ID: 950140517

View in Genome Browser
Species Human (GRCh38)
Location 3:10612000-10612022
Sequence GAGAGTGTAAAATGCGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 82}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950140517_950140519 -4 Left 950140517 3:10612000-10612022 CCAGCATCGCATTTTACACTCTC 0: 1
1: 0
2: 1
3: 6
4: 82
Right 950140519 3:10612019-10612041 TCTCTGTTCTAGAGTATGGATGG 0: 1
1: 0
2: 0
3: 7
4: 167
950140517_950140518 -8 Left 950140517 3:10612000-10612022 CCAGCATCGCATTTTACACTCTC 0: 1
1: 0
2: 1
3: 6
4: 82
Right 950140518 3:10612015-10612037 ACACTCTCTGTTCTAGAGTATGG 0: 1
1: 0
2: 2
3: 4
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950140517 Original CRISPR GAGAGTGTAAAATGCGATGC TGG (reversed) Intronic
902047910 1:13539727-13539749 GAGAGGGTAAAATGAGCTGGAGG - Intergenic
905634500 1:39540620-39540642 GAGAGTGTATGAAGCAATGCTGG + Intergenic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
910061494 1:83098371-83098393 GAGAGTGTAGAATTCTATCCAGG - Intergenic
911606725 1:99914384-99914406 GAGAGTCTAAAATTCTTTGCCGG - Intronic
913049655 1:115106139-115106161 GAGTGTGTTTAATGGGATGCTGG + Intergenic
913505120 1:119509768-119509790 CAGAGTGAAAAATTCGAAGCTGG - Intronic
918581439 1:186135405-186135427 GAGAGTCTAAAATGAGAAGACGG - Intronic
919393172 1:197013056-197013078 AAGAGAGTAAAATGGTATGCAGG + Intergenic
1063030272 10:2227699-2227721 GAAAGTGTAAACTGAGCTGCCGG + Intergenic
1066024319 10:31338626-31338648 GAGAATGTAAAAAGCAATACTGG + Intronic
1066385446 10:34937544-34937566 GAGAGTGTAGAATCCAAAGCTGG + Intergenic
1072682879 10:97519290-97519312 AAGACTATAAAATGGGATGCTGG - Intronic
1073465103 10:103690433-103690455 GAGAGTCCAAAATGTGATGGGGG + Intronic
1076118220 10:127916075-127916097 GGGAGTGTTAAATGTGATGCTGG + Intronic
1078512271 11:11994358-11994380 GAGCTTGTAAAAGGCAATGCAGG + Intronic
1086270650 11:85061954-85061976 GCGAGTGTAAAATGGGCTGGGGG - Intronic
1088240593 11:107770162-107770184 GAGAGTGCAAAATGCAAATCTGG - Intergenic
1091911160 12:4231692-4231714 GAGAGTGTAAAAGATGTTGCTGG - Intergenic
1092092587 12:5815206-5815228 GAGAGTGTAAAATGCATGGCAGG - Intronic
1098302385 12:69067405-69067427 GTGAGTGTAAAATGCAAGGACGG + Intergenic
1100391787 12:94150243-94150265 GAGAGTGTAAAAAGGGGGGCGGG + Intronic
1107390244 13:39956031-39956053 GAGACAGTAAAATGTGATGCTGG + Intergenic
1110356728 13:74575760-74575782 GAGAGTGAACAATTAGATGCTGG + Intergenic
1111593277 13:90377610-90377632 GTGAGTGGATAATGCGATTCGGG + Intergenic
1115522838 14:34250631-34250653 GAGAGCTTAAAATTCGAAGCTGG - Intronic
1117117795 14:52534236-52534258 CAGAGTATAAAATGTGAAGCAGG - Intronic
1118436218 14:65773006-65773028 GAGATTGTAAAAATCCATGCCGG - Intergenic
1123685527 15:22794628-22794650 GAGAGTGTAAACTGAGATCCAGG + Intronic
1124551164 15:30682574-30682596 GAGAGTGGAAGATAGGATGCAGG - Intronic
1124680080 15:31723080-31723102 GAGAGTGGAAGATAGGATGCAGG + Intronic
1125106480 15:35977480-35977502 GAAAGTGTAAAATGCATAGCAGG - Intergenic
1127952502 15:63823145-63823167 GAGAGTGGAAAATGGGAGGAGGG - Intronic
1133540682 16:6750155-6750177 GAGAGAGCAAAATGGGATGCAGG + Intronic
1137364640 16:47849970-47849992 GACAGTGTCAATGGCGATGCAGG + Intergenic
1140146322 16:72313761-72313783 GAGATATTAAAATGAGATGCAGG + Intergenic
1140862176 16:79027432-79027454 CAGGGTGTAAAATGGGAGGCAGG - Intronic
1141557308 16:84844752-84844774 GAGAGTCTAAAATCCCCTGCAGG + Intronic
1141841596 16:86577410-86577432 GAAAATGTAAAATGAGATGGGGG + Intronic
1144003284 17:11075271-11075293 GAGATTATAAAATGCAATCCAGG - Intergenic
1157302044 18:46486110-46486132 GAGAGTGTGACATGTGATCCAGG + Intronic
932376487 2:71240690-71240712 GAGACTATAAAATGCCATACTGG + Intergenic
932486059 2:72085097-72085119 GAGAATGTAGAATGAGAAGCAGG + Intergenic
941786193 2:169501260-169501282 GAAAGTGTAAAATGAGATAATGG - Intronic
942448081 2:176091793-176091815 GTGACTGCAAAATGCGAGGCCGG + Intergenic
1170152377 20:13239012-13239034 GAGAGTGTGAAGTGTGATGGTGG + Intronic
1173336730 20:42118201-42118223 GAGGGTGTAAAAAGGGATGAAGG + Intronic
1173476578 20:43364100-43364122 GTGAGTGCAAAAAGCGAGGCAGG - Intergenic
1173699155 20:45051954-45051976 GTGAGTATCAAATGAGATGCAGG + Intronic
1175242047 20:57556908-57556930 GAGCCTGTAGAATGCCATGCAGG - Intergenic
1184586369 22:45450812-45450834 GTGAGTGGAGAATGCCATGCCGG + Intergenic
1185374716 22:50477017-50477039 GAGAGTGGAGAGTGCGGTGCAGG - Intergenic
950140517 3:10612000-10612022 GAGAGTGTAAAATGCGATGCTGG - Intronic
953043232 3:39273266-39273288 GTGAGTGGAAAATGGAATGCGGG + Intronic
953286460 3:41615101-41615123 TAGAGAATAAAATGGGATGCGGG - Intronic
955990355 3:64620574-64620596 AAAAGTGTAAAATCCGAGGCAGG - Intronic
958524117 3:95230856-95230878 GAGGCTGTAAAAAGCAATGCTGG - Intergenic
966885701 3:184377096-184377118 GAGAGTGGAAAATGGGATGCAGG + Intronic
972405622 4:38743997-38744019 GAAAGTGTAAAATGAGAAACAGG + Intergenic
977092372 4:92694111-92694133 AAAAGTGTAAAATGCTAAGCTGG + Intronic
977721194 4:100242093-100242115 GAGAGGGTAAAATGATCTGCGGG + Intergenic
978275789 4:106948125-106948147 GAGACTGTCAAATGTTATGCAGG + Intronic
980117028 4:128689136-128689158 AAGAATGTAAAATGCAATGATGG - Intergenic
981597564 4:146445092-146445114 CAGAATGTAAAATTCGAGGCAGG - Intronic
981883001 4:149638321-149638343 GAGAGTGTAAAATGGTATGTGGG + Intergenic
989994644 5:50814137-50814159 GATAGTGTCAAATGCTATTCTGG - Intronic
995916671 5:117254790-117254812 GAGAGTAGAAAATGCTATTCAGG + Intergenic
999812499 5:155140886-155140908 AATTGTGTAAAATGCTATGCAGG - Intergenic
1001383761 5:171321077-171321099 TAGAGTATGAAATGGGATGCAGG + Intergenic
1013608271 6:111770996-111771018 TAAAGTGTAAAATGAGAGGCAGG + Intronic
1014330939 6:120062292-120062314 GAGAGAGGAAAATGAGAAGCAGG + Intergenic
1014474415 6:121854571-121854593 GAGAGTTGAAAATGGGATGGGGG + Intergenic
1024051897 7:45629097-45629119 GAGAGAGTAAAATGAGAAGTGGG - Intronic
1029335681 7:99897387-99897409 GAGAGTGTAAAATCCCAGGGAGG - Intronic
1029650921 7:101890830-101890852 GAGTGTGTAAAGTGAGAAGCAGG - Intronic
1041036115 8:53792379-53792401 GAGAGTGTACAGTGAGATCCAGG - Intronic
1044607674 8:94061327-94061349 GAGAGTGTGAAATGCTGTGGCGG + Intergenic
1046190748 8:110791191-110791213 GAGAGGGTAAAATGCTCTGGGGG + Intergenic
1051215474 9:14793193-14793215 GTGAGTGTAAAATGAAATACTGG - Intronic
1056534680 9:87517126-87517148 GAGAGTGAAGAATGCGATTGGGG + Intronic
1058858044 9:109085925-109085947 TAGAGTGAAAAAGGCGATACAGG + Intronic
1186104387 X:6190767-6190789 CAAAGGGTAAAATGAGATGCTGG + Intronic
1186855467 X:13621946-13621968 GAGTGTGTAAATTGGGATGATGG - Intronic
1187573475 X:20529758-20529780 GAGAGTGAAAAAGGAGAAGCAGG + Intergenic
1193333241 X:80258980-80259002 GAGAGGGAAAAAGGGGATGCAGG + Intergenic
1196415430 X:115466065-115466087 CAGAGTGGAATATGAGATGCTGG - Intergenic
1198159693 X:133995294-133995316 GAGGGTGGAAAATGCGAGGAGGG + Intergenic
1198739753 X:139829180-139829202 GAGACTGTAAAATGCTATTTTGG - Intronic
1199297902 X:146180163-146180185 GAGAGTGTAAATTAGGGTGCAGG - Intergenic
1199855331 X:151754804-151754826 GTGCCTGTAAAATGAGATGCTGG - Intergenic