic
1117193066 14:53312741-53312763 TTTTATAAGGCGGGGGGGGGTGG - Intergenic
1117672090 14:58118494-58118516 TTCTATGCGGGGGCGGGGGTGGG + Intronic
1118352472 14:64983118-64983140 GGCTATGAGGGGGTGGGGGGGGG - Intronic
1118466107 14:66032609-66032631 TTCTAAAAGAGGGTTTGGGGTGG - Intergenic
1118714427 14:68548945-68548967 TTCAACAAAGGGGTGGGAGGAGG - Intronic
1118880125 14:69818723-69818745 TTCTATAAAGGAGTGTGGGTTGG + Intergenic
1118971412 14:70641644-70641666 GTCTGAAAGGAGGTGGGGGGAGG - Intergenic
1119581921 14:75792215-75792237 GCCTATCATGGGGTGGGGGGAGG + Intronic
1120278549 14:82409446-82409468 TTCTTTAAAGGGGTGGGGGGAGG + Intergenic
1120519606 14:85511220-85511242 TTCAATGCGGGGGGGGGGGGGGG + Intergenic
1121044584 14:90778471-90778493 TCCTATTTGGGGGTGGGAGGTGG - Intronic
1122434362 14:101684127-101684149 TTGTGTGTGGGGGTGGGGGGTGG + Intergenic
1122650674 14:103224825-103224847 TTCTATTTGGGCTTGGGGGGCGG - Intergenic
1124187517 15:27542966-27542988 TTACACAAGGGGGTGGGGGTGGG + Intergenic
1124873889 15:33572549-33572571 TGCCATGAGGCGGTGGGGGGAGG + Intronic
1124909688 15:33906934-33906956 TTTTAAAAAGGGGTGTGGGGGGG + Intronic
1125173283 15:36791776-36791798 TTCTATAATGGAGTTGGGTGGGG + Intronic
1125892728 15:43278154-43278176 TTCTCTATTGGGGTGGGGAGGGG + Intronic
1127559285 15:60119854-60119876 TTCTATTTGGGGTTGGCGGGGGG + Intergenic
1127839677 15:62820309-62820331 ATCTGGATGGGGGTGGGGGGTGG - Intronic
1129822804 15:78616351-78616373 TTTTTTGGGGGGGTGGGGGGGGG - Intronic
1129874158 15:78961725-78961747 TGTTATAACTGGGTGGGGGGTGG - Exonic
1131789718 15:95951093-95951115 GTTTATATGGGGGTGGGGGTGGG - Intergenic
1131917033 15:97278879-97278901 GCCTATCAGGGGGTGGGGGGCGG - Intergenic
1131971624 15:97899357-97899379 TTAAATAAGGGGGTGGTGGGCGG - Intergenic
1132711587 16:1271299-1271321 CTCTATGAGCGGGGGGGGGGGGG + Intergenic
1132724573 16:1333345-1333367 GTCTAGAAGGGGGTGGTCGGCGG - Intergenic
1132851656 16:2027385-2027407 TCCTGCACGGGGGTGGGGGGGGG + Intronic
1133021960 16:2970627-2970649 TTCTATAAAGGGGTGAGGCCAGG - Intronic
1133103297 16:3492118-3492140 TTGGATCATGGGGTGGGGGGTGG - Intergenic
1133165290 16:3942527-3942549 GTCTGTCATGGGGTGGGGGGAGG + Intergenic
1133337752 16:5017170-5017192 TTCCAGAGGCGGGTGGGGGGAGG + Exonic
1133640255 16:7709743-7709765 TTTTGGGAGGGGGTGGGGGGAGG + Intronic
1134688488 16:16175268-16175290 TGCTATACAGGGGTGGTGGGCGG - Intronic
1135489902 16:22900157-22900179 TTCTATATGGGGGAAGGGGTAGG + Intronic
1135974556 16:27099449-27099471 TGCTCTATGGGGGTGGGAGGTGG - Intergenic
1137278679 16:46956113-46956135 TTTTTTAAGGGGGTGGTGGTAGG + Exonic
1137889571 16:52144909-52144931 TTCCATCAGGGAGTGGAGGGTGG + Intergenic
1138844094 16:60544256-60544278 TTCTAAAACTGGGTGGGAGGAGG - Intergenic
1139385938 16:66571003-66571025 TTCTATAAGGAAGTGGGATGTGG - Intronic
1139954705 16:70687457-70687479 TTCTTTATTGGGGTGGGGGTGGG + Exonic
1140775744 16:78247615-78247637 TTTTATAAGGGGCAGGGGGCAGG - Intronic
1140857809 16:78993254-78993276 TACTATTTGGGGGTGGGGGGAGG + Intronic
1141399684 16:83736635-83736657 TTCAAAAATGGGGTGGGGGAGGG + Intronic
1141807271 16:86350012-86350034 TTCTCTAAGGCAGTGGTGGGAGG + Intergenic
1142601099 17:1053335-1053357 TTCGAGAAGGGGCTGGGGGAGGG + Intronic
1143057081 17:4170467-4170489 TTCTAGAAGGTTGTGGGGTGTGG + Intronic
1143061838 17:4208465-4208487 ATCTTTCAGGGGGTGGGAGGAGG - Intronic
1143498368 17:7325148-7325170 TTCTAATGGGGGGGGGGGGGCGG - Intronic
1143545282 17:7591715-7591737 TTATCTAGGGGGGAGGGGGGTGG - Exonic
1144113606 17:12063964-12063986 TTCTGTCAGGGGGCGGGGGGCGG + Intronic
1144147492 17:12412645-12412667 TTAGAAAAGAGGGTGGGGGGAGG - Intergenic
1144600503 17:16608578-16608600 TTCTGAAAGGGGGTCGTGGGTGG + Intergenic
1144726506 17:17505096-17505118 GTCTGTATGGGGGTGAGGGGTGG - Intergenic
1144964934 17:19070853-19070875 TTCTATAAAGAGATGGGGGGGGG + Intergenic
1144983033 17:19181325-19181347 TTCTATAAAGAGATGGGGGGGGG - Intergenic
1144985191 17:19196914-19196936 TTCTATAAAGAGATGGGGGGGGG + Intergenic
1146029503 17:29352974-29352996 TTTTTTACGGTGGTGGGGGGTGG + Intergenic
1146527921 17:33582744-33582766 GTGTATGAGGGGGTGGGGTGTGG - Intronic
1146928559 17:36762034-36762056 TTCTTTAAGGGGGCTGGGGGTGG + Intergenic
1146989103 17:37251074-37251096 TTTTAAAAGGAGGTGGGTGGGGG + Intronic
1147970512 17:44217239-44217261 TGCTTTAAGGGGCTAGGGGGTGG - Intronic
1148061903 17:44842523-44842545 GTTTATAAAAGGGTGGGGGGTGG + Intergenic
1148139481 17:45317892-45317914 TTCTGAATGGGGGTCGGGGGTGG + Intergenic
1148750834 17:49944935-49944957 TTCTATGAGGGGCTGGGATGGGG - Intergenic
1148899293 17:50864524-50864546 ATATATATGGGGGTGGGGGGAGG - Intronic
1149109861 17:53015568-53015590 GCCTGTAAGGGGGTGGGGTGGGG + Intergenic
1149153295 17:53595002-53595024 TGCTTTCAGGGGGTGGGGGAGGG + Intergenic
1149246991 17:54720920-54720942 GCCTATCAGGGGGTGGGGGAAGG + Intergenic
1149506535 17:57198539-57198561 TTATATCAGGTGGTGGTGGGAGG + Intergenic
1149772012 17:59330198-59330220 GTCTAAAACGGGGGGGGGGGGGG - Intergenic
1150413781 17:64970118-64970140 TTTAAAAAGGGGGTGGGGGTGGG - Intergenic
1150455625 17:65304580-65304602 TTCTCTGGGGGGGGGGGGGGGGG - Intergenic
1151159111 17:72150102-72150124 TTGTATGGGGGGGTGGGGGGTGG + Intergenic
1151232326 17:72693956-72693978 TTCTATAAAGAGCTGGGGGCTGG - Intronic
1152467578 17:80474801-80474823 TTGTAAAAGGGGAGGGGGGGGGG - Intronic
1152617433 17:81344444-81344466 TTCTAAACTGGGGAGGGGGGAGG + Intergenic
1153248685 18:3098565-3098587 TGCTGTAAGAGGGTGGGGTGTGG - Intronic
1153322985 18:3792011-3792033 AGCTATAGTGGGGTGGGGGGTGG - Intronic
1153939507 18:9966104-9966126 ACAGATAAGGGGGTGGGGGGGGG - Intergenic
1155702781 18:28768694-28768716 TTCTTGGAGGGGATGGGGGGTGG - Intergenic
1155924843 18:31644439-31644461 TTTTTTTTGGGGGTGGGGGGAGG + Intronic
1156569701 18:38239343-38239365 TTCTATATGGGGGGTGGGGAGGG + Intergenic
1157028553 18:43876687-43876709 TTCTGAAAGGGGGTACGGGGTGG + Intergenic
1157333581 18:46721110-46721132 TTCTATCAGGGGGTAGGGTGGGG - Intronic
1157486033 18:48087834-48087856 TTTTAAAAGTGGGTGGGGGGGGG + Intronic
1157628547 18:49073441-49073463 TATTTTATGGGGGTGGGGGGAGG - Intronic
1159327729 18:66945757-66945779 TTCTATAAGGGGAGTGGGAGTGG + Intergenic
1160032195 18:75271745-75271767 TGCGTTAAGGGGGTGGGGAGGGG - Intronic
1160710588 19:549287-549309 TCCTGTCAGGGGCTGGGGGGCGG + Intronic
1161271910 19:3394521-3394543 TAGTGTAAGCGGGTGGGGGGTGG - Intronic
1161444651 19:4311362-4311384 TTCCATCAGTGGGTTGGGGGAGG - Intronic
1161566830 19:5007076-5007098 TTCTAGAAGGGCCTTGGGGGAGG + Intronic
1162373403 19:10291806-10291828 TTCTGTGAGTGGGTGTGGGGAGG + Exonic
1162771726 19:12953400-12953422 TCCTAGAAGAGGATGGGGGGGGG - Exonic
1163165870 19:15497767-15497789 TTTTAAATGGGGGTGGGGGATGG - Intronic
1163567273 19:18059125-18059147 TTTTATAGGGGGGTGAGGGTGGG + Exonic
1163796709 19:19342178-19342200 TGCTCTGAGGGGGTGGGAGGTGG - Intronic
1163944261 19:20521325-20521347 TTCTAGAAGGGGTTGGGGTTTGG + Intergenic
1164147291 19:22519815-22519837 TGTTAAAAGGGGGTGGGGGTCGG - Intronic
1164159309 19:22616295-22616317 TGTTAAAAGGGGGTGGGGGTCGG + Intergenic
1164444172 19:28302974-28302996 TACTATGAGGGGGAGGGAGGAGG + Intergenic
1164498559 19:28793037-28793059 TCGTTTAAGGGGGTGGGGGGGGG - Intergenic
1164664104 19:30011890-30011912 GTCTGTCATGGGGTGGGGGGAGG + Intronic
1164920056 19:32082703-32082725 TTCCATAATGTGGTGGGTGGGGG + Intergenic
1165945279 19:39437964-39437986 CTCTAAAAGGGTGAGGGGGGAGG + Intronic
1167655294 19:50759760-50759782 AGCTATTTGGGGGTGGGGGGCGG - Intergenic
1168295130 19:55374481-55374503 ATCAAGGAGGGGGTGGGGGGCGG - Intergenic
1168442100 19:56378212-56378234 TTACATTAGGGGGAGGGGGGAGG - Intronic
1168679277 19:58301763-58301785 TTCTCAAAGGGGGTGTGGGAAGG + Exonic
926411696 2:12609798-12609820 TTTTTTGGGGGGGTGGGGGGCGG - Intergenic
926454530 2:13049012-13049034 TTGAATCATGGGGTGGGGGGAGG - Intergenic
926847109 2:17153671-17153693 GCCTATCATGGGGTGGGGGGAGG + Intergenic
926974414 2:18499317-18499339 TCCTATCAGAGGGTGGAGGGTGG - Intergenic
927031121 2:19121602-19121624 TTAGATATGGGGGTGGAGGGGGG - Intergenic
927273950 2:21245681-21245703 TTCTATAAGAGGATGGAGGCAGG - Intergenic
927768566 2:25837071-25837093 CTCCAAAGGGGGGTGGGGGGGGG + Intronic
928421775 2:31142762-31142784 TTCTATAGGGGCTGGGGGGGGGG - Intronic
929147811 2:38722038-38722060 TTCTAGGTGGGGGGGGGGGGTGG - Intronic
929316623 2:40486871-40486893 CTCTACAAAGGGGTGGGGGGAGG - Intronic
929959012 2:46482241-46482263 TTCAAAAAGGGTGTGGGGGCAGG - Intronic
930085151 2:47491554-47491576 TTAGAGACGGGGGTGGGGGGGGG - Intronic
930136273 2:47906239-47906261 CTCTTTCAGGGGGTGTGGGGGGG - Intergenic
930707667 2:54520663-54520685 CTCTATTGTGGGGTGGGGGGTGG - Intronic
931021961 2:58056085-58056107 CTCTTTTAGGGGGTGGGGGAGGG - Intronic
931150322 2:59565747-59565769 TTCTGTTATGAGGTGGGGGGTGG - Intergenic
931473594 2:62565006-62565028 TTCTAAATGGAGGTGGGGAGGGG + Intergenic
931754328 2:65358906-65358928 TCCTATCTGGGGGTGGGGTGAGG + Intronic
932190672 2:69739410-69739432 TTTTTTAGGGGGGTGGGGTGGGG + Intronic
932310298 2:70734349-70734371 TGCTTTGAGGGGGTGAGGGGTGG - Intronic
932433691 2:71690666-71690688 TTTTATAATGGGGTGGAGGATGG - Intergenic
932991268 2:76790700-76790722 TTCACTGAGGTGGTGGGGGGGGG - Intronic
933324759 2:80821188-80821210 ACCTGTCAGGGGGTGGGGGGGGG - Intergenic
933555963 2:83831036-83831058 GTGTATATGGGGGTGGGTGGGGG - Intergenic
935053371 2:99543704-99543726 TTTTGTTAGGGGGTGGGGGTAGG - Intergenic
935963557 2:108449852-108449874 TTCTATATCGGGGTGGGCGGGGG - Intronic
936377615 2:111955447-111955469 TTCTATAAGGGGGTAGAAGAGGG + Intronic
936610266 2:113995813-113995835 GTCTGTCATGGGGTGGGGGGAGG - Intergenic
936949084 2:117959061-117959083 CTCTATAAGGGAGGAGGGGGTGG + Intronic
936986776 2:118318954-118318976 TTATCTAAGAGGGTGGGGAGGGG + Intergenic
937283646 2:120736628-120736650 TTTTTTCAGGGGGTGGAGGGTGG + Intronic
937453878 2:122024930-122024952 TGCTGTGGGGGGGTGGGGGGGGG + Intergenic
937458033 2:122060816-122060838 TTGAGTAAGGGGGTGGGGGAAGG - Intergenic
937976914 2:127588140-127588162 TTATATAAGGGGGTTTGGAGTGG + Intronic
937977242 2:127589405-127589427 TTATATAAGGGGGTTTGGAGTGG + Intronic
938637153 2:133240749-133240771 TTCTATATGGAGGTGGTTGGTGG - Intronic
938901248 2:135800239-135800261 TTCTTTTTGGGGGTTGGGGGTGG + Intronic
939015800 2:136902595-136902617 TGCCATAAGGGAGTGGAGGGTGG + Intronic
939367516 2:141252192-141252214 TTTTTTTAGGGGGTGGGGGGTGG - Intronic
940042768 2:149377784-149377806 TTTTTTGGGGGGGTGGGGGGGGG - Intronic
940766804 2:157798517-157798539 TTTTTGGAGGGGGTGGGGGGTGG + Intronic
940767845 2:157809268-157809290 TTCTATTCGGGGGAGGGGAGAGG - Intronic
940771888 2:157847924-157847946 TTATAGAATGGGGTGGTGGGGGG - Intronic
940910928 2:159209455-159209477 TTCTAGAAGGTGGGGCGGGGAGG + Intronic
941013533 2:160328685-160328707 AACTATAAGGGGCTGGGGTGGGG + Intronic
941039692 2:160607136-160607158 TTTTTTTGGGGGGTGGGGGGAGG + Intergenic
941497015 2:166218252-166218274 ATGTAAAATGGGGTGGGGGGAGG + Intronic
941596055 2:167478715-167478737 GCCTATCATGGGGTGGGGGGAGG - Intergenic
941614700 2:167706046-167706068 CTTTTTAAGGGGGTCGGGGGAGG + Intergenic
941654754 2:168131376-168131398 TTGTAGCAGGGGGTGGGGCGGGG + Intronic
941810288 2:169748772-169748794 ATGTATATGGGGGGGGGGGGGGG - Intronic
941904893 2:170711277-170711299 TTTTTTATGGTGGTGGGGGGAGG - Intergenic
941908967 2:170743986-170744008 TGCAGTTAGGGGGTGGGGGGCGG + Intergenic
942762871 2:179420465-179420487 TTCTATCAGCGGGTGGAGGGTGG + Intergenic
942814431 2:180034736-180034758 TGCTATCAGGGGATGGGGGAGGG + Intergenic
943365179 2:186961924-186961946 GTCTCGAAAGGGGTGGGGGGAGG - Intergenic
943511328 2:188830879-188830901 TACAATGGGGGGGTGGGGGGTGG - Intergenic
943659690 2:190545692-190545714 TTTTAAAAAGGGGTGGGTGGAGG + Intergenic
943818664 2:192290174-192290196 TTCTGTAAATGGGTGCGGGGTGG + Intergenic
944605542 2:201348625-201348647 GTGTGTAAGGGGGTGGTGGGGGG - Intronic
945478429 2:210315351-210315373 TTATATATGGAGGTGGGGGGGGG - Intergenic
946996018 2:225392313-225392335 GTCTGTCAGGGGGTGGGGGTAGG + Intergenic
947119869 2:226802018-226802040 TTTTTTTGGGGGGTGGGGGGTGG - Intergenic
947488318 2:230572436-230572458 TTCTGTAAGCAGGTGGGAGGGGG + Intergenic
947739282 2:232477750-232477772 TTCTAGAAGTGGCTGAGGGGTGG - Intergenic
948705021 2:239785320-239785342 TTAAATAAAGGGGTGGAGGGGGG + Intronic
1169145686 20:3250808-3250830 TTAGAAAAGGGGTTGGGGGGTGG - Exonic
1169464157 20:5822999-5823021 GTATATATGGGGGTGGGGGCGGG - Intronic
1170273263 20:14552312-14552334 CTCTATGTGGGGGTGGGGGTGGG + Intronic
1170557454 20:17526131-17526153 TTCTGTATGGCGGGGGGGGGGGG + Intronic
1171123539 20:22584325-22584347 TTTTAAAAGAGGGTGGGGGTGGG - Exonic
1171196386 20:23202796-23202818 TTCTAGTTGGGGGTGGAGGGTGG + Intergenic
1171538289 20:25918951-25918973 TTCTGTTGTGGGGTGGGGGGAGG - Intergenic
1172047173 20:32088547-32088569 TCCTATATGGGGGAGAGGGGAGG - Exonic
1172202666 20:33137948-33137970 TTCTGTTGTGGGGTGGGGGGAGG - Intergenic
1172998802 20:39090973-39090995 TTATACAGGGGGGTGGGTGGGGG - Intergenic
1173480802 20:43397875-43397897 TTCTATTATGGAGAGGGGGGGGG - Intergenic
1174439233 20:50535868-50535890 CTCTATTTGGGGGTGGGGGACGG - Intronic
1174776496 20:53347492-53347514 TTGAATAAGGAGTTGGGGGGTGG - Intronic
1176973088 21:15288929-15288951 CTCTGTCAGGGGGTGAGGGGAGG + Intergenic
1177332280 21:19679903-19679925 TTTTTTCGGGGGGTGGGGGGAGG + Intergenic
1177453720 21:21306830-21306852 TTGTAGTAGGGGGTTGGGGGAGG - Intronic
1178029047 21:28504226-28504248 TTGCATAAGGAGGTGGGGGATGG - Intergenic
1178475419 21:32933382-32933404 TTCAAGAAGTGGGTGGCGGGCGG - Intergenic
1178486142 21:33021083-33021105 TACTATATGGGGGGTGGGGGTGG - Intergenic
1178832303 21:36066315-36066337 TTCCAAAAGGGGGAGGGAGGGGG - Intronic
1178878165 21:36428498-36428520 AGCTATTTGGGGGTGGGGGGGGG - Intergenic
1178936867 21:36870288-36870310 TACCATGAAGGGGTGGGGGGAGG + Intronic
1180651502 22:17381087-17381109 TTGTACACGGGGGTGGGCGGGGG + Intronic
1180914553 22:19476571-19476593 GTGGATATGGGGGTGGGGGGTGG - Intronic
1181805017 22:25369501-25369523 TCCTGCAAGGGGGTGGGTGGGGG - Intronic
1181873939 22:25925227-25925249 TTTTAAAATGGGGTGGGGGAGGG - Intronic
1182200571 22:28564969-28564991 TACTATTTGGGGGTGGGAGGAGG + Intronic
1182277555 22:29200295-29200317 TCCCATAAGGGGGTGGAGGCTGG + Intergenic
1183131452 22:35840523-35840545 TGCTGGGAGGGGGTGGGGGGAGG - Intronic
1183438140 22:37807332-37807354 TTAAAAAAGGGGGTGGGGGGGGG - Exonic
1184623540 22:45703069-45703091 TTCTTTAAGGTGGTGAGGAGCGG + Intronic
950056534 3:10029503-10029525 CTCAAAAAGGGAGTGGGGGGCGG + Intronic
950138503 3:10599794-10599816 TTCTATAAGGGGGTGGGGGGTGG + Intronic
950834624 3:15907389-15907411 GACTATTGGGGGGTGGGGGGAGG - Intergenic
951146401 3:19233063-19233085 TTATGTAGTGGGGTGGGGGGGGG - Intronic
951204186 3:19909032-19909054 TCCTTGTAGGGGGTGGGGGGCGG - Intronic
952385931 3:32841615-32841637 TTCTTTTGGGGGGTGGGGGTTGG - Intronic
953168770 3:40488657-40488679 TTTTTTTAGGGGGTGGGGGGTGG + Exonic
954573958 3:51664539-51664561 GTTTATTTGGGGGTGGGGGGAGG + Exonic
954655140 3:52190111-52190133 TTCAATAAGGGGGTGGCTGTGGG + Intergenic
954904007 3:54044173-54044195 TTCGATATTGGGGTGGGGAGAGG + Intergenic
956783616 3:72624126-72624148 TTCTAGAAGGGGCTGGAGTGGGG - Intergenic
958777450 3:98503260-98503282 TTCTAAAAGTGGGTGGGAGGAGG + Intronic
959424398 3:106168325-106168347 TACTAAAAGGGGGAGGGGAGGGG + Intergenic
959604564 3:108227884-108227906 CTATTTAAGGGGGTGGGGGGTGG + Intergenic
960601394 3:119462626-119462648 TTCTTCAAGGGGGGGGGGCGGGG + Intronic
961210291 3:125120293-125120315 TTCAAAATGGGGGTGGGGGAGGG + Intronic
961529417 3:127531539-127531561 TTTTATCAGTGGGGGGGGGGGGG - Intergenic
961863948 3:129940011-129940033 GTCTAGAAGGGGATGGGGTGTGG - Intergenic
962436910 3:135375258-135375280 TTTTATTGGGGGGTGGGGGGTGG - Intergenic
962439869 3:135403584-135403606 TCCTAAAAGGAGGTGGGTGGAGG - Intergenic
962805257 3:138922440-138922462 TTTTTCATGGGGGTGGGGGGTGG + Intergenic
962904347 3:139788705-139788727 TTCTATAAGGCAGGGGGTGGGGG + Intergenic
963276552 3:143337264-143337286 TTCTGAATGAGGGTGGGGGGTGG - Intronic
965357121 3:167689661-167689683 TTTTAAAAGGGGGTGGGGGGAGG + Intronic
965690043 3:171346039-171346061 TTCTATAAGGTGGTCAGGGAAGG + Intronic
965770284 3:172174931-172174953 TTGTATTGGGGGGGGGGGGGTGG - Intronic
965921048 3:173914218-173914240 TTCTTTAAGGATGTGGGGGAGGG - Intronic
966010721 3:175072680-175072702 TTGAAAAACGGGGTGGGGGGAGG + Intronic
966714186 3:182999767-182999789 CACTGTAAGGGGGTGGGGTGAGG + Intergenic
966919204 3:184601545-184601567 TTCTGTTCTGGGGTGGGGGGAGG + Intronic
967553199 3:190823965-190823987 TTCTTTAAGTTGGTGGGGGCGGG - Intergenic
968010924 3:195274483-195274505 TTTTTTTGGGGGGTGGGGGGAGG - Intergenic
969286011 4:6202208-6202230 TTTTTTGAGGGGGTGGGTGGGGG - Intergenic
970487813 4:16542088-16542110 TTACATCAGGTGGTGGGGGGGGG + Intronic
971043435 4:22779219-22779241 CTCCAAAAGTGGGTGGGGGGGGG - Intergenic
971419696 4:26464287-26464309 TTTTCTATGGGGGTGGGGGGTGG - Intergenic
971767371 4:30850533-30850555 TTTTATTAGGTGGAGGGGGGAGG + Intronic
971837968 4:31793776-31793798 TTCTGGTAGGGGGTGGGTGGGGG - Intergenic
971857899 4:32065987-32066009 TTCAAGTAGGGGGTGGAGGGCGG + Intergenic
972308078 4:37851480-37851502 TTCTATGTTGGGGTTGGGGGAGG + Intronic
972385219 4:38559539-38559561 TCCTATATGGTGGTGGGTGGTGG - Intergenic
973224838 4:47771592-47771614 GTCTATCAGAGGGTGGAGGGTGG - Intronic
973936134 4:55848716-55848738 CTCTTTGTGGGGGTGGGGGGTGG - Intergenic
974223602 4:59009174-59009196 TTTTATTGTGGGGTGGGGGGAGG + Intergenic
974827086 4:67144906-67144928 GCCTGTTAGGGGGTGGGGGGAGG + Intergenic
974920447 4:68232851-68232873 ATTTGTAAGGGGGAGGGGGGAGG - Intronic
975370880 4:73585982-73586004 ACATATAATGGGGTGGGGGGAGG - Intronic
975422413 4:74183104-74183126 AGCAATAAGGGGGTTGGGGGAGG + Intronic
975602221 4:76113512-76113534 TACTATAAGGGGGTGTGCAGAGG + Intergenic
976347806 4:84025423-84025445 TTTTATCTGGGGGTGGGGGGTGG + Intergenic
976378297 4:84370285-84370307 TTCTAGTAGAGGGTGGAGGGTGG - Intergenic
976495616 4:85726226-85726248 CTCTTTTGGGGGGTGGGGGGTGG + Intronic
976827464 4:89276884-89276906 TCCTATATGGGGGTGGGAGGAGG + Intronic
977636704 4:99306299-99306321 TGCTAAAGCGGGGTGGGGGGTGG - Exonic
977744315 4:100527522-100527544 TTCTGTCGTGGGGTGGGGGGAGG - Intronic
978353604 4:107846261-107846283 TACTATTGTGGGGTGGGGGGAGG - Intronic
978716172 4:111845848-111845870 GTCTATCAGAGGGTGGAGGGTGG + Intergenic
978734544 4:112070533-112070555 GCCTATCATGGGGTGGGGGGAGG + Intergenic
979268517 4:118732031-118732053 TTCTAGAAGGGAGGGGAGGGCGG + Intronic
980233111 4:130069467-130069489 TTCTGTTGTGGGGTGGGGGGAGG - Intergenic
980510445 4:133779748-133779770 CCCTAGCAGGGGGTGGGGGGCGG - Intergenic
980992587 4:139750822-139750844 TTTTAAAAGGGGGTAGGGAGTGG - Intronic
981716740 4:147759578-147759600 TTTTTAAAGGGGGGGGGGGGCGG - Intronic
981743826 4:148032332-148032354 TACAATATGGGGGGGGGGGGGGG - Intronic
982257727 4:153466595-153466617 ATCTATAAGAGGGCGAGGGGAGG + Intronic
982743708 4:159084602-159084624 TTATATAATAGGGTGGGTGGTGG - Intergenic
982792494 4:159609561-159609583 GTCTGTCATGGGGTGGGGGGAGG - Intergenic
983457366 4:167982171-167982193 GCCTGTCAGGGGGTGGGGGGAGG - Intergenic
983505224 4:168546300-168546322 TTCTTTTGGTGGGTGGGGGGTGG - Intronic
983939552 4:173525585-173525607 TTTTGGAAGGGGGTGGGAGGAGG - Intronic
984297028 4:177865561-177865583 TTAAATAAGGTGGTGAGGGGAGG + Intronic
984619814 4:181939689-181939711 CTATATAAGGGGTTGGGGTGCGG + Intergenic
984708359 4:182864108-182864130 TTGTGGAAGGGGGTGGGGAGGGG - Intergenic
986823715 5:11497600-11497622 TACTATAAGGGAGTGGAGAGAGG + Intronic
988610267 5:32717002-32717024 GCCTGTCAGGGGGTGGGGGGTGG - Intronic
989052722 5:37337098-37337120 GTGTATAAGGAGGTGAGGGGAGG - Intronic
989063626 5:37435965-37435987 TTTGATAAGGGGGTGGTGGTGGG + Intronic
989394618 5:40940995-40941017 TTCTATATGTGGGTGGGAGTGGG + Intronic
989672215 5:43932072-43932094 GCCTGTCAGGGGGTGGGGGGAGG - Intergenic
990934409 5:61132398-61132420 TTCTCAAAGGAGGTGGGGGAGGG - Intronic
991264548 5:64701528-64701550 TTTTAGAAGGGGCTGGGGGAAGG + Intronic
991285636 5:64972762-64972784 TGCTACAAGGGAATGGGGGGAGG - Intronic
992315681 5:75551394-75551416 TTTTTTAAGAGGTTGGGGGGTGG - Intronic
992597935 5:78364876-78364898 GTCTGTCATGGGGTGGGGGGAGG + Intronic
992699473 5:79327486-79327508 TTTTAAATGGGGGTGGGGAGAGG + Intergenic
992792540 5:80226491-80226513 TTCTATAGGGGAGTAGGTGGAGG - Intronic
993065267 5:83090325-83090347 TTTTATAAGGTGGTGGGGTTGGG + Intronic
994012941 5:94928827-94928849 TTCTTTTTGGAGGTGGGGGGCGG - Intronic
995208095 5:109505072-109505094 GTCTGTCATGGGGTGGGGGGAGG + Intergenic
996118149 5:119641969-119641991 CTCTGTGTGGGGGTGGGGGGGGG - Intergenic
996369866 5:122741823-122741845 TTAGTTCAGGGGGTGGGGGGTGG - Intergenic
996475344 5:123912957-123912979 TTCTAAAAGGTGGTGGGAGAGGG - Intergenic
996704495 5:126483625-126483647 TTTTTTAAGGGGGTGGGGTGAGG - Intronic
996749652 5:126875718-126875740 TTCTATAAAGGGCAGGGGGAGGG + Intronic
997131337 5:131279448-131279470 TTCTGAAAGGGGGGGGGGGAGGG - Intronic
997810163 5:136959372-136959394 TTCTTTATGGGGGGTGGGGGAGG + Intergenic
997902264 5:137777845-137777867 TTGTAGAGGGGGGTTGGGGGTGG - Intergenic
997963384 5:138338697-138338719 TTCTTCATGGGGGTGGGGGGAGG + Intronic
998631509 5:143904000-143904022 GCCTATAAGAGGGTGGGGGGTGG - Intergenic
999101457 5:149029009-149029031 TACTGTAGGGGGGTGGGGGGTGG + Intronic
999335777 5:150715151-150715173 TCCTCCAAGGGGGTGGGGGTGGG + Intronic
999714092 5:154345140-154345162 TCATATGTGGGGGTGGGGGGAGG - Intronic
999858354 5:155619509-155619531 TTCTGTCGGGGGGTGGGTGGTGG - Intergenic
1000122623 5:158211648-158211670 GTCTGTCATGGGGTGGGGGGAGG + Intergenic
1000242247 5:159419344-159419366 TTGTATAATGGGTTGGGGGTTGG + Intergenic
1000426861 5:161101446-161101468 TTCTATTAAGTGGTGGGGAGTGG + Intergenic
1001204905 5:169753357-169753379 AGCTGTCAGGGGGTGGGGGGGGG - Intronic
1001299472 5:170523587-170523609 TCCTGTAAGGGAGTGGGTGGAGG - Intronic
1001420971 5:171586843-171586865 TGCTTTCTGGGGGTGGGGGGAGG + Intergenic
1001525144 5:172423532-172423554 TTGGATACGGGGTTGGGGGGGGG + Intronic
1001930191 5:175667443-175667465 TTTTTTTGGGGGGTGGGGGGAGG - Intronic
1002355186 5:178622275-178622297 TTATATAAGGGGAAGGGGGAAGG - Intronic
1002794248 6:458036-458058 ACCTGTCAGGGGGTGGGGGGGGG - Intergenic
1003579387 6:7325983-7326005 TGGTATAAGGGGGTGGGGATGGG - Intronic
1003842363 6:10135090-10135112 TACTATTGTGGGGTGGGGGGCGG + Intronic
1003911866 6:10750425-10750447 GTTTAGAATGGGGTGGGGGGGGG + Intronic
1004402170 6:15298989-15299011 TTATTTGCGGGGGTGGGGGGCGG + Intronic
1004409376 6:15366489-15366511 CTCTATATGTGGGTGGGGGGCGG + Intronic
1005111358 6:22285348-22285370 TTTTTTGGGGGGGTGGGGGGAGG + Intergenic
1006022545 6:31125990-31126012 TGCTTGCAGGGGGTGGGGGGTGG - Intronic
1006273273 6:32980822-32980844 TCCTAGAGGGGGGCGGGGGGGGG - Exonic
1006487493 6:34355684-34355706 TTTTTTGGGGGGGTGGGGGGTGG + Intronic
1006770384 6:36547956-36547978 TTCTACACGGGGTAGGGGGGTGG - Intergenic
1006795646 6:36730774-36730796 TTCTGCAAGGGGGGGGGTGGGGG - Intronic
1006934110 6:37705513-37705535 ACGTAAAAGGGGGTGGGGGGCGG + Intergenic
1007194789 6:40051073-40051095 GCCAATATGGGGGTGGGGGGTGG + Intergenic
1007262612 6:40574507-40574529 GTCCATCACGGGGTGGGGGGTGG + Intronic
1008077803 6:47163857-47163879 TACTATAAGGTGGTAGGGGCGGG + Intergenic
1008194993 6:48507876-48507898 GACTGTTAGGGGGTGGGGGGAGG - Intergenic
1008812447 6:55520090-55520112 GCCTGTCAGGGGGTGGGGGGCGG + Intronic
1009223089 6:61001357-61001379 TAATATTTGGGGGTGGGGGGAGG + Intergenic
1009273479 6:61645305-61645327 GTCTATCAGAGGGTGGGGGTTGG + Intergenic
1010154017 6:72770991-72771013 ATCTAGAAGGGGGAAGGGGGCGG + Intronic
1010771339 6:79835016-79835038 GTCTACAAGAGGGTGGAGGGTGG + Intergenic
1011075779 6:83437156-83437178 TGGTAAAAGGGGGTGAGGGGTGG + Intergenic
1011459656 6:87589999-87590021 TCGTATAAGGAGGTGGGGCGAGG - Exonic
1011525470 6:88259601-88259623 GTCTGTCATGGGGTGGGGGGAGG + Intergenic
1012398148 6:98823567-98823589 TTCTTTCTGGGGGTGGGGTGGGG - Intergenic
1012632303 6:101486373-101486395 TTGCATGAGGGGGTGGGGCGGGG + Intronic
1012830210 6:104195219-104195241 TTATACCATGGGGTGGGGGGAGG - Intergenic
1013361379 6:109396683-109396705 TTGTAGAAGGGGTTTGGGGGAGG - Intronic
1013579368 6:111517995-111518017 CTCTATATGGTGGTGGGGGGAGG - Intergenic
1014001227 6:116368912-116368934 TACTGTAATGGGGTGGGCGGGGG + Intronic
1014687897 6:124526499-124526521 TTCTATCTGAGGGTGGGGGTTGG - Intronic
1014888242 6:126808831-126808853 TCCTGGAGGGGGGTGGGGGGTGG - Intergenic
1015233753 6:130947019-130947041 TAATTTAAGGGGCTGGGGGGGGG - Intronic
1015502990 6:133952751-133952773 TTATATAATGGGGGGTGGGGAGG + Intronic
1015816660 6:137218591-137218613 TTCTTAGCGGGGGTGGGGGGGGG - Intronic
1016491880 6:144614189-144614211 TTCTAAAAGGTGCTGTGGGGAGG + Intronic
1017886361 6:158602999-158603021 TCTTAAAAGGGGGTGGGGAGAGG - Intronic
1019759804 7:2802388-2802410 TTTTTTGGGGGGGTGGGGGGTGG + Intronic
1020835802 7:13148821-13148843 TTTTTTTTGGGGGTGGGGGGCGG - Intergenic
1021311420 7:19102520-19102542 TTCTATCATGGGCAGGGGGGCGG - Intronic
1021579219 7:22134723-22134745 TTCAATTAGAGGGTGGGAGGTGG - Intronic
1022103187 7:27181077-27181099 TTTTTTGGGGGGGTGGGGGGAGG + Intergenic
1022978757 7:35582700-35582722 GTCTTTAAGAGGGTGGAGGGTGG - Intergenic
1023663095 7:42490872-42490894 TTATTTATGGGGGTGGGGAGAGG - Intergenic
1023821763 7:43984558-43984580 TTCTAGATGAGGGTGGGGGCGGG - Intergenic
1026376784 7:69759773-69759795 TTATATGGGGGGGGGGGGGGGGG - Intronic
1026376786 7:69759775-69759797 CTTTATATGGGGGGGGGGGGGGG - Intronic
1026439970 7:70435663-70435685 TTTTGTATGGGGGTTGGGGGAGG + Intronic
1027359859 7:77396508-77396530 TTTTAAAAGGTGGTGGGGAGGGG + Intronic
1028241558 7:88427229-88427251 GCCTATCATGGGGTGGGGGGAGG + Intergenic
1029229011 7:99050881-99050903 CTCTGTTATGGGGTGGGGGGGGG + Intronic
1029750026 7:102537977-102537999 TTCTAGATGAGGGTGGGGGCGGG - Intronic
1029767977 7:102637083-102637105 TTCTAGATGAGGGTGGGGGCGGG - Exonic
1030058663 7:105605464-105605486 TTCGATGAGGGTGGGGGGGGGGG + Exonic
1030521537 7:110603996-110604018 TTCTTTTGGGGGGCGGGGGGGGG - Intergenic
1031519728 7:122748867-122748889 AACAATAAGGGGGTGGGGGAGGG + Intronic
1031936510 7:127740670-127740692 ATTTCCAAGGGGGTGGGGGGTGG + Intronic
1032115247 7:129111185-129111207 TTCCATAACAGGGAGGGGGGAGG + Intergenic
1032218877 7:129978870-129978892 ATCTATGTGGGGGTGGGGGTGGG - Intergenic
1033306799 7:140231069-140231091 TTCAATCTGCGGGTGGGGGGAGG + Intergenic
1033364010 7:140657707-140657729 TTCTATAAGTAGGAGGGTGGAGG + Intronic
1034129743 7:148704157-148704179 TTTTCCACGGGGGTGGGGGGGGG - Intronic
1034763335 7:153694334-153694356 TTCCATCAGAGGGTGGAGGGTGG - Intergenic
1036513443 8:9421732-9421754 TTATATAAAGGGGTGGGATGAGG + Intergenic
1036799224 8:11777347-11777369 TTTTAAAAGGCGGTGGGGGTGGG - Intronic
1036917492 8:12818547-12818569 CTCTAGTTGGGGGTGGGGGGCGG + Intergenic
1037612376 8:20487040-20487062 GCCTGTCAGGGGGTGGGGGGGGG + Intergenic
1037693378 8:21202874-21202896 CTATAAAAGGGGGTGGGGCGTGG + Intergenic
1037759275 8:21731099-21731121 TTCTAGATGGGGGTGCTGGGAGG - Intronic
1037865945 8:22441850-22441872 TCCTAAAAAAGGGTGGGGGGCGG - Intronic
1038327173 8:26579957-26579979 TTTTTAAAGGGTGTGGGGGGGGG - Intronic
1038428308 8:27479670-27479692 TCCTCTAGGGTGGTGGGGGGAGG - Intronic
1038501596 8:28049239-28049261 CTCTATAAGGGGGTTGGTGGGGG - Intronic
1039642046 8:39234262-39234284 TTCTAATGGGGGGTGGGAGGGGG - Intronic
1039915019 8:41853654-41853676 TGTTATAAGGCGGTGGGGGTAGG - Intronic
1041338574 8:56815799-56815821 TTCTGTTGTGGGGTGGGGGGAGG + Intergenic
1041502543 8:58553847-58553869 TTTTGGAAGGGGGTGGGGAGAGG + Intronic
1041636144 8:60147083-60147105 CTCTATTGTGGGGTGGGGGGAGG + Intergenic
1042137514 8:65645693-65645715 CTCTACAAAGGGGGGGGGGGGGG - Intronic
1042141167 8:65680158-65680180 TTTTCTCAGGGGTTGGGGGGCGG + Intronic
1042660103 8:71144982-71145004 TTCTTCCAAGGGGTGGGGGGTGG - Intergenic
1042903176 8:73747497-73747519 TTCTAGACGGGGGAGGGGGCGGG + Intronic
1043122827 8:76350788-76350810 TACTTTAGTGGGGTGGGGGGAGG + Intergenic
1043508149 8:80923062-80923084 TTTTTTCCGGGGGTGGGGGGGGG + Intergenic
1043850288 8:85208586-85208608 TTTAATAAGCGGGTGGGGGAAGG - Intronic
1043909011 8:85839052-85839074 TTCTGCAAGGGGGTTGGGGGGGG - Intergenic
1046346102 8:112929219-112929241 TTCTCCCATGGGGTGGGGGGAGG + Intronic
1047710613 8:127548350-127548372 TTTTATTCGGGGGTGGGGGGAGG - Intergenic
1047983719 8:130211172-130211194 TTCTATAATGTGGAGGAGGGGGG + Intronic
1047989113 8:130267024-130267046 TTTTTTGAGGGGGTGGGTGGCGG - Intronic
1049057778 8:140252389-140252411 ATCTATAAGGAGGTGGAGTGTGG - Intronic
1050530853 9:6588111-6588133 GTTTAAAAGGGGGTGGGGGTGGG + Intronic
1050631932 9:7568909-7568931 TTATTTAAGTGGGGGGGGGGGGG - Intergenic
1051128855 9:13836043-13836065 TTGAATCATGGGGTGGGGGGGGG + Intergenic
1051158539 9:14179319-14179341 CTTTAGAAGGGGGTTGGGGGTGG - Intronic
1051330858 9:16023838-16023860 ATCTTTGTGGGGGTGGGGGGAGG - Intronic
1051332718 9:16039854-16039876 GTGTGTAATGGGGTGGGGGGTGG + Intronic
1051851540 9:21515145-21515167 TTCTAAAAAGGGGTTGGGGTAGG + Intergenic
1051895103 9:21978116-21978138 TTATGTAGGGGGGAGGGGGGAGG + Intronic
1052817521 9:33112952-33112974 TGAAAGAAGGGGGTGGGGGGAGG + Exonic
1052885615 9:33644842-33644864 TACTCTATGGGGGGGGGGGGGGG + Intergenic
1053120003 9:35539203-35539225 TTCCAAAAGGGAGAGGGGGGCGG + Intronic
1053275602 9:36781015-36781037 TTCTTTCAGGTGGTGGGTGGAGG + Intergenic
1054853721 9:69875217-69875239 TTTTTTAAGGGGGTGAGGGAAGG + Intronic
1055030927 9:71770545-71770567 TTTTATAAGGGGAAAGGGGGTGG + Intronic
1055570360 9:77610230-77610252 TTCTATAGGGGAGAGGGAGGTGG - Intronic
1055682806 9:78735481-78735503 GCCTATAAGAGGGTGGAGGGTGG - Intergenic
1056102066 9:83309182-83309204 TGCTTTGTGGGGGTGGGGGGAGG + Intronic
1056456968 9:86769736-86769758 TTGTATAAGATTGTGGGGGGGGG + Intergenic
1056681515 9:88723098-88723120 TTTTATAAGGTGGCGGGGTGGGG - Intergenic
1056969525 9:91190918-91190940 TTGTAAAAGGGGCTGGGGGGTGG - Intergenic
1056996267 9:91462818-91462840 TTTTTTTTGGGGGTGGGGGGAGG + Intergenic
1057284172 9:93735683-93735705 TTCTATCAGAGAGTGGAGGGTGG + Intergenic
1057485075 9:95476417-95476439 TTTTAAAAGGGAGTGGAGGGAGG + Intronic
1057888617 9:98851069-98851091 TTAAAGAAGGGGGCGGGGGGCGG - Intergenic
1058549392 9:106097701-106097723 GCCTATTAGGGGGTGGAGGGTGG + Intergenic
1058741190 9:107944341-107944363 TTTAATACGGGGGGGGGGGGGGG - Intergenic
1058767303 9:108194335-108194357 TTATTTAAAGGGGTGGAGGGAGG - Intergenic
1059091431 9:111363111-111363133 GTCTATCAGTGGGTGGGGTGGGG - Intronic
1059148887 9:111929047-111929069 TTTTTTTGGGGGGTGGGGGGTGG - Intronic
1059386444 9:113968629-113968651 TTTTATTTGGGTGTGGGGGGAGG - Intronic
1060461645 9:123861133-123861155 TCCTGGAAGGGGGTTGGGGGAGG - Intronic
1060532227 9:124354665-124354687 TTCTTTAAGAGGGTGGGGGTCGG - Intronic
1060619424 9:125050263-125050285 TTAAATAAGGGGGTGGAGGTGGG + Intronic
1060681845 9:125573090-125573112 TTATAAAAGGGGGGGGGGGGGGG + Intronic
1061486567 9:130923450-130923472 TTCCAGCAGGGGGTGGGGCGGGG - Intronic
1061693900 9:132356496-132356518 TACTAAAAGGGGGTAGGGGCCGG - Intergenic
1062015667 9:134289878-134289900 TTCTAGAAGAGAGTGGGGTGGGG + Intergenic
1186123117 X:6384298-6384320 TTGTTTTATGGGGTGGGGGGCGG + Intergenic
1187166102 X:16805277-16805299 TTTAAAAAGGGGGTGGAGGGCGG - Intronic
1187444179 X:19345749-19345771 TACTGTAAGGTGGCGGGGGGGGG - Intronic
1188295535 X:28443337-28443359 AACTATAAGGGGGTGGTGGGGGG + Intergenic
1188396171 X:29686514-29686536 ATCTTTAGGGGGGTGGGGGGAGG - Intronic
1188403252 X:29774143-29774165 TTTTATGCGGGGGTGGGGAGGGG - Intronic
1189648758 X:43165126-43165148 TTCTATATGGGGGAGGGAGGGGG - Intergenic
1189696326 X:43666985-43667007 GTCTGTCATGGGGTGGGGGGCGG + Intronic
1189889307 X:45582480-45582502 TTCATTGGGGGGGTGGGGGGTGG - Intergenic
1190131745 X:47754297-47754319 TTCTGCAAGGTGGTGGGGTGGGG + Intergenic
1190624214 X:52320785-52320807 TTTTTTATGGGGGTGGGGGAGGG + Intergenic
1190828799 X:54042860-54042882 TGGTGCAAGGGGGTGGGGGGCGG - Intronic
1191114287 X:56835813-56835835 TTCTATAGTGGGGTGGAGGGAGG - Intergenic
1191670598 X:63745106-63745128 CACTCTGAGGGGGTGGGGGGTGG + Intronic
1191714561 X:64185445-64185467 CTGTATATGGGGGTGGGGGTGGG - Exonic
1192167095 X:68833064-68833086 CCCTACAAGGGGGTGGGGGTGGG + Intronic
1192428497 X:71097076-71097098 TTCCCAAAGGGGGTGGGGGTGGG - Intronic
1192487798 X:71545283-71545305 TTTTTTAAGGGGTTGGGGTGGGG - Intronic
1192532891 X:71904461-71904483 GACTATTATGGGGTGGGGGGAGG - Intergenic
1192859242 X:75048269-75048291 TACTCTAAGGGGGTGGGGGTAGG + Intergenic
1193629767 X:83869366-83869388 GTCTATCAGAGGGTGGAGGGTGG - Intronic
1193732806 X:85121711-85121733 TTCTATGTGGGGGTGGGGAATGG + Intergenic
1193754451 X:85390137-85390159 GTCTATCAGAGGGTGGAGGGTGG + Intergenic
1194101555 X:89711697-89711719 GTCTATCAGAGGGTGGAGGGTGG - Intergenic
1194763646 X:97824005-97824027 TTTTTTAAGGGGATGGGGGAGGG - Intergenic
1195660825 X:107376196-107376218 GCCTGTCAGGGGGTGGGGGGAGG - Intergenic
1195666208 X:107433518-107433540 GTCTGTCATGGGGTGGGGGGAGG - Intergenic
1195704913 X:107731859-107731881 TGCTAGATGGGGGTGGGGGGAGG + Intronic
1195963966 X:110413515-110413537 TTGAATGTGGGGGTGGGGGGGGG - Intronic
1195965766 X:110428756-110428778 TTCCATAGGGGAATGGGGGGAGG - Intronic
1195978309 X:110551638-110551660 GTCTGTTGGGGGGTGGGGGGCGG + Intergenic
1196072566 X:111542773-111542795 GTCCAGAAAGGGGTGGGGGGTGG + Intergenic
1196099539 X:111833070-111833092 CTCTATAAGGGGGCAGGGGCAGG - Intronic
1196335251 X:114524710-114524732 TTCTGTTGTGGGGTGGGGGGAGG + Intergenic
1197344545 X:125317112-125317134 TTCTATTACGGTGTGGGGGAAGG - Intergenic
1197702098 X:129607153-129607175 TTCTTTAAGGGAGAGGGGCGTGG + Intergenic
1198277213 X:135106402-135106424 TACTAGAAGGGGGAGGAGGGAGG - Intergenic
1199051755 X:143244189-143244211 TTCTGTTGTGGGGTGGGGGGAGG - Intergenic
1199175308 X:144781323-144781345 GCCTATCATGGGGTGGGGGGAGG + Intergenic
1199895457 X:152122456-152122478 TTTTATATCGGGGTGGGAGGTGG + Intergenic
1200161655 X:154012837-154012859 TTCAGGAATGGGGTGGGGGGAGG + Intronic
1200362861 X:155629155-155629177 GTCTGTCATGGGGTGGGGGGAGG - Intronic
1200454503 Y:3372783-3372805 GTCTATCAGAGGGTGGAGGGTGG - Intergenic
1200469368 Y:3563474-3563496 TTCTATCAAAGGGTGGAGGGTGG + Intergenic