ID: 950139890

View in Genome Browser
Species Human (GRCh38)
Location 3:10608196-10608218
Sequence CAGTGTGGATGGAGTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 874
Summary {0: 1, 1: 1, 2: 6, 3: 77, 4: 789}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950139890 Original CRISPR CAGTGTGGATGGAGTGAGGA GGG (reversed) Intronic
900190223 1:1349969-1349991 CAGGATGGGAGGAGTGAGGAGGG + Intergenic
900237106 1:1598138-1598160 CGGGGTGGCTGGGGTGAGGATGG + Exonic
900494229 1:2969194-2969216 CGGTCTGGATGGATGGAGGAAGG + Intergenic
901013067 1:6211831-6211853 CAGTGTGGATGCAGGGGGGTGGG - Intronic
901144098 1:7053625-7053647 CAGAGTGGAGTGAGGGAGGAAGG - Intronic
901316315 1:8311948-8311970 CACTATGGATGGTGTGAAGAGGG + Intergenic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
902318722 1:15644504-15644526 CAGTGTTGCTGTAGTGAGGCTGG + Intronic
902528264 1:17073610-17073632 GAGTGGGGAGGGAGAGAGGAGGG + Intronic
902961170 1:19963713-19963735 CAGAGTGGCTGGAGTGAAGCGGG - Intergenic
903215400 1:21840982-21841004 ATGAGTGGATGGAGAGAGGAAGG - Intronic
903289790 1:22302361-22302383 GAGGGTGGATGGTGGGAGGAGGG + Intergenic
903331712 1:22600058-22600080 AAGGGGGGATGGAGGGAGGAAGG + Intronic
904046537 1:27612633-27612655 GGGTGGGGATGGAGTGAGAAAGG + Exonic
904255258 1:29250652-29250674 CTGTGTTGATGGAGTCAAGAAGG + Intronic
904490404 1:30855341-30855363 GAGTGCGGTTGGAGTGAGGGAGG - Intergenic
904831218 1:33307696-33307718 AGGTGGGGATGGAGTGAGGTTGG - Intronic
905098653 1:35498568-35498590 CAGAGTGGAGGCAGGGAGGAAGG - Intronic
905453757 1:38073737-38073759 CAGGAAGGAGGGAGTGAGGAGGG + Intergenic
905467597 1:38167048-38167070 AGGTGGGAATGGAGTGAGGAGGG + Intergenic
906449644 1:45934061-45934083 CAGGGTGGAGGGTGGGAGGAGGG - Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907574246 1:55511637-55511659 CAGTTAGGATGCAGTGAGGCAGG + Intergenic
908000145 1:59671522-59671544 CAGAGTAGGTGGAGGGAGGAAGG + Intronic
908757117 1:67479311-67479333 CAGTGAGAGTGGAGTGAGGGAGG + Intergenic
909669175 1:78168884-78168906 CACTGTGTATTGAGAGAGGAAGG - Intergenic
910050030 1:82962532-82962554 TAGTGTTGATGGCGTGAGGGAGG + Intergenic
910575488 1:88758521-88758543 GAGTGTGGAGGGTGGGAGGAGGG - Intronic
910788407 1:91025229-91025251 GAGGGTGGATGGTGGGAGGAGGG - Intergenic
911124887 1:94332194-94332216 GAGGGTGGATGGTGGGAGGAGGG + Intergenic
911141125 1:94503677-94503699 CTGTTTGCATGAAGTGAGGAAGG - Intronic
911571531 1:99523351-99523373 CAGGGTGGAGGGTGGGAGGAAGG - Intergenic
911825152 1:102474028-102474050 CAGTGGGGATAGAGAGAGGAAGG - Intergenic
912960593 1:114192170-114192192 CAGTGTGGGTGGAGAGAGAGCGG + Intergenic
913265512 1:117039292-117039314 AGGTGGGGTTGGAGTGAGGATGG + Intergenic
913397654 1:118389747-118389769 TAGTGTGGCTGGAGTTATGAAGG - Intergenic
913713341 1:121509675-121509697 GAGTGTGGAGGGTGGGAGGAAGG + Intergenic
914340547 1:146756226-146756248 CAGGGTGTATGGGGTGGGGAGGG - Intergenic
914806312 1:150994752-150994774 CTGTGTGCAGGGAGTGAGGGTGG - Intronic
915113303 1:153578575-153578597 CAGTGTGGCTGGAGCATGGATGG + Intergenic
915744994 1:158149186-158149208 CAGTGTGGATGGAGAAAAGTGGG + Intergenic
915943437 1:160133493-160133515 CAGAGTGAATGGAGTTGGGATGG - Intronic
916001592 1:160621645-160621667 CAGTGTGTATGTGGTGAGCATGG + Intronic
916214639 1:162384598-162384620 CAGGGAGAAGGGAGTGAGGATGG + Intronic
916751537 1:167727249-167727271 CAGTGTGGATGCAAAGTGGATGG - Intronic
916826668 1:168448464-168448486 CAGTATGGATAGAGTGGAGAGGG - Intergenic
916996051 1:170302427-170302449 CAGTGGTTATAGAGTGAGGAAGG - Intergenic
917002040 1:170370986-170371008 CAGGGTGGGGGGAGGGAGGAGGG - Intergenic
917043530 1:170832304-170832326 AAGTGTGGATGCAGTGAAAAGGG - Intergenic
917050455 1:170916601-170916623 AAGCATGGATGGAGTGAGTATGG + Intergenic
917261037 1:173169753-173169775 CAGTGGGGATGAAGAGAGGTTGG + Intergenic
918135695 1:181672234-181672256 GAGTGTGGAGGGTGGGAGGAGGG + Intronic
918928271 1:190816076-190816098 GAGTGTGGAGGGTGGGAGGAGGG + Intergenic
919493467 1:198234846-198234868 CAGTGTGAATGCAGAGAGGAGGG - Intronic
920109238 1:203575463-203575485 GAGTGAGGGTGGGGTGAGGATGG - Intergenic
920544934 1:206808591-206808613 CAGAGTAAATGGAGTGAGGTGGG + Intronic
920595776 1:207268488-207268510 AAGGGTGGATGCAGTGAGAAGGG + Intergenic
920768693 1:208858952-208858974 CAGTGTGGTTGGAGTAAAGTGGG + Intergenic
923323155 1:232856563-232856585 CAGTGGGGAGGGAGTGTCGATGG - Intergenic
923520879 1:234734282-234734304 TAGAGTGGATGGAGAGAGGTGGG + Intergenic
923953610 1:238989350-238989372 CATTGTAGATGGGGTGAGTAGGG + Intergenic
924603679 1:245513887-245513909 CAGTGTAGATGAAATGAGGGAGG - Intronic
1063168783 10:3487258-3487280 CATGGTGGAAGGAGTGAGGAAGG - Intergenic
1063473760 10:6310179-6310201 CAGGGAGGATGTAGTGAGAATGG - Intergenic
1063561807 10:7135191-7135213 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
1063962651 10:11319664-11319686 GAGTGTGAATGGCGTGAGAATGG - Intronic
1064171564 10:13038206-13038228 GAGGGTGGAGGGTGTGAGGAGGG + Intronic
1064814139 10:19237287-19237309 CAGTGAGGAAGAAGTGGGGAGGG - Intronic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065028064 10:21557755-21557777 CTCTGTGGCTGGAGTGGGGAGGG + Intronic
1065827688 10:29586891-29586913 CAGGGTGGAGGGTGGGAGGAGGG + Intronic
1066981717 10:42422744-42422766 CAGAGTGGAGGCAGTGAAGAGGG - Intergenic
1067684061 10:48456820-48456842 CAGTGGGGAAGGAGGGAGGGAGG - Intronic
1067913788 10:50374730-50374752 CAGAGTGGTTGAAGTGAGAATGG - Intronic
1068031287 10:51708527-51708549 CAGCGAAGAGGGAGTGAGGAAGG - Intronic
1068068905 10:52170552-52170574 GAGTGTCGATGGAGTGGAGAGGG - Intronic
1068077481 10:52274814-52274836 TGGTGTGGATGGAGTGAACAGGG - Intronic
1068470835 10:57460850-57460872 CAGTGTGGATTGAGGCAGTAGGG + Intergenic
1068573683 10:58659558-58659580 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1068618635 10:59151796-59151818 CACACAGGATGGAGTGAGGATGG + Intergenic
1069964381 10:72101985-72102007 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1070655427 10:78267838-78267860 CTGTGTGAGTGGAGTGGGGAAGG + Intergenic
1070679600 10:78439340-78439362 GAGTGTGGTGGGAGTGGGGAGGG + Intergenic
1070837942 10:79462847-79462869 CAGTTTGGGAGGAGTGAGGGAGG + Intergenic
1070941415 10:80351488-80351510 CAGTGTGGATGGAGTGGTGGGGG - Intronic
1071048570 10:81416756-81416778 CGGGGTGGAGGGAGTGGGGAGGG - Intergenic
1071676656 10:87661170-87661192 AAGTGGGGAAGGAGTGTGGAGGG + Intronic
1072624792 10:97104305-97104327 CAGGGTCGCTGGAGTGAGAAAGG + Intronic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1073357789 10:102870708-102870730 CAGTGCTGATGGAGTGAGGAAGG - Intronic
1074313846 10:112344533-112344555 CAGTTTGGAAGGGGTGAGGAGGG + Intergenic
1074430128 10:113387274-113387296 TGGTGGGGATGGGGTGAGGAGGG - Intergenic
1075050300 10:119178553-119178575 CCGCGAGGATGGAGTGGGGAAGG + Intronic
1075068851 10:119307777-119307799 CAGTGTGTATGCAGAAAGGAGGG - Intronic
1075797995 10:125134839-125134861 CAGGGTAGGTGGAGTGGGGAGGG - Intronic
1075840549 10:125498717-125498739 CAGGGTGGAGGGTGGGAGGAGGG - Intergenic
1076057465 10:127387216-127387238 CAGTGTGGCTGGAATGCAGAGGG - Intronic
1076273703 10:129178487-129178509 CAGTGTGGAGGGGGTGCAGAGGG - Intergenic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076732113 10:132444227-132444249 GAGCGGGGAGGGAGTGAGGAGGG - Intergenic
1076876209 10:133217100-133217122 CAGTGTGGATGTAGTTAACACGG + Intronic
1076980847 11:203943-203965 CTGTGTGGAAGGAAGGAGGAGGG + Exonic
1077315947 11:1919419-1919441 CATTCTGGATGGGCTGAGGAGGG - Intergenic
1077346538 11:2060073-2060095 AATTGTGTATGGAGTGAGTATGG - Intergenic
1077731176 11:4731553-4731575 CAGTGTGGAAGGAGAGGGTAAGG - Intronic
1077898963 11:6474555-6474577 CAGTGTCTTTGGTGTGAGGAAGG - Intergenic
1078501504 11:11883679-11883701 CAGTCTGGAGTGAGTGAGTAGGG + Intronic
1078759480 11:14240739-14240761 CAATGTGGGTGGAGTGAAGGTGG - Intronic
1078895074 11:15590837-15590859 CAGTGTGGCTGGAGTGGGTAGGG - Intergenic
1078991058 11:16647019-16647041 TGGTGTGGATGCAGTGAGAAGGG - Intronic
1080826923 11:35856311-35856333 TAGGATGGATGGAGGGAGGATGG + Intergenic
1081015188 11:37869380-37869402 CAGAGTGGAAGGAGTGATGGTGG - Intergenic
1081662405 11:44896114-44896136 CTGGGTGGATTGAGGGAGGAAGG + Intronic
1082755337 11:57069608-57069630 CAGTGTGGAGGGTTAGAGGAGGG + Intergenic
1082774196 11:57233450-57233472 AAGTGAGGAGGGAGAGAGGATGG - Intergenic
1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG + Intronic
1083343196 11:61972135-61972157 CACTGTGGAGGGAGGGAGGGAGG + Intergenic
1083623198 11:64059032-64059054 CTCTTTGGATGGAGTGAGGATGG + Intronic
1083764641 11:64836050-64836072 CAGTGTGCCTGGAGGGAGCATGG - Intronic
1083830115 11:65226027-65226049 CAGTGTGTCTGGGGTGAGGTGGG + Intergenic
1083835821 11:65266599-65266621 CAGTATGGACAGAATGAGGAGGG + Exonic
1084458007 11:69279547-69279569 GAGTGTGGATGGATTGATGGTGG - Intergenic
1084458018 11:69279619-69279641 GAGTGTGGATGGATTGATGGTGG - Intergenic
1084458044 11:69279762-69279784 GAGTGTGGATGGATTGATGGTGG - Intergenic
1084458063 11:69279904-69279926 GAGTGTGGATGGATTGATGGTGG - Intergenic
1084458095 11:69280116-69280138 GAGTGTGGATGGATTGATGGTGG - Intergenic
1084556426 11:69878860-69878882 GTGTGTTGGTGGAGTGAGGATGG - Intergenic
1084579084 11:70011251-70011273 GAGTTTGGCTGGAGTGAGCAGGG + Intergenic
1085004619 11:73074929-73074951 CAGTGGGGAGGGAGGGAGGCAGG + Intronic
1085065899 11:73495437-73495459 CAGTGGTGATGGAGTGGTGATGG - Intronic
1085400676 11:76233861-76233883 GAGTGTTCACGGAGTGAGGAGGG + Intergenic
1086017741 11:82187443-82187465 CAGGGTGGAGGGTGGGAGGAGGG - Intergenic
1086259166 11:84916795-84916817 CAGTGTGGCTGAAGAGAGAAAGG - Intronic
1086931332 11:92696264-92696286 CAGTGTGGAGGTGGAGAGGAGGG + Intronic
1087552830 11:99673587-99673609 GAGAGTGGATGGTGGGAGGAGGG - Intronic
1087642027 11:100765287-100765309 CAGTTTGGATTGAGTGTGTAGGG - Intronic
1088524400 11:110737489-110737511 AAGTGTGTATGCAGTGGGGAAGG - Intergenic
1088949504 11:114553043-114553065 CAGTGTTGGTGCAGTGAGGGAGG - Intronic
1089196975 11:116699592-116699614 CAGAGTGGAGGGGGTGAGAAAGG - Intergenic
1089269925 11:117295088-117295110 CAGTGTGCATAGAGTGTGTAGGG + Intronic
1089420435 11:118329107-118329129 CAGGGTGGAGGGTGGGAGGAGGG + Intergenic
1089455797 11:118625117-118625139 AAGTGTGGCTGAAGTGAGCAAGG - Intronic
1089569287 11:119392658-119392680 TGGTGTGGATGCAGTGATGAGGG - Intergenic
1089652919 11:119926379-119926401 CAGGGTGGATGGAGTAGGGCTGG - Intergenic
1089751208 11:120652517-120652539 CAGCCTGGATGGAGTGTGCAGGG - Intronic
1090263163 11:125337201-125337223 CAGTGTGAATGGCCTGTGGAAGG + Intronic
1090547680 11:127783154-127783176 CAGTATGGATGCAGTGGGGAGGG + Intergenic
1090777160 11:129975671-129975693 CAGTGTGGCTGGGCAGAGGAAGG - Intronic
1090974640 11:131671025-131671047 AAGGGAGGATGGAGTGAGAAAGG - Intronic
1091168510 11:133501099-133501121 CAGTGTGGGTGGTGGGAGCAGGG - Intronic
1091222789 11:133939109-133939131 CAGTGTGGTTGGAGTGCGCTGGG - Intronic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092529379 12:9331883-9331905 CAGTGTGGCTGCAGGGAGGCTGG + Intergenic
1092927781 12:13287812-13287834 CAATGTGGATGGAGTGAGTGAGG + Intergenic
1092977634 12:13760737-13760759 AAATGTGGAAGGAGTGAAGATGG - Intronic
1093019641 12:14191462-14191484 GAGTTTGGAGGGAGGGAGGAGGG + Intergenic
1093167175 12:15817503-15817525 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1095375299 12:41520078-41520100 CAGTGTGGAGGAAGAGAAGAGGG - Intronic
1095555857 12:43503710-43503732 GAGGGTGGATGGTGGGAGGAGGG - Intronic
1096124169 12:49107503-49107525 CAGTGTGCATGGAGGTAGGAGGG - Intronic
1096411862 12:51382798-51382820 CAGTGTGGATGGAAGAGGGAGGG + Intronic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1096696947 12:53355331-53355353 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
1096910812 12:54981973-54981995 CAGTGTGGGAGGAGAGAAGAAGG + Intronic
1096924541 12:55128958-55128980 CAGGGTGGAAGGTGGGAGGAGGG + Intergenic
1097145388 12:56936191-56936213 CTGTGTGCATGGGGTGGGGATGG - Intergenic
1097338140 12:58407650-58407672 CAGGGTGGAGGGTGGGAGGAGGG - Intergenic
1097349734 12:58535755-58535777 CAGTCTGGAAAGAGAGAGGAAGG - Intergenic
1097996433 12:65892740-65892762 CAGGATGAATGGATTGAGGACGG - Intronic
1098204405 12:68092852-68092874 CAGTGTTGAGGGGCTGAGGATGG + Intergenic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098731801 12:74044770-74044792 CAGTGTGGATGTGGTGAAAAGGG + Intergenic
1099265868 12:80447040-80447062 CAGTGTGGATGCAGAGAAAAGGG - Intronic
1099289367 12:80756455-80756477 AAGTGTGTATGGATTGAGAATGG - Intergenic
1100003054 12:89860519-89860541 GCCTGGGGATGGAGTGAGGAAGG + Intergenic
1100209030 12:92381941-92381963 GAGGGGGGATGGAGGGAGGAAGG + Intergenic
1100815034 12:98378678-98378700 CAGTGTGGGTGAAGTGAAGTGGG - Intergenic
1100916333 12:99427771-99427793 CAGTGAAGATGGGGTGAGAAAGG + Intronic
1101576517 12:106002037-106002059 CAGGGTGGTTGGAGTGAGCAAGG + Intergenic
1101623694 12:106417309-106417331 CAGTGTGGCTGGAGTGAGTGAGG + Intronic
1103415003 12:120737758-120737780 GGGTGTGGAGGGAGTGAGGCTGG + Intronic
1103991135 12:124800201-124800223 CAGCGTTGAGGAAGTGAGGATGG + Exonic
1104064711 12:125297196-125297218 CAGGGTGGATGGGAGGAGGAGGG + Intronic
1104274965 12:127318308-127318330 CTGTGGGGATGCAGTGAGGATGG - Intergenic
1104371598 12:128228508-128228530 CAGTGTGGTAGGAGTGAGGGAGG + Intergenic
1104437488 12:128767385-128767407 CAGGGGGGAGGGAGGGAGGAAGG + Intergenic
1104460718 12:128953661-128953683 TTGTGTGTGTGGAGTGAGGAAGG + Intronic
1104546069 12:129714057-129714079 CAGTGTGGTTGGAGGGAGGTAGG - Intronic
1104657951 12:130587958-130587980 CTGTGTGGAGGGACAGAGGAAGG - Intronic
1104984091 12:132586987-132587009 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984097 12:132587010-132587032 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984115 12:132587074-132587096 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984132 12:132587143-132587165 CAGTGCGGCTGGAGGGTGGACGG + Intergenic
1104984154 12:132587231-132587253 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984177 12:132587341-132587363 CAGTGCAGCTGGAGGGAGGACGG + Intergenic
1104984188 12:132587387-132587409 CAGTGCAGCTGGAGGGAGGACGG + Intergenic
1104984198 12:132587433-132587455 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984204 12:132587456-132587478 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104991300 12:132625242-132625264 CAGGATGGAGGGAGTGAGCAGGG - Intronic
1105247872 13:18668637-18668659 CAGGGAGGATGTAGTGAGAATGG - Intergenic
1105844435 13:24282093-24282115 CAGTGTGGCTGAAGTGATGAGGG + Intronic
1106413596 13:29527791-29527813 CAGGGTGGCTGGTGTGAGGGTGG - Intronic
1107747340 13:43524484-43524506 CAGGGTGGAGGGCGTGAGGAGGG - Intronic
1107804980 13:44145267-44145289 TAGTGGGAAAGGAGTGAGGATGG + Intronic
1107843210 13:44481641-44481663 CAGGGTGGGTGGAGTTAGGTGGG - Intronic
1108955986 13:56157425-56157447 CAGGGAGGATGGAGGGAGGGGGG + Intergenic
1109233732 13:59790560-59790582 CACTGTGGAAGGAATAAGGAAGG - Intronic
1109645779 13:65253040-65253062 GAGAGTGGATGGTGGGAGGAGGG - Intergenic
1109915562 13:68981101-68981123 GAGTGTGGAGGGTGGGAGGAGGG + Intergenic
1110425035 13:75357481-75357503 CAGTGTGGCTGGAGTTGGGGAGG - Intronic
1110523324 13:76506240-76506262 GAGGGTGGAGGGAGGGAGGAGGG + Intergenic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1113939792 13:114012656-114012678 CAGTGTGTGGGGAGTGTGGAAGG - Intronic
1114538349 14:23437038-23437060 CAGCTTGGAAGGAGTGAGGCAGG + Intergenic
1115084224 14:29493950-29493972 CAGTGTGTATGAAATGAGCATGG - Intergenic
1115459997 14:33649879-33649901 CAGAGTGGTTGTAGTGTGGAAGG + Intronic
1115507022 14:34102519-34102541 CAGGCTGGATGGAGCAAGGAGGG - Intronic
1115682137 14:35752612-35752634 CAGTCTGAGAGGAGTGAGGAGGG + Intronic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1116252937 14:42509987-42510009 GAGGGTGGAAGGAGGGAGGAGGG + Intergenic
1116303780 14:43221692-43221714 CAGTAGGGATGGTGGGAGGAGGG - Intergenic
1116890654 14:50264727-50264749 AAGTGGGGAGGGAGGGAGGAAGG + Intronic
1117539937 14:56737177-56737199 CAGTATGGTTGGAGTGTGGCAGG - Intergenic
1117548947 14:56814806-56814828 GAATGTGGATGGATTGATGAAGG + Intergenic
1117604684 14:57415797-57415819 CAGTTTGGAGGGAGGGAGGGAGG - Exonic
1117721080 14:58629567-58629589 CAGTGTTGATCAAGTGGGGAGGG + Intergenic
1118351701 14:64976810-64976832 CAGTGTGGCTGGGGTGGGGATGG - Intronic
1118765722 14:68908175-68908197 CAGTGTGTATGGGGTGGGGGTGG + Intronic
1119714261 14:76847537-76847559 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1119715346 14:76855082-76855104 CAGTGAGGAGACAGTGAGGAAGG + Intronic
1120452203 14:84682693-84682715 CAGTGTGGAAGGTGGGAGGAGGG - Intergenic
1121489912 14:94350402-94350424 GATTGAGGATGGATTGAGGATGG + Intergenic
1121859048 14:97299340-97299362 CAATGGGGATGGAGAGAGAAGGG - Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122329112 14:100901133-100901155 CAATGAGGCTGCAGTGAGGATGG + Intergenic
1122529439 14:102415557-102415579 GCGTGGGGATGGGGTGAGGAGGG + Intronic
1122596713 14:102898904-102898926 AAGTGAGGATGGAGTGGTGACGG + Intronic
1123217859 14:106828795-106828817 GAGTGTGGAGGGTGGGAGGAGGG + Intergenic
1123814007 15:23958093-23958115 CAGGGTGGAAGGTGGGAGGAGGG - Intergenic
1123979260 15:25584590-25584612 GAGAGTGGAGGGAGGGAGGAGGG - Intergenic
1124235163 15:27983821-27983843 CAGTGTGGAGGCAGTGCGGATGG + Intronic
1124371450 15:29106860-29106882 AAGTGGGGATGAAGTGAGGCAGG - Intronic
1124997262 15:34735911-34735933 CTGTGTGGATGGAGTTGGCAAGG - Intergenic
1125973949 15:43934874-43934896 CAGTCTGGCTGGGGTGAGGGTGG + Intronic
1126590107 15:50330569-50330591 AAGTGTGTATGGGATGAGGAAGG - Intronic
1127440135 15:58998391-58998413 GAGTGTGGAGGGTGGGAGGAGGG - Intronic
1127608234 15:60611750-60611772 CAGTGATGAAAGAGTGAGGATGG - Intronic
1127659292 15:61085028-61085050 AAGGGGGGAGGGAGTGAGGAGGG - Intronic
1127679724 15:61281666-61281688 AAGGGTGGATGGTGGGAGGATGG + Intergenic
1128336807 15:66791937-66791959 CAGTGGGGAGGGATTGAGGCTGG - Intergenic
1128550630 15:68595998-68596020 CAGTGAGGTTTGAGTGTGGAGGG + Intronic
1128726630 15:69992705-69992727 CAGGCTGGAGTGAGTGAGGAGGG - Intergenic
1128762639 15:70227925-70227947 CAGTGTGGAGGGTGGGAGGAGGG - Intergenic
1129491325 15:75928582-75928604 GAGGGTGGAGGGTGTGAGGAAGG + Intronic
1130468289 15:84203721-84203743 CAGTGTGTGTGGGGTGGGGAGGG + Intergenic
1130485460 15:84396021-84396043 CAGTGTGTGTGGGGTGGGGAGGG - Intergenic
1130495977 15:84469821-84469843 CAGTGTGTGTGGGGTGGGGAGGG - Intergenic
1130590582 15:85208319-85208341 CAGTGTGTGTGGGGTGGGGAGGG + Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1130939851 15:88498315-88498337 CAGGGTTGAAGGAGTGAGGAGGG + Intergenic
1131361181 15:91792068-91792090 CAAAGGGGATGGAGGGAGGAGGG - Intergenic
1132120245 15:99169579-99169601 CAGTGAGCAGGGAGTGGGGAGGG + Intronic
1132307285 15:100825619-100825641 CATTGTGGTGGAAGTGAGGAAGG + Intergenic
1132357324 15:101181580-101181602 CAGTGGGGCTGGAGAGAGAAGGG - Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133129347 16:3667002-3667024 CACTGGGGATGGAGTGTGGGAGG - Intronic
1133413635 16:5589071-5589093 CAGTGGGTATGGAGTGGGGTGGG + Intergenic
1133772938 16:8878248-8878270 CAATGTGGCTGGAGTAGGGAGGG + Intergenic
1133812814 16:9174301-9174323 CAATGAGGATGGATGGAGGAAGG + Intergenic
1133833546 16:9346532-9346554 GACTGGGGATGGAGTGGGGATGG - Intergenic
1133838756 16:9389487-9389509 AAGTATGGATGGTGGGAGGAGGG - Intergenic
1134310173 16:13068529-13068551 GAGTTTAGATGGAGAGAGGATGG + Intronic
1134349937 16:13427658-13427680 CAGTGTGGCTGGAGAGAGAGAGG + Intergenic
1134426138 16:14147583-14147605 CAGTGTGTTTGGAGCGAGGGAGG + Intronic
1135181809 16:20281400-20281422 CATTTGGGATGGAGTGGGGAGGG + Intergenic
1135523546 16:23196132-23196154 CAGAGTGGCTGGGGTCAGGATGG + Intronic
1135774140 16:25241585-25241607 TAGTCTGGATGGAGGGAGCAGGG - Intronic
1136041095 16:27579570-27579592 AAGTCTGGCTGGAGTGAGGGAGG - Intronic
1136560576 16:31036866-31036888 CAGTGTGGATGGGCAGAGGAAGG + Intronic
1137225244 16:46498769-46498791 TAGTGGGAATGGAGTGAGTAGGG - Intergenic
1137638790 16:50010361-50010383 CACTGTGTTTGGAGGGAGGATGG + Intergenic
1139139689 16:64246202-64246224 AAGTGTGGAGGGAGGAAGGAGGG + Intergenic
1139853920 16:69965872-69965894 CAGAGGGGAGGGAGTGAGGGCGG - Intergenic
1139882898 16:70188785-70188807 CAGAGGGGAGGGAGTGAGGGCGG - Intergenic
1139993738 16:70961180-70961202 CAGGGTGTATGGGGTGGGGAGGG + Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140369611 16:74406734-74406756 CAGAGGGGAGGGAGTGAGGGCGG + Intergenic
1140372035 16:74419232-74419254 CAGAGTGGATGCAGGGAGGGGGG + Intronic
1141011429 16:80404012-80404034 CAGTGGGGAGGGAGTGAACAAGG - Intergenic
1141028876 16:80570936-80570958 GAGTGTGGATGGAGGGAGAGTGG - Intergenic
1141178006 16:81733412-81733434 AAGGGTGGATGGAGAGAGGATGG - Intergenic
1141198657 16:81880699-81880721 GACTGTGGAGGGAATGAGGAGGG + Intronic
1141787669 16:86212746-86212768 CAGTCTGTGTGGTGTGAGGAAGG - Intergenic
1141831807 16:86513268-86513290 CAATTTTGAAGGAGTGAGGAAGG - Exonic
1141881713 16:86864575-86864597 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
1141980629 16:87547849-87547871 CAGGGTGTTTGGAGTGAGCATGG + Intergenic
1141993316 16:87622363-87622385 GAGAGTGGCTGGAGTGAGAACGG + Intronic
1142106699 16:88308005-88308027 CATTGTGTATGGTGTGAGGTAGG + Intergenic
1142431119 16:90027939-90027961 CAGGGTGGTAGGAGTGTGGAAGG + Intronic
1142475591 17:187223-187245 CAGTGTGGAGGGAGAGAGCCTGG - Intergenic
1142740198 17:1927403-1927425 TGGTGTGGAGTGAGTGAGGAAGG + Intergenic
1143055450 17:4158752-4158774 AAGGGAGGATGGAGTGTGGACGG - Intronic
1143370718 17:6437301-6437323 CCGTGTGGCTGGAGAAAGGATGG - Intergenic
1143462069 17:7110194-7110216 GAGTGTGGCTGCAGTGGGGAAGG - Intronic
1143863793 17:9909543-9909565 TGGAGTGGAGGGAGTGAGGAGGG - Intergenic
1143919557 17:10320080-10320102 CAAGGGGGAAGGAGTGAGGAGGG + Intronic
1143952969 17:10648159-10648181 CTGTGTGGTTGTAGGGAGGAGGG - Intronic
1143983316 17:10889737-10889759 TAGTGTGGAGGGTGGGAGGAGGG - Intergenic
1144097737 17:11917081-11917103 AAGCGGGGATGGAGTGGGGAAGG + Intronic
1144328302 17:14202838-14202860 CATGGAGGCTGGAGTGAGGAAGG - Intronic
1144564309 17:16347340-16347362 CAGTGGCTATGGAGTGAGCAAGG - Intronic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1144754235 17:17669714-17669736 AAGGGAGGATGGAGGGAGGAGGG - Intergenic
1144771559 17:17762372-17762394 CAGTGTGGTTGGAGTGTGCATGG + Intronic
1144836195 17:18157908-18157930 CAGTGTGGGTGGGGTGGGGCGGG + Intronic
1145325703 17:21822513-21822535 CAGTGTTGGTGCAGTGAGGGAGG - Intergenic
1145983355 17:29027562-29027584 AAGTGTGGATGGTGAGAGGGTGG + Intronic
1146482828 17:33218800-33218822 GAGAGTGGAAGGAGTGAGGAGGG - Intronic
1146532177 17:33617498-33617520 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1146696370 17:34911679-34911701 CAGTGTGGCTGGAGAGAGTTGGG + Intergenic
1146798367 17:35798900-35798922 CACTTTGGATGGGGTGGGGAGGG + Intronic
1146798374 17:35798937-35798959 CTGTGTGGATGCTGGGAGGATGG + Intronic
1146884741 17:36463625-36463647 CATTGAGGGTGGAGGGAGGAAGG + Intergenic
1146959791 17:36964302-36964324 GAGTGGGGATGGAGTGGAGATGG + Intronic
1147350696 17:39840867-39840889 CAGTGTGAATGAGGTAAGGAGGG + Intronic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1147495575 17:40912059-40912081 CAGTGTGGATGGGTGGAAGAGGG + Intergenic
1147589058 17:41669545-41669567 TGGTGTGGCTGGAGTGGGGACGG + Intergenic
1148980160 17:51566756-51566778 CAGTGTGGACGAAGGCAGGAAGG + Intergenic
1149090457 17:52772119-52772141 GAGAGTAGATGGAGGGAGGAAGG + Intergenic
1149294452 17:55249334-55249356 GAGTGGGGAAGGAATGAGGAAGG - Intergenic
1150179645 17:63103335-63103357 CAGTCTGGAGGGAGTAAGAATGG + Intronic
1151201768 17:72473080-72473102 TAGTGTGGATGTAGTGAACAGGG + Intergenic
1151471158 17:74318700-74318722 CAGTGTGACCGGAGTGAGTAAGG + Intergenic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152227447 17:79098955-79098977 CAGACTGGAGGCAGTGAGGACGG + Intronic
1153101322 18:1473219-1473241 GAGTGGGGAGGGAGAGAGGAAGG + Intergenic
1153329152 18:3855280-3855302 GAGGGTGGAGGGAGGGAGGAAGG + Intronic
1153359511 18:4177608-4177630 GAGGGTGGATGGAGGGAGGAAGG - Intronic
1153871368 18:9323417-9323439 CAGTGTGTATTGGGGGAGGAGGG - Intergenic
1153971817 18:10234060-10234082 CAGTGTGGCCTGAGTCAGGATGG - Intergenic
1154057994 18:11030122-11030144 CTTTGTGGCTGGAATGAGGATGG - Intronic
1154158374 18:11960966-11960988 CTGTGAGGGTGGAGAGAGGAGGG + Intergenic
1154181580 18:12143763-12143785 CAGTGAGGATGGCGTGTGGCTGG - Intergenic
1154182324 18:12147821-12147843 CAGTGAGGATGGCGTGTGGCTGG + Intergenic
1154440977 18:14390497-14390519 CAGGGAGGATGTAGTGAGAATGG + Intergenic
1155361662 18:25009334-25009356 TAGTGTGGATGCAGTGAAAAGGG + Intergenic
1155709098 18:28853535-28853557 GAGTGTGGAGGGTGGGAGGAGGG + Intergenic
1155770053 18:29685115-29685137 GAGTGTGGAGGGTGAGAGGAGGG + Intergenic
1156178735 18:34578100-34578122 TGGTGTGGATGCAGTGAAGAGGG - Intronic
1157513184 18:48293257-48293279 TTGTGTGCATGCAGTGAGGAAGG - Intronic
1157563864 18:48666745-48666767 CAGGGTGGATGGGGTAAGGTAGG - Intronic
1157784698 18:50471057-50471079 CAGGGTAGCTGGAGTGAGGATGG - Intergenic
1158294883 18:55984796-55984818 GAGGGTGGATGGTGGGAGGAAGG + Intergenic
1158392233 18:57053029-57053051 CAGTATGGCTGGAGTGTGCATGG - Intergenic
1159678364 18:71314860-71314882 CAGTGTGTAGGGTGGGAGGAGGG + Intergenic
1159914036 18:74173163-74173185 CAGTGAGGATGGGACGAGGAGGG + Intergenic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1161033475 19:2071092-2071114 CGAGGTGGATGGAGTGAGGGTGG + Exonic
1161198876 19:3003215-3003237 CAGGGAGGAGGGAGAGAGGAGGG + Intronic
1161426936 19:4208829-4208851 TAGTGTGGATGCAGGGAGGAGGG - Intronic
1161531986 19:4795266-4795288 CAGGGAGGATGCAGTGAGAATGG - Exonic
1161635007 19:5382706-5382728 CAGTGAGGAAAGAGAGAGGAAGG - Intergenic
1161649419 19:5475118-5475140 CAGTGTGGCTGGAGTGAGCTGGG + Intergenic
1162312620 19:9915954-9915976 CAGTGTAGTTGGAGTGAGCCAGG + Intronic
1162487634 19:10971232-10971254 CAGTGTGGCTGGAGCAGGGAAGG - Intronic
1162717043 19:12640726-12640748 GAGGGTGGAAGGAGGGAGGAAGG + Intergenic
1163598818 19:18235774-18235796 CAGTGTGGCTGGAGGGTGGGAGG - Intronic
1163786336 19:19276851-19276873 CAGCCTGGCTGGACTGAGGAAGG + Intronic
1164695640 19:30241594-30241616 CAGTGTGGCTGGAGTAAAAAAGG + Intronic
1164711344 19:30359270-30359292 CAGTGTGCATGGTGTGGGGAGGG + Intronic
1164726335 19:30468334-30468356 TTGTGAGGATGGAATGAGGAAGG + Intronic
1165321886 19:35090633-35090655 CAGTGTTCATGGAGTGAGAAAGG + Intergenic
1165909979 19:39219724-39219746 GAGGGAGGATGGAGTGAGGCGGG + Intergenic
1166039471 19:40192805-40192827 CACTGTGCCTGGAGTGAGAAGGG + Intronic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1167842552 19:52133866-52133888 CAGGGTGGAGGGTGGGAGGAGGG - Intronic
1168472330 19:56649734-56649756 CAGTGTGGCTGGAGGGTGGGAGG + Intronic
925435600 2:3834819-3834841 CAAGTGGGATGGAGTGAGGATGG + Intronic
925719770 2:6815778-6815800 GAGGGTGGATGGTGGGAGGAGGG + Intergenic
926778043 2:16441415-16441437 CAGTCTGGAAGCAGGGAGGAAGG - Intergenic
926960296 2:18350879-18350901 GAGGGTGGATGGTGGGAGGAGGG - Intronic
927099115 2:19774362-19774384 CAGTGTAGATGGAGATATGAGGG + Intergenic
927520827 2:23696994-23697016 GTGTGTGGCTGGAGGGAGGAAGG - Intronic
928239764 2:29576380-29576402 CAGTGTGCATGGTGGTAGGAAGG - Intronic
928451923 2:31385405-31385427 CAGTGCTGATGGAGTCAGAATGG - Intronic
928549105 2:32354595-32354617 CTGTGGGGCTGGAGTGAGAAGGG - Intergenic
929999130 2:46849239-46849261 GACTGTGGATGGATTGAGGGTGG - Intronic
930572725 2:53107422-53107444 GAGGGTGGAGGGAGGGAGGAGGG + Intergenic
931037406 2:58258940-58258962 TGGGGTGGCTGGAGTGAGGAAGG + Intergenic
931226860 2:60339321-60339343 CAGTGTGGCTGGAATGGTGAGGG - Intergenic
931603341 2:64026588-64026610 CAGTCTGGATGCAGTGTGAATGG - Intergenic
931717093 2:65037829-65037851 CACTGTGGCTGAAGTGAGGTGGG - Intergenic
932076849 2:68672301-68672323 TAGTGTGGCTGGAGTAAGGAGGG + Intergenic
932097012 2:68859814-68859836 CTGTGTGAATGGTCTGAGGAAGG + Intergenic
932425494 2:71631833-71631855 CAGTGTGCAGCGAGGGAGGAGGG - Intronic
932769370 2:74492074-74492096 CAGGGAGGGTGGGGTGAGGACGG - Intronic
933117839 2:78497367-78497389 CATTGTGGAAGGGGTGAGCAGGG + Intergenic
933559917 2:83876357-83876379 CAGTTTGGTTGGAGAGAGGGAGG + Intergenic
933656163 2:84888595-84888617 TAGTGTGGGTGGTGTGATGAGGG + Intronic
934711127 2:96514856-96514878 CAGGGTGGATGGGGTAAGCAAGG + Intergenic
934791593 2:97067023-97067045 CAGGGTGGATGCAGAGTGGAGGG - Intergenic
934965225 2:98715641-98715663 GAGGGTGGAGGGTGTGAGGAGGG + Intronic
935677595 2:105609371-105609393 GAGTGTGAATGGAGATAGGATGG + Intergenic
936295021 2:111261378-111261400 CAGGGTGGATGCAGAGTGGAGGG - Intergenic
937138463 2:119576346-119576368 GAGTGTGGAGGGTGAGAGGAGGG - Intronic
937239711 2:120452219-120452241 CAGTGGGGATGGAGTGAAAGTGG - Intergenic
937293092 2:120793780-120793802 CAGGGTGAATGTAGTGAGGGAGG - Intronic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937787712 2:125921916-125921938 CAGTGGGGTTGGAGTGGGTATGG - Intergenic
938554137 2:132408595-132408617 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
938727772 2:134121991-134122013 CAGTGAGGACGGGGGGAGGAGGG - Intronic
938902709 2:135811563-135811585 CAGTGTGGCTGGAGCAATGAGGG + Intronic
938967782 2:136403988-136404010 CAGTTTGGATGGAGGGTGGATGG - Intergenic
939011016 2:136845957-136845979 TGGTGTGGATGGACTGATGAGGG + Intronic
939235516 2:139487373-139487395 GAGGGTGGATGGTGGGAGGAGGG - Intergenic
939459876 2:142486139-142486161 GAGTGAGGTGGGAGTGAGGAGGG + Intergenic
939765711 2:146246850-146246872 AAGTGTGGATGGAGTGAGAGAGG + Intergenic
940055550 2:149509156-149509178 CAGTGTGGCAGAAGTTAGGAGGG + Intergenic
941025309 2:160450035-160450057 CAGAGTGGAGGGGGTGAGAAAGG - Intronic
941870948 2:170385104-170385126 CAGGGTGTATGGGGGGAGGAAGG + Intronic
943565768 2:189514362-189514384 CACTGTGGCTGGGGTGAGAAGGG - Intergenic
943666670 2:190616172-190616194 ATGTGTGGATGGAGTGAGGAGGG + Intergenic
944015152 2:195026948-195026970 AAGAGTGGATGGATTGAGGCAGG + Intergenic
944091896 2:195921069-195921091 CAGTGTGGATGTAGTGAAAGGGG + Intronic
945519206 2:210802232-210802254 GAGGGTGGAGGGTGTGAGGAGGG - Intergenic
946172995 2:217906310-217906332 GAGTGTGGATGGGGAGAAGAAGG - Intronic
946393569 2:219431298-219431320 CAGAGAGGATGGAGGGAGCAAGG - Intergenic
946818440 2:223605268-223605290 GAGTGTGGATGGTGGGAGGAGGG - Intergenic
947062491 2:226182150-226182172 GAGGGAGGAGGGAGTGAGGAAGG - Intergenic
948079987 2:235198125-235198147 CAGCCTGGAAGGAGTGTGGAGGG + Intergenic
948164139 2:235848314-235848336 GGGTGTGGGTGGAGTGATGAGGG - Intronic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948360171 2:237414246-237414268 CAGTGAGGAGGGGGAGAGGAGGG - Exonic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
948763564 2:240208121-240208143 CCTTTTGGATGGAGGGAGGAGGG - Intergenic
948890399 2:240904624-240904646 CAGGGCGGGTGGAGTGAGGAAGG - Intergenic
1168792708 20:590622-590644 CAGTGTGATTGGAGAGAGGATGG + Intergenic
1168862185 20:1053570-1053592 CTGTCTGGCTGGAGGGAGGAGGG - Intergenic
1169005526 20:2204144-2204166 CAGTGTGGCTGGAATGAAGTGGG - Intergenic
1169027445 20:2382779-2382801 CACCATGGATGGAGTGAGGGAGG - Intronic
1169088835 20:2844836-2844858 CAGTGTGGCTGGAGTGCTGTAGG + Intronic
1169241620 20:3986265-3986287 GAGTGAGGAGGGAGGGAGGAAGG - Intronic
1169659066 20:7958248-7958270 CAGTGAGGCTGCAGTGAGGCTGG - Intergenic
1169957768 20:11124656-11124678 CAGTCAGGATGGAGAGGGGATGG + Intergenic
1170055910 20:12202119-12202141 CATTCTGGATGGAGTGGGGAAGG - Intergenic
1170633298 20:18083424-18083446 CAGTGTGGATGGATCAAGGGAGG - Intergenic
1170693742 20:18638583-18638605 CAGTGTGGCTGGAGCTTGGAGGG + Intronic
1170789176 20:19493806-19493828 CAGTGTTTCTGGAGTGTGGAGGG - Intronic
1170931550 20:20773406-20773428 CAGGGTGGAGAGAGTGGGGAAGG - Intergenic
1172179966 20:32996869-32996891 GAGTGTGCATGGAGAGAGAATGG - Intronic
1173128365 20:40362178-40362200 CAGAGAGGATGGAATGAGAATGG + Intergenic
1173349753 20:42233927-42233949 CAGTGTGAAAGGACAGAGGATGG - Intronic
1173471187 20:43324833-43324855 GAGGGTGCATGGAGAGAGGAGGG - Intergenic
1174106627 20:48166804-48166826 AAGGGTGGATGGAGAGAGGCTGG + Intergenic
1174162173 20:48559286-48559308 CACTGTGGATGGAGGCAGCAGGG + Intergenic
1174251108 20:49220312-49220334 CAGTGTGAATGGAGAGAGGCGGG - Intronic
1174727249 20:52876078-52876100 CAGTGTGGTTGGAGTAGGGATGG + Intergenic
1174793697 20:53503811-53503833 CAGGGAGGAAGGAGGGAGGAAGG + Intergenic
1175110846 20:56646834-56646856 CCCTGTGGCTGGAGTGGGGAGGG + Intergenic
1175904868 20:62374782-62374804 CAGTGTGGAGGGGGAGAGGGAGG + Intergenic
1175984037 20:62755364-62755386 GAGGGTGGATGGAGGGATGAAGG - Intronic
1176095095 20:63337831-63337853 CAGTGTGGCTGGTGTGTGGGAGG + Intergenic
1176455072 21:6900698-6900720 CAGGGAGGATGTAGTGAGAATGG - Intergenic
1176688091 21:9872838-9872860 GAGAGTGGAAGGAGAGAGGATGG + Intergenic
1176833245 21:13765746-13765768 CAGGGAGGATGTAGTGAGAATGG - Intergenic
1176836218 21:13794774-13794796 AAGTGTGGTGGGGGTGAGGATGG + Intergenic
1177167687 21:17621340-17621362 TAGTGAGGATGGGGTGGGGACGG + Intergenic
1177206793 21:18019335-18019357 TAGTGGGGAGGAAGTGAGGATGG + Intronic
1177309539 21:19371823-19371845 AAGTGTGGAGGGTGGGAGGAGGG + Intergenic
1177531415 21:22363042-22363064 GAGGGTGGATGGTGAGAGGAGGG + Intergenic
1177718087 21:24866510-24866532 GAGGGTGGAGGGTGTGAGGAGGG - Intergenic
1178043817 21:28671593-28671615 CAGTGTGGTAGGAGTGGGGTGGG + Intergenic
1178159638 21:29896871-29896893 GAGTTTGGATGGGGTGAGGTGGG - Intronic
1178641580 21:34348886-34348908 GAGGGTGGATGGTGGGAGGAGGG + Intergenic
1179314199 21:40226891-40226913 GAGGGTGGATGGTGGGAGGAGGG - Intronic
1179350693 21:40607975-40607997 CAGTGAAGAGTGAGTGAGGAAGG + Intronic
1179565630 21:42246101-42246123 CAGTGTGGATGGGTGGAGAAGGG - Intronic
1179713351 21:43275409-43275431 CAGAGCAGATGGAGGGAGGAGGG - Intergenic
1179828416 21:43981412-43981434 CAGTGGGGCTGCAGTGGGGATGG - Intronic
1181482279 22:23207849-23207871 CATGGAGGATGGAGTGAGCATGG + Intronic
1181494488 22:23280308-23280330 CAGGCTGGTGGGAGTGAGGAGGG - Intronic
1181671444 22:24427343-24427365 CAGGGTGGCTGCAATGAGGATGG - Intronic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
1182660106 22:31919118-31919140 CACTGTGGAAGGTGGGAGGAGGG - Intergenic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1182974490 22:34610350-34610372 CAGGGGGGATGGGGTGGGGATGG - Intergenic
1182980108 22:34661820-34661842 CAGTGGGTATGGTGTGGGGAAGG - Intergenic
1183005061 22:34894517-34894539 CAGTGAGGATGGGGTCAGGAAGG + Intergenic
1183167402 22:36158271-36158293 CACTGTTGATGGAGTGTGAAAGG + Intronic
1183319223 22:37154969-37154991 CAGTGTGAATTGTCTGAGGAGGG - Intronic
1183672839 22:39283281-39283303 CAGGCTGGATGGAGTGGGGGTGG - Intergenic
1183733486 22:39630970-39630992 CAGGGAGGATGGAGGGAGGTGGG + Intronic
1183739403 22:39661784-39661806 GGATGTGGATGGAGTGAGGTGGG + Intronic
1184383615 22:44161824-44161846 CAATGGGGGAGGAGTGAGGACGG - Intronic
1184733677 22:46385463-46385485 CAGTGAGCCTGGAGTGAGGCGGG + Intronic
1185047198 22:48534450-48534472 GAGTGTGGAGGCAGAGAGGAGGG + Intronic
949146756 3:710115-710137 GAGAGTGGAGGGAGGGAGGAAGG - Intergenic
950139890 3:10608196-10608218 CAGTGTGGATGGAGTGAGGAGGG - Intronic
950309003 3:11939614-11939636 TCATGTGGTTGGAGTGAGGAAGG + Intergenic
950331328 3:12158449-12158471 CAGTATGGCCGGAGTGAGGGAGG + Intronic
950451363 3:13067523-13067545 CAGTGGGGAAGGGGTGGGGAGGG + Intronic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
950894853 3:16439676-16439698 GTGGGTGGCTGGAGTGAGGAAGG + Intronic
950934101 3:16821284-16821306 CATTGTGGATGGAGGCAGCAGGG + Intronic
950947693 3:16966914-16966936 CAGGGTGGAGGGTGGGAGGAGGG - Intronic
951305304 3:21053159-21053181 CAGGGTGGAGGAAGTGAGGAGGG + Intergenic
951498952 3:23362488-23362510 CAGCAGGGATGGAGGGAGGAGGG - Intronic
951642312 3:24849838-24849860 TAGTGTAGATGGAGTTAGGGTGG + Intergenic
952132950 3:30385298-30385320 CAGTGTGGAGGGAAGGGGGAAGG + Intergenic
952408580 3:33026749-33026771 CTGAGAGGATGGAGGGAGGATGG + Intronic
952486644 3:33818424-33818446 CAGTGTGGCAGGAGAGAGCAAGG - Intronic
953006765 3:38986217-38986239 CAGTGTGGATGGTGTGGTGACGG - Intergenic
953225578 3:41016470-41016492 AAGTGTGGATGGAGTGACTGAGG + Intergenic
953312001 3:41889535-41889557 CAGGGTGGAGGGTGGGAGGAGGG + Intronic
953745214 3:45568782-45568804 GAGGGTGGAGGGAGGGAGGAGGG - Intronic
954317955 3:49811520-49811542 CAGGGTGGATGGAGGGTGGCTGG - Intronic
954336315 3:49920124-49920146 CAGTGTTGATGGAGTAATGGAGG - Intronic
954369303 3:50161904-50161926 AAGTGTGTGTGGAGTGAGAATGG + Intronic
954425441 3:50440633-50440655 CAGTGTGGGAGCAGAGAGGAGGG + Intronic
954602524 3:51880621-51880643 GAGGGTGGATGGTGGGAGGAGGG + Intergenic
954635228 3:52067513-52067535 CAGTGAGGAGGCAGTAAGGATGG - Intergenic
954681270 3:52347313-52347335 CAGTGTGGCTGGAGTCAGGGAGG + Intronic
954917970 3:54164685-54164707 CAGTGGGGATGGGGGAAGGATGG + Intronic
955581677 3:60429669-60429691 CAATGTGGTTGGGATGAGGATGG + Intronic
955675535 3:61444356-61444378 CAGGGTGGAGGGAGGGAGGGAGG - Intergenic
955789537 3:62574078-62574100 CAGTGGGGATGGAATGAGATGGG - Intronic
955803965 3:62714523-62714545 CAGTGTGGGTGAAGGGAGGAAGG + Intronic
956410583 3:68974275-68974297 CAGTGTGGCTGGTGTGATCAAGG - Intergenic
957178029 3:76838230-76838252 GAGAGTGGATGGTGGGAGGAGGG + Intronic
959578495 3:107960723-107960745 CAGTGGGGAGGGAGAGAGAAAGG + Intergenic
960294685 3:115928671-115928693 CAGAGTGCAGGGGGTGAGGAGGG + Intronic
960302731 3:116023643-116023665 CAGTGAGCATGAAGAGAGGAAGG - Intronic
960604817 3:119494500-119494522 CAGTGTAGATGATATGAGGATGG + Exonic
961012694 3:123447135-123447157 CTGTGGGAATGCAGTGAGGAAGG - Intronic
961331936 3:126147617-126147639 CAGTGGGGCAGGAGTCAGGAGGG + Intronic
962245466 3:133787355-133787377 CAGAGAGAAGGGAGTGAGGAAGG + Intronic
962480344 3:135792661-135792683 AGGTGAGGATGGAGTGAGTAAGG - Intergenic
963202604 3:142600220-142600242 CAGTGAGGAGGGAGTGAGGCTGG + Intronic
963525629 3:146411042-146411064 CTGTGTGAATGGTGTGTGGATGG - Intronic
963728229 3:148945834-148945856 CAGTGTGGCTAGAGTGGGGCTGG - Intergenic
964342283 3:155720352-155720374 CAGTGTGGATGTGGTGAAAAGGG - Intronic
965367045 3:167813883-167813905 CTGTGTGGCTGCAGTGGGGAGGG - Intronic
966311059 3:178594371-178594393 TAGTGTGGAAGCAGTGAAGATGG + Intronic
966332629 3:178831748-178831770 GAGTGTGGAGGGAGGAAGGAGGG + Intronic
966542156 3:181103885-181103907 CAGAGTGGAAAGAGTGAGGCAGG + Intergenic
966603813 3:181801698-181801720 GAGTGGGGAGGGAGGGAGGAAGG + Intergenic
966937098 3:184717782-184717804 CCGGGTGGATGGAGGGAGAAGGG + Intergenic
967815663 3:193796168-193796190 CAGCGTGGCTGGAGTAAAGAGGG - Intergenic
967898759 3:194425062-194425084 CATTGTGGAGGGAGTTAGGATGG - Intronic
968278672 3:197459437-197459459 TAGTAGGGATGCAGTGAGGACGG + Intergenic
968278849 3:197460154-197460176 TAGTAGGGATGCAGTGAGGACGG + Intergenic
968867099 4:3220066-3220088 CAGTGTTGGGGTAGTGAGGAGGG + Intronic
969519289 4:7666450-7666472 CAGGGTGGGAGGAGGGAGGAAGG - Intronic
970173014 4:13308050-13308072 CAGTGTGGCTAGAGTGCGGTGGG - Intergenic
970173543 4:13313245-13313267 GAGTGTGGAAGGTGGGAGGAGGG + Intergenic
970267162 4:14301001-14301023 AAGGGTGGATAGTGTGAGGAAGG + Intergenic
970315475 4:14824965-14824987 CAGTGTGGCATGAGTGAGCAGGG + Intergenic
970434852 4:16023471-16023493 CAGTGTGGAGAGAATGAGGGAGG - Intronic
971664331 4:29462184-29462206 GAGGGGGGATGGAGGGAGGAGGG + Intergenic
971774598 4:30946471-30946493 CAGTGTGGTGGGAGGGAGGTGGG - Intronic
972646743 4:40975157-40975179 GAGAGTGGATGGTGGGAGGACGG - Intronic
973556961 4:52092990-52093012 GAGAGTGGATGGTGGGAGGAGGG + Intronic
974084198 4:57242179-57242201 CAGTGTGATTGGAATGGGGAAGG + Intergenic
975197397 4:71541684-71541706 CAGTCTGGCAGCAGTGAGGATGG + Intronic
975288149 4:72644897-72644919 CAGTGTGAATGGGGTTATGAAGG - Intergenic
975485577 4:74931682-74931704 CAGGGAGGATGGAGAGGGGATGG + Intergenic
975547137 4:75571347-75571369 CAGTGTGTCTGGAGTGGGAAAGG - Intergenic
975895365 4:79083793-79083815 CAGATGGGATGGAGGGAGGACGG - Intergenic
976126384 4:81837750-81837772 CAGGGTGGAGGGAATGGGGAAGG - Intronic
977148789 4:93481875-93481897 CAGGCTTGATGGAGGGAGGAAGG + Intronic
977208366 4:94189681-94189703 CAGTATGGATGGAGTTGGGTGGG + Intergenic
977374897 4:96190039-96190061 GAGGGTGGATGGTGGGAGGAGGG - Intergenic
977510923 4:97961715-97961737 TAGTGTGGATGCAGTGAACAGGG + Intronic
977580036 4:98714805-98714827 GTGTGTGGATCGAGTGTGGAAGG - Intergenic
978944915 4:114483608-114483630 GAGGGTGGATGGTGAGAGGAGGG + Intergenic
979630893 4:122901485-122901507 CAGTGTGGATGATGTAAGGGTGG + Intronic
980351462 4:131690677-131690699 GAGAGTGGAAGGAGAGAGGATGG + Intergenic
980622687 4:135329779-135329801 TAGTTTGAATGGAGTGATGATGG + Intergenic
981255968 4:142660661-142660683 CAGTTTGCATGGAGAGAGGGAGG - Intronic
981448095 4:144864133-144864155 TAGGGTGGAGGGAGGGAGGAAGG + Intergenic
981870140 4:149475868-149475890 CAGTTTTGATGGAGTCATGAGGG + Intergenic
982086002 4:151836753-151836775 CAGGGTGGAGGGTGGGAGGAGGG - Intergenic
982346622 4:154367294-154367316 CAGGGTGGAAGGAGGGAGAACGG + Intronic
983126626 4:163960654-163960676 GAGTGTGGAGGGTGGGAGGAGGG + Intronic
983639448 4:169931128-169931150 GAGTGTGGAGGGTGGGAGGAGGG + Intergenic
984201387 4:176724924-176724946 TAGGGAGGATGGAGAGAGGATGG + Intronic
984720791 4:182970844-182970866 GAGTGGGGATGTAGGGAGGAAGG + Intergenic
984764019 4:183385737-183385759 GAGTGTGGAGGGTGGGAGGAGGG + Intergenic
984853155 4:184171098-184171120 CAGTCTGGATGGAGCATGGAAGG + Intronic
984870677 4:184322332-184322354 GAGGGTGGAGGGAGAGAGGAGGG - Intergenic
985092399 4:186377810-186377832 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
985230095 4:187806321-187806343 CGGTGGGGAGGAAGTGAGGATGG + Intergenic
985477885 5:90141-90163 CAGAGGGGATGGAGTTAGAAAGG - Intergenic
985883120 5:2655899-2655921 CAGTTTGGAAGGAGAGATGATGG + Intergenic
985972673 5:3390823-3390845 CAGTGTGCATGGAGTGCAGTGGG - Intergenic
986269205 5:6216753-6216775 GAGTGTGGATGCAGCCAGGATGG - Intergenic
986280625 5:6319206-6319228 CAGTGTGCATTGAGTGTTGAGGG - Intergenic
986620899 5:9673141-9673163 AAGGGTGGATGGTGGGAGGAGGG + Intronic
986647226 5:9929355-9929377 CAGTCTCCATGGAGTGGGGATGG + Intergenic
986854488 5:11853153-11853175 CAGTTTTGGTGGAGTGATGAGGG - Intronic
988209075 5:28179071-28179093 GAGGGTGGATGGTGGGAGGAGGG + Intergenic
988318102 5:29657811-29657833 GAGGGTGGAGGGAGAGAGGAGGG + Intergenic
988918489 5:35919858-35919880 CAGTGGGTATGGGGTGAAGATGG + Intronic
989964574 5:50452739-50452761 GAGTGTGGAGGGTGGGAGGAGGG - Intergenic
990173467 5:53081126-53081148 TGGTGTGGATGGAGTGGGGGTGG - Intronic
990654428 5:57939562-57939584 AAGTGGGGAGGAAGTGAGGAGGG - Intergenic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
992091632 5:73322838-73322860 CAGTGTGCAGTGACTGAGGAAGG + Intergenic
992441485 5:76801274-76801296 CTGTGTGGCTGGAGAGAGCATGG + Intergenic
992480890 5:77151712-77151734 CTGTCTGGAAGGAGTGAGAAGGG - Intergenic
993298365 5:86173801-86173823 CATGGTGGATGGGGAGAGGATGG + Intergenic
993350655 5:86845986-86846008 GAGTGTGGAGGGTGGGAGGAGGG - Intergenic
993355322 5:86899736-86899758 TAGGGTGGAGGCAGTGAGGAAGG - Intergenic
993536038 5:89087674-89087696 CTGTGTTGATGGGGTGGGGAAGG - Intergenic
994469934 5:100190702-100190724 GAGTGTGGAGGGTGGGAGGAAGG - Intergenic
994728356 5:103462844-103462866 CAGTGTGAATGCTGTGAGGTGGG - Intergenic
994957527 5:106552554-106552576 CAGGGTGGAAGGTGGGAGGAGGG + Intergenic
995415870 5:111912347-111912369 CAGGGTGGATGAAGTGAGGAGGG - Intronic
995431057 5:112078093-112078115 CAGTGTGGAGGGTAAGAGGAGGG - Intergenic
995453731 5:112330882-112330904 GAGTGTGGACAGGGTGAGGAGGG + Intronic
995833293 5:116376897-116376919 CTGTGTGGGTGGGGTGTGGATGG + Intronic
995866199 5:116693831-116693853 CATTGTGCATGGGGGGAGGAGGG + Intergenic
995919343 5:117292805-117292827 GAGGGTGGATGGTGGGAGGAGGG - Intergenic
996038805 5:118787721-118787743 CAGTGTGGAAGGAGGGTGGTTGG + Intergenic
996255631 5:121399383-121399405 GAGGGTGGATGGTGGGAGGAGGG + Intergenic
996819511 5:127610990-127611012 GAGTGTGGAGGGTGGGAGGAGGG - Intergenic
997358702 5:133280769-133280791 CAGCGTGGCTGGAATGTGGAGGG - Intronic
997639938 5:135442546-135442568 CTGTAAGGATGGAGGGAGGAGGG - Intergenic
997641739 5:135452877-135452899 CAGTTTGGAAGGGGTGAAGATGG + Intergenic
997734269 5:136201918-136201940 CAGTGTACATGAAGTGATGAGGG + Intergenic
997882339 5:137602041-137602063 CAGGGTGGAAGGTGTGAGGCCGG - Intergenic
998004167 5:138646354-138646376 CAGTGAGGATGGAGAGAGAGCGG - Intronic
998262435 5:140641783-140641805 CAGTGTGGATGGTGTGGTGGAGG + Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998430320 5:142064776-142064798 CACTGTGGAAGGAGAGGGGAGGG - Intergenic
998956781 5:147446845-147446867 CAGGGTGGAAGGATTGGGGATGG - Intronic
998959153 5:147466433-147466455 CAGTGCTGGTGGAGTGAGGGTGG - Intronic
999269631 5:150289328-150289350 CAGTGTGTATGTAGGGATGAAGG - Intronic
999689278 5:154132790-154132812 CAGCATTGATTGAGTGAGGAAGG + Intronic
1000521166 5:162296389-162296411 GAGTGTGGAGGGTGGGAGGAGGG - Intergenic
1000657915 5:163904193-163904215 CATTGTAAATGGAGTAAGGATGG + Intergenic
1001691785 5:173638774-173638796 CAGTCGGGAAGGAGAGAGGAAGG - Intergenic
1002073937 5:176697051-176697073 CTGTGTGGTGGGAGTGAGCATGG - Intergenic
1002195666 5:177499683-177499705 AAGTGAGGAAGGAGTTAGGAAGG - Intergenic
1002209235 5:177586344-177586366 TGGTGTGGATGGAGTGAACAGGG - Intergenic
1002250432 5:177925532-177925554 CAGTGTGGCTGCAGCGAGTAGGG - Intergenic
1002458211 5:179358051-179358073 CAGTGGGAGTGGGGTGAGGAGGG + Intergenic
1003020533 6:2505220-2505242 CAGTGACGGGGGAGTGAGGAGGG - Intergenic
1003126308 6:3358827-3358849 CAGTGAGGAAGAAGTGAGAAGGG + Intronic
1003393929 6:5736954-5736976 TAGTGTGGAGGGCGAGAGGAAGG - Intronic
1003672743 6:8174563-8174585 CTGTGTGGCTGGACAGAGGACGG + Intergenic
1004825552 6:19416787-19416809 CTCTGTGTATGGTGTGAGGAAGG + Intergenic
1005024222 6:21447472-21447494 CCGTGTGTTTGCAGTGAGGATGG - Intergenic
1005164796 6:22907375-22907397 GTGTGTGTAGGGAGTGAGGATGG - Intergenic
1005305394 6:24508752-24508774 CAGTGTGGATGTGGTGAACAGGG - Intronic
1005970770 6:30759692-30759714 CACTGTGGATGGAGTGATGGGGG + Intergenic
1006118814 6:31791823-31791845 CAGAGTGGGTGGGGTGGGGAAGG - Intronic
1006255176 6:32827069-32827091 CAGTGAGGATGGGGTGAGAGTGG - Intronic
1006883609 6:37360989-37361011 CAGATTGAAAGGAGTGAGGAAGG - Intronic
1006929388 6:37678592-37678614 CAATGTGGCTGGAGTGGGGAGGG - Intronic
1007623001 6:43226207-43226229 CGGTGTGGCTGTGGTGAGGAGGG + Intronic
1008323975 6:50154302-50154324 GAGGGTGGATGGAGGGAGGAGGG - Intergenic
1010203050 6:73299566-73299588 CAGTGTGCAGGGCGTGAGGGAGG - Intronic
1010416698 6:75619861-75619883 CAGGGAGGATGGATTGAGGCTGG + Intronic
1010532492 6:76985621-76985643 GAGGGTGGATGGTGGGAGGAGGG - Intergenic
1010842235 6:80659737-80659759 CAGTGTGGCTGGGGCCAGGAGGG + Intergenic
1011628909 6:89305797-89305819 GAGTGTGGAGGGTGGGAGGAGGG + Intronic
1012536450 6:100303760-100303782 TAGTGTGGATGTGGTGAGAAGGG - Intergenic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1014274118 6:119367433-119367455 CAGGGTGGAGGGTGAGAGGAGGG + Intergenic
1015092620 6:129376590-129376612 CAGTATGGCTGGAGTGCAGATGG - Intronic
1015765669 6:136713340-136713362 CAGTGGGCAAGGAGTGAGGGTGG + Intronic
1016666981 6:146653588-146653610 GAGTGTGGAGGGTGGGAGGAGGG + Intronic
1016693954 6:146970963-146970985 GAGTGGGGATGAAGTGAGCAGGG + Intergenic
1016751420 6:147634447-147634469 CAGTGTTGGAGGAGGGAGGAGGG - Intronic
1017549760 6:155493397-155493419 GGGTGTGGATGGGGGGAGGAGGG + Intergenic
1017609361 6:156168059-156168081 CAGGCTGGAGGGAGGGAGGAAGG + Intergenic
1018346600 6:162905292-162905314 CTGTGTGAATGGAGTGGGAAGGG + Intronic
1019042446 6:169118413-169118435 CTGTGGGGGTGGAGTGGGGATGG - Intergenic
1019057810 6:169235798-169235820 GAGTGTGGATGGAGTGAGTGTGG - Intronic
1019057977 6:169236543-169236565 GAGTGTGGATAGAGTGAGTGTGG - Intronic
1019058016 6:169236744-169236766 GAGTGTGGATGGAGTGAGTGTGG - Intronic
1019290192 7:246518-246540 GAGCGCGGATGGAGGGAGGAAGG - Intronic
1019419582 7:944835-944857 CAGGGTGGGTAGAGTGGGGATGG - Intronic
1019501094 7:1365094-1365116 CAGAGGGGATGCAGTGGGGAGGG - Intergenic
1019549418 7:1594684-1594706 GAGGGTGGATGTAGGGAGGATGG - Intergenic
1019549614 7:1595416-1595438 GAGGATGGATGGAGGGAGGATGG - Intergenic
1019664788 7:2246403-2246425 GAGTGTGGAAGGAGGGAGGAAGG + Intronic
1020188079 7:5974036-5974058 CAGTGCAGCTGGGGTGAGGAAGG - Intronic
1020294839 7:6750733-6750755 CAGTGCAGCTGGGGTGAGGAAGG + Intergenic
1020442012 7:8227352-8227374 CAGAGAAGATGGAGAGAGGAAGG + Intronic
1020488546 7:8749603-8749625 CAGTGTGGAAGGAGACTGGAGGG + Intronic
1020550071 7:9592949-9592971 GAGTGTGGAGGGTGGGAGGAGGG + Intergenic
1020614063 7:10436922-10436944 GAGTATAGATGGAGTGAAGATGG - Intergenic
1020816994 7:12917818-12917840 GAGGGTGGATGGTGGGAGGAGGG - Intergenic
1021407483 7:20289105-20289127 AAGGGTGGAGGGAGGGAGGAGGG + Intergenic
1021494001 7:21252442-21252464 GGGGGTGGATGGAGTGATGAAGG + Intergenic
1022223055 7:28333525-28333547 GTGGGTGGATGGAGTGAGAACGG - Intronic
1022228743 7:28392122-28392144 GAGGGTGGACGGAGGGAGGAAGG + Intronic
1022762892 7:33376174-33376196 CAGAGTGGAGGGTGGGAGGAAGG - Intronic
1023712697 7:43011883-43011905 AAGGGTGGATGGTGGGAGGAGGG - Intergenic
1024126877 7:46307723-46307745 TAGTGTGGATGGGGTGAACAGGG + Intergenic
1025724241 7:64043168-64043190 CAGTATGAAGGGAGTGGGGAGGG - Intronic
1025875516 7:65477142-65477164 CTGGGTGGTTGGAGAGAGGAGGG - Intergenic
1026286756 7:68969924-68969946 AACTGTGGCTGGGGTGAGGATGG + Intergenic
1026883098 7:73919885-73919907 CAGTGGGGAGGGGGGGAGGAGGG - Intergenic
1027917446 7:84343666-84343688 CAGTATGGATGGGGAGAGGAGGG + Intronic
1028117298 7:87013551-87013573 CAGCAGGGATGGAGTGAGGAAGG + Intronic
1028505947 7:91570285-91570307 TAAAGTGCATGGAGTGAGGAAGG - Intergenic
1028514402 7:91660415-91660437 CAGAGTAGAAGCAGTGAGGAAGG + Intergenic
1029196130 7:98806770-98806792 GAGGGGGGATGGAGTGAGGCTGG - Intergenic
1029707848 7:102285133-102285155 CAGGGAGGAAGAAGTGAGGAGGG - Intronic
1030086936 7:105824034-105824056 CAGAGTGGATGGACTGAGGGTGG + Intronic
1030237958 7:107287638-107287660 GCCTGGGGATGGAGTGAGGAAGG - Intronic
1030416681 7:109252763-109252785 CAGTGGGGAGGGTGGGAGGAAGG + Intergenic
1031523673 7:122797713-122797735 CAGGGTGGAGGCAGGGAGGAGGG + Intronic
1031736073 7:125363558-125363580 CAGAGTGGAGGGTGAGAGGAAGG - Intergenic
1031958098 7:127963185-127963207 CACTTTGGATGGAATGTGGATGG + Intronic
1031978086 7:128106473-128106495 CAGGATGGATGGTGTGAAGATGG - Intergenic
1032254192 7:130284123-130284145 CAGTGTGGATGGAGTGATGAGGG + Intronic
1032269372 7:130389538-130389560 GATTGGGGCTGGAGTGAGGATGG + Intergenic
1032361204 7:131256798-131256820 AAGGGTGGAGGGAGGGAGGAGGG + Intronic
1032675868 7:134129269-134129291 CAGAGTGGAGGGAGGGAGGAAGG - Intronic
1033025974 7:137772919-137772941 CAATGGGGGTGGAGAGAGGAAGG + Intronic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033422838 7:141218332-141218354 CAGTGGGGATGGAGGAAGGGAGG + Intronic
1033437484 7:141346605-141346627 CAGTGTGTGTGGAGTGTGTATGG - Intronic
1033966934 7:146986637-146986659 TGGCGTGGATGGAGTGAAGAGGG - Intronic
1034347917 7:150398278-150398300 CAGCGTGGGTTGAGGGAGGAGGG + Exonic
1034399279 7:150851324-150851346 CAAAGTTAATGGAGTGAGGATGG - Intronic
1034553321 7:151834714-151834736 CGGAGTGGAGGGAGTGTGGAGGG + Intronic
1034642106 7:152612428-152612450 GTGTGGGGGTGGAGTGAGGATGG - Intergenic
1035466115 7:159079032-159079054 CAGTGTCCATGGAGGAAGGATGG + Intronic
1035695816 8:1594985-1595007 CAGTGTGTATGGATTCAAGATGG - Intronic
1035938823 8:3873552-3873574 CAGGGTGGACGGTGGGAGGAGGG + Intronic
1036445324 8:8817156-8817178 CAGTTTAGATGGAGAGAGGATGG - Intronic
1037465670 8:19157590-19157612 CATAGTGGATGGAGAGTGGATGG - Intergenic
1037482815 8:19320695-19320717 TAGTGAGAACGGAGTGAGGAGGG - Intronic
1037796273 8:21997836-21997858 CAGTGTGGTGGGGGGGAGGAAGG + Intronic
1037904265 8:22706188-22706210 CAGTGTGGTGGGAGAGAAGATGG - Intergenic
1038482835 8:27913592-27913614 GAGGGTGGAGGCAGTGAGGAAGG - Intronic
1038553779 8:28492137-28492159 CAGTGTGGATGGTGTGACTCAGG - Intergenic
1038675716 8:29621060-29621082 CAGGGTGGAGGGAGAGAGGTTGG + Intergenic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1039824059 8:41158012-41158034 GAGTTTGGAAAGAGTGAGGAAGG - Intergenic
1040626332 8:49153481-49153503 TAGTGTGGATGTAGTGAAAAGGG - Intergenic
1041022998 8:53657370-53657392 CAGTGAGGATAGACTGAGGCAGG + Intergenic
1041261909 8:56028246-56028268 CAGTGTGGAGGGAGGGAGGACGG + Intergenic
1041302387 8:56426365-56426387 GAGTGTGAAGGGAGAGAGGAGGG - Intergenic
1041706608 8:60852988-60853010 CAGAGTGGTGGGAGTGTGGACGG + Exonic
1041953657 8:63533295-63533317 CATTGTGGAGGGAGGAAGGAAGG - Intergenic
1042469263 8:69164625-69164647 GAGTGTGGAGGGTGGGAGGAGGG - Intergenic
1042702273 8:71628369-71628391 GAGTGTGGAGGGTGGGAGGAGGG + Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1043356867 8:79423991-79424013 GAGAGAGGATGGAGAGAGGAAGG + Intergenic
1043831335 8:84992725-84992747 CAGAGTAGAGGGTGTGAGGAGGG - Intergenic
1044275402 8:90293511-90293533 CAATGTGGATGGACAGAGTAAGG - Intergenic
1044769528 8:95616321-95616343 CAGAGCGGTAGGAGTGAGGAGGG + Intergenic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1045097460 8:98812886-98812908 TAGGGTGGGGGGAGTGAGGAGGG + Intronic
1045270335 8:100655878-100655900 CAGTGTGCAGGGAATGAGGGGGG + Intronic
1045475588 8:102549746-102549768 GAGTGAGGATGGAGTGAGGGAGG - Intergenic
1045838435 8:106551063-106551085 CAGAATGGATGCACTGAGGAAGG - Intronic
1045863622 8:106840256-106840278 CAATGAGGATGGAGAGAAGATGG - Intergenic
1046024682 8:108708021-108708043 TAGGGTGGATGGTGGGAGGAGGG - Intronic
1046025755 8:108721584-108721606 CAAAGTGACTGGAGTGAGGATGG - Intronic
1046072029 8:109267267-109267289 GAGGGTGGAGGGAGGGAGGAGGG - Intronic
1046353212 8:113043552-113043574 CAGTGTGGATGAAATAGGGAAGG - Intronic
1046594220 8:116241421-116241443 CAGTGTCTATGTAGTGGGGAGGG + Intergenic
1046707778 8:117475644-117475666 GAAAGTGCATGGAGTGAGGAAGG - Intergenic
1046940325 8:119924881-119924903 GAGTGTGGAGGGTGGGAGGAGGG - Intronic
1047556209 8:125933434-125933456 AAGTTAGGATGGAGTGTGGATGG + Intergenic
1047608790 8:126500497-126500519 GAATATGGATGGAGAGAGGAAGG - Intergenic
1048266044 8:132987975-132987997 CAGTGGGGATGGTGTGCAGATGG - Intronic
1048575824 8:135689268-135689290 AAGTGTGGAAGGAAAGAGGAAGG + Intergenic
1049254125 8:141604908-141604930 CAGAGGGTCTGGAGTGAGGAGGG + Intergenic
1049474885 8:142792482-142792504 AAGTGTAGATGGAAGGAGGATGG - Intergenic
1050009590 9:1172164-1172186 CTGGGTGGATGGGGAGAGGAAGG + Intergenic
1050119862 9:2297154-2297176 CAGAGTGACTGGAGTGAGGCTGG + Intergenic
1051368167 9:16335880-16335902 CAGTGTGGCAGGAGTCAGGAAGG + Intergenic
1051428991 9:16962921-16962943 GAGTGTGGAGGGTGGGAGGAGGG - Intergenic
1051505758 9:17825787-17825809 CAGGGTGGATGGGGTAAGGCTGG - Intergenic
1053404346 9:37858897-37858919 AGGTGTAGATGGAGTGGGGAAGG - Intronic
1053416907 9:37952556-37952578 CAGTCAGGTTGGCGTGAGGAGGG + Intronic
1053454636 9:38224660-38224682 CAGTGAGGATGAGGTGGGGAGGG + Intergenic
1053479092 9:38402766-38402788 CCGTGTGGATGGACTGACGGGGG + Intergenic
1053781253 9:41609035-41609057 GAGAGTGGAAGGAGAGAGGATGG - Intergenic
1054169199 9:61819188-61819210 GAGAGTGGAAGGAGAGAGGATGG - Intergenic
1054668333 9:67761628-67761650 GAGAGTGGAAGGAGAGAGGATGG + Intergenic
1055963512 9:81843158-81843180 CAGGGTGGAGGGAGTTAGGGGGG + Intergenic
1056680073 9:88709396-88709418 CAGTTTGGCTGGATTGAGGAGGG - Intergenic
1056737697 9:89223930-89223952 CACTGTGGAGGGAGGGAGGGAGG - Intergenic
1057380685 9:94564660-94564682 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1057571332 9:96206382-96206404 CACTCTGGCTGGAGCGAGGAGGG + Intergenic
1057884982 9:98823185-98823207 CACTGGGGATGGAGTGACAAAGG - Intronic
1058007654 9:99935899-99935921 CAGTGTGGCTAGTGTGAGCAAGG + Intronic
1058218278 9:102262085-102262107 CAGAGTGGATGATGGGAGGAGGG - Intergenic
1059062477 9:111047693-111047715 GAGTGTGGAGGGTGGGAGGAGGG + Intergenic
1059163476 9:112057128-112057150 TGGTGGGGATGGAGTGGGGAGGG - Intronic
1059264943 9:113018627-113018649 CAGAGTGGAGGGTGGGAGGAGGG + Intergenic
1059433705 9:114264430-114264452 CAGTGTCGGAGGAGTGAGGAAGG - Intronic
1059522940 9:114961002-114961024 AAGTGGGGTTGGAATGAGGATGG - Intergenic
1059901899 9:118936804-118936826 CAGGGTGGATGGTGGGAAGAGGG - Intergenic
1060050853 9:120377123-120377145 CAGTCTGGAGGGAGTGGAGAAGG + Intergenic
1060100345 9:120834864-120834886 CAGTGAGGATAGAGAGAAGAGGG + Intronic
1060312998 9:122480756-122480778 GAGGGTGGATGGTGGGAGGAGGG - Intergenic
1060824338 9:126679388-126679410 GAGGGTGGATGGAGGGGGGATGG + Intronic
1060885697 9:127150495-127150517 CTGTGTGGGTGGGGTGAGGGGGG - Intronic
1061006644 9:127931813-127931835 CAGAGTGGCTGGAGTGAAGAGGG + Intergenic
1061203579 9:129150656-129150678 CACTGTGGTGGGAGTGGGGACGG + Intergenic
1061207869 9:129174924-129174946 CCCAGTGGATGGAGGGAGGAAGG - Intergenic
1061215356 9:129218547-129218569 TGGTGTGGGTGGAATGAGGATGG - Intergenic
1061770471 9:132916293-132916315 CAGAGTGGTTGCAGTGGGGAGGG - Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1062186628 9:135221900-135221922 CAGTGTGTCTGGAGGGAGCAAGG - Intergenic
1062307816 9:135919646-135919668 CAGCATGGGTGGAGTGAGGAGGG - Intergenic
1062640749 9:137516972-137516994 CAGAGTTGAGTGAGTGAGGATGG - Intronic
1185532858 X:835542-835564 GAGTGTGGACGGTGGGAGGAGGG - Intergenic
1185772365 X:2774198-2774220 CAGTGTGGATGGGCAGACGAGGG - Intronic
1185908414 X:3959580-3959602 GAGAGTGGAGGGAGGGAGGAGGG - Intergenic
1187190130 X:17026615-17026637 CAATTTGTATGGAATGAGGAGGG - Intronic
1187454550 X:19429706-19429728 AAGTGTGGATGGAGAGAAGGTGG + Intronic
1187556234 X:20354801-20354823 GAGAGTGGGTGAAGTGAGGAAGG + Intergenic
1187595172 X:20763283-20763305 CAAGGTGGAGGGAGGGAGGAGGG - Intergenic
1187755870 X:22525546-22525568 GAGAGTGGAGGGAGGGAGGAGGG + Intergenic
1187884138 X:23873180-23873202 TATTGGGGGTGGAGTGAGGATGG - Intronic
1188081027 X:25840727-25840749 GAGGGTGGATGGTGGGAGGAGGG + Intergenic
1188259144 X:28001907-28001929 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG + Intergenic
1189720653 X:43912912-43912934 GAGGGTGGATGGTGGGAGGAGGG - Intergenic
1190812202 X:53895629-53895651 GAGGGTGGAAGGAGGGAGGAGGG + Intergenic
1190880651 X:54490182-54490204 GAGGGTGGAGGGAGGGAGGAGGG + Intronic
1191047641 X:56156378-56156400 GAGGGTGGATGGTGAGAGGAGGG - Intergenic
1191891106 X:65942303-65942325 GAGGGTGGATGGTGGGAGGAGGG - Intergenic
1192528568 X:71868160-71868182 CAGAGTGGAGGCAGTGATGAAGG - Intergenic
1192831844 X:74758551-74758573 GAGGGTGGAGGGAGGGAGGAGGG - Intronic
1192879932 X:75273175-75273197 CAGAGTGCATGGTGTGAGAAGGG + Intergenic
1193219070 X:78900646-78900668 CAGTTTGGAGGAAGTTAGGAAGG + Intergenic
1193307546 X:79967103-79967125 TGGTGTGGATGGAGTGAAAAGGG - Intergenic
1193449834 X:81652044-81652066 GAGTGTGGAAGGTGGGAGGAGGG + Intergenic
1193512771 X:82426164-82426186 GAGAGTGGAGGGAGGGAGGAGGG - Intergenic
1193570442 X:83134963-83134985 GAGTGTGGAGGGAGGGAGGAGGG + Intergenic
1193698813 X:84739819-84739841 CAGGGTGGTTGGAGAGAGGAGGG - Intergenic
1193778356 X:85671849-85671871 CAGAGTGGGGGAAGTGAGGATGG - Intergenic
1195084363 X:101400355-101400377 CAGGGTGCATGTAGTGAAGATGG + Intronic
1195934620 X:110113023-110113045 CAGAGGGGAGGGAGGGAGGAAGG - Intronic
1196039736 X:111189065-111189087 GAGTGAGGAAGGAGGGAGGAGGG - Intronic
1196494606 X:116309754-116309776 AAGGGTGGAGGGAGGGAGGATGG - Intergenic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1196777065 X:119348151-119348173 CAGAGTGGTGGGAGTGAAGATGG + Intergenic
1197377476 X:125699153-125699175 GAGAGTGGATGGTGGGAGGAGGG - Intergenic
1197765464 X:130057005-130057027 CAGTGAAGAAGGCGTGAGGAGGG - Exonic
1198089883 X:133318131-133318153 GAGTGGGGAAGGGGTGAGGATGG - Intronic
1198329615 X:135609947-135609969 CAATGTCCATGGAGCGAGGATGG + Intergenic
1198329893 X:135612581-135612603 CAGTGTCTATGAAGTGAGGATGG + Intergenic
1198337104 X:135677180-135677202 CAATGTCTATGAAGTGAGGATGG - Intergenic
1198379761 X:136072821-136072843 CATAGTACATGGAGTGAGGAGGG + Intergenic
1198828582 X:140724780-140724802 CTGTGTGTATGGAATGAGTATGG - Intergenic
1198839074 X:140836831-140836853 CATTGTGGGTGGAGTGCGGGTGG + Intergenic
1199264751 X:145817724-145817746 GAGGGAGGAGGGAGTGAGGAGGG - Intergenic
1199791376 X:151158439-151158461 GAGGGTGGAGGGAGGGAGGAGGG - Intergenic
1199872940 X:151914007-151914029 CAGTGTGGATGGGGGTGGGAGGG - Intronic
1199873467 X:151916051-151916073 CAGTGTGGATGGGGGTGGGAGGG - Intronic
1199874173 X:151918770-151918792 CAGTGTGGATGGGGGTGGGAGGG - Intronic
1200216019 X:154368605-154368627 CAGGGTGGGTGGGGTGAGGCAGG + Intronic
1200229845 X:154438401-154438423 CAGTGGGGATGGTGGGTGGAAGG + Intronic
1200828095 Y:7663673-7663695 GAGTGGGGATGGAGTGGGGAGGG + Intergenic
1201303651 Y:12532196-12532218 CAGTGTGGACTCAGAGAGGAAGG + Intergenic
1201310963 Y:12597877-12597899 CAGGGTGGCTGGAAAGAGGAGGG + Intergenic
1201316211 Y:12648891-12648913 TAGTGTGGATGCAGTGATCAGGG + Intergenic
1201591216 Y:15616883-15616905 CAGGGTGCAGGGAGTGGGGAGGG + Intergenic