ID: 950140693

View in Genome Browser
Species Human (GRCh38)
Location 3:10613125-10613147
Sequence CTCTGGACACCAAAGCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 2, 1: 3, 2: 22, 3: 54, 4: 263}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950140693 Original CRISPR CTCTGGACACCAAAGCTCAG TGG Intronic
900278460 1:1849134-1849156 CTCTCAACACCAAGGCTCAGGGG + Intronic
900873891 1:5327441-5327463 CTCTGGACACTGATGCTCAGGGG - Intergenic
901208908 1:7513434-7513456 CTCTGGCCTCCAGAGCTAAGAGG - Intronic
901327797 1:8379382-8379404 CTCTGACCACCACAGCTCTGTGG + Intronic
901862909 1:12086219-12086241 CTCAGGCCACCAAAGGACAGAGG + Intronic
903288195 1:22290175-22290197 CTGCAGACACCACAGCTCAGAGG - Intergenic
903844199 1:26267714-26267736 CTCTGGACACAGCAGCTCACTGG - Intronic
904211662 1:28889890-28889912 CTCAGGACACCATAACTCTGTGG - Intronic
904805020 1:33125092-33125114 CTCTGTTCACCCCAGCTCAGAGG + Intergenic
906809066 1:48807919-48807941 CTCTGGACACAGAAAATCAGTGG + Intronic
908510492 1:64846871-64846893 CTCTGGACAGCCAAGGCCAGAGG - Intronic
910655927 1:89617997-89618019 CTGTGGACTCTAAGGCTCAGGGG - Intergenic
911296538 1:96124130-96124152 CTCTGGATGCCATAGCTCAGGGG + Intergenic
912125303 1:106530031-106530053 ATCTGTACACCAAATCTCTGTGG + Intergenic
912384193 1:109263234-109263256 CTCTTGCCCCCAAAGCCCAGGGG - Exonic
912406593 1:109443812-109443834 CTCTGAACACCAAGGCTCAGAGG + Intergenic
912688838 1:111788383-111788405 CTCTGGAAACCCAAGCCCCGTGG - Intronic
912996330 1:114535772-114535794 TTCTGGACACCAAGGCTTGGAGG + Intergenic
913127281 1:115804324-115804346 CTCTGAACACCATAGTTCAGGGG + Intergenic
914709364 1:150198549-150198571 CTCTAGACTCCAAGGCTCAGTGG - Intergenic
915040392 1:152963399-152963421 CACTGGTCAACCAAGCTCAGTGG - Intergenic
915183291 1:154081994-154082016 CATTGGACACCAAAACTCAGTGG + Intronic
917273652 1:173306084-173306106 CTCTGAAATCCAAATCTCAGTGG + Intergenic
917404754 1:174693751-174693773 TTATGGAGTCCAAAGCTCAGTGG + Intronic
918075429 1:181167642-181167664 CTTTGGACAGCAAAGGTCAAGGG + Intergenic
918162002 1:181910119-181910141 CTCTAGAAACCAACTCTCAGCGG + Intergenic
918518186 1:185385601-185385623 ACATGGATACCAAAGCTCAGAGG + Intergenic
920244904 1:204580089-204580111 TGCTGCAAACCAAAGCTCAGGGG - Intergenic
920504595 1:206507298-206507320 CTCTGTACAGTACAGCTCAGAGG - Intergenic
920793064 1:209111007-209111029 CTCTGGTCACCAAAACACATGGG - Intergenic
922476045 1:225907560-225907582 CCCTGCACACCACAGCTCTGGGG + Intronic
923656891 1:235924602-235924624 TTCTTGGCACCAAAGCTCACAGG + Intergenic
924423410 1:243930356-243930378 ATGAGGACACCAAAGCACAGAGG - Intergenic
1063541461 10:6938285-6938307 CTCTGGATACAAAAGACCAGGGG + Intergenic
1064980537 10:21162108-21162130 CTCTGGATACCAAAGATTGGTGG + Intronic
1066564822 10:36710505-36710527 CACTGGACACCAAATTCCAGGGG + Intergenic
1066590763 10:36991834-36991856 GTCTGGAGAACAAAGCTGAGAGG - Intergenic
1067716553 10:48694972-48694994 CCCTGGACTTCAAAGCTCAGGGG - Intronic
1071047580 10:81400848-81400870 TTCTGGGCACCAAAGCTTGGTGG - Intergenic
1072211543 10:93250991-93251013 CTCTGGACACCTCATTTCAGTGG + Intergenic
1072799137 10:98380682-98380704 CTCTGGACACCATCACCCAGGGG + Intergenic
1073293396 10:102424361-102424383 CCTTGGACACCAGAGCTCTGCGG + Exonic
1075350753 10:121722792-121722814 CTCTGGACACCTCATCTAAGTGG + Intergenic
1076475085 10:130746175-130746197 CTTTGGACAGCTCAGCTCAGCGG - Intergenic
1076727031 10:132418774-132418796 CCCTGGGCACCGGAGCTCAGAGG - Intergenic
1077248223 11:1549266-1549288 CTGTGGGGACCAGAGCTCAGAGG - Intergenic
1077554763 11:3220641-3220663 GTGTGGACACCAGAGCTCAAGGG - Intergenic
1081680411 11:44998675-44998697 CTCTGTACCCTAAGGCTCAGAGG + Intergenic
1082918229 11:58463033-58463055 CTTAGGATGCCAAAGCTCAGTGG - Intergenic
1083029833 11:59582372-59582394 CTCTGGATACCAAAGCTCAGTGG + Intronic
1084197222 11:67530332-67530354 ATGAGGACACCAAGGCTCAGAGG - Intergenic
1084439612 11:69165115-69165137 CTCTGGACACCAAGGCTCCGGGG + Intergenic
1084743062 11:71151404-71151426 TTCTGGGCAGCAAAGCTGAGGGG - Intronic
1085274518 11:75289764-75289786 CTCCCTACACCAGAGCTCAGGGG + Intronic
1085897531 11:80657590-80657612 GTCTGGAGAACAAAGCTGAGAGG + Intergenic
1086561826 11:88177153-88177175 ATGTGGAAACCAAGGCTCAGAGG - Intergenic
1087158648 11:94928097-94928119 CTCTGTAAACCAAATCACAGAGG - Intergenic
1088498519 11:110457965-110457987 CTTTGGACACCAAAGCAGAGTGG + Intronic
1088608672 11:111556326-111556348 CTCTGGACACGAAAGCTCTGTGG - Intronic
1089060382 11:115621518-115621540 TCCTGGAAACCAAAGCCCAGAGG + Intergenic
1089165418 11:116472243-116472265 CTCTGGACACCAAAGCTCAGTGG + Intergenic
1089642290 11:119855741-119855763 CTCTGGACAAAAAAGCTCTCTGG + Intergenic
1089663916 11:120004838-120004860 CTCTGGGCGCCAAAACTCAGTGG - Intergenic
1089956758 11:122578427-122578449 CTCTGGACACTGAGGCTTAGTGG - Intergenic
1090910229 11:131111848-131111870 TTCTGGTCACCAAAGATCACAGG + Intergenic
1091348374 11:134871816-134871838 CTCTGGACACCAAGGCTTAGTGG - Intergenic
1091612396 12:2022266-2022288 CTCTGGCCACCTGAGTTCAGGGG + Intronic
1091918238 12:4284406-4284428 CTCTGGAGAACACAGCTCACTGG - Intronic
1092231337 12:6777357-6777379 CTCTGGACACCCCATCCCAGAGG + Exonic
1093520811 12:20047794-20047816 CTCTGGACACTAGGGCTCACTGG - Intergenic
1094066763 12:26369919-26369941 CTTTGGACATTGAAGCTCAGTGG + Intronic
1096411673 12:51381426-51381448 TTCTGGACACATAAGCTCACTGG + Intronic
1096717096 12:53498215-53498237 GTCTGGACAGGAAGGCTCAGGGG + Intronic
1097182255 12:57178211-57178233 CTCTGGCCAGCAAGGCTTAGGGG + Intronic
1098066216 12:66620052-66620074 ATATGGAGATCAAAGCTCAGAGG + Intronic
1098332312 12:69366458-69366480 ATCAGGATACCAAGGCTCAGAGG + Intronic
1098881352 12:75920517-75920539 CTCTGGAAATGTAAGCTCAGTGG + Intergenic
1100380160 12:94054395-94054417 CACTGGACACCAAGGCTCAGTGG + Intergenic
1102687108 12:114733931-114733953 CTCTGAACTCCAGAGCCCAGTGG + Intergenic
1104186573 12:126438355-126438377 GTGTGGAAACTAAAGCTCAGAGG + Intergenic
1104348929 12:128027917-128027939 CTTTGGACACAAAAGTTAAGGGG + Intergenic
1104644723 12:130488787-130488809 CTCTGCAGACCAAAGCCCAGGGG - Intronic
1104888961 12:132130597-132130619 ATGTGGAAAGCAAAGCTCAGGGG + Intronic
1105257746 13:18755617-18755639 TTCTGGGCAGCAAAGCTCAAGGG - Intergenic
1105260400 13:18774925-18774947 TTCTGGGCAGCAAAGCTCAAGGG - Intergenic
1106080542 13:26496957-26496979 CTCTGGTCACCAAAGCAAAGAGG + Intergenic
1106696271 13:32177166-32177188 GTCTAGATACCAAAGTTCAGGGG - Intronic
1107596760 13:41971317-41971339 CTCTGGATGCCAAAGCTCAGTGG + Intergenic
1110305447 13:73982074-73982096 CTCTAGTCAACAAAGCACAGGGG - Intronic
1110797823 13:79660268-79660290 CTTTTGACTCCAAGGCTCAGAGG - Intergenic
1113571229 13:111359646-111359668 CTCTGGACACAGAGACTCAGGGG + Intergenic
1113984823 13:114305336-114305358 CACTCGACACCATGGCTCAGAGG - Exonic
1114131652 14:19800015-19800037 CTCAGGGCCCCAAAGCTCATGGG - Intronic
1114413800 14:22525573-22525595 CCCTGTACTCCAAAGCTGAGGGG + Intergenic
1115754087 14:36516706-36516728 CTCTGGCCGCCTAGGCTCAGCGG - Exonic
1116666436 14:47781602-47781624 CTCTGGAAACTAAAGTTCTGAGG - Intergenic
1116807527 14:49508424-49508446 TTCTGGACTCCAGAACTCAGAGG + Intergenic
1117773389 14:59157301-59157323 CTCTAGACACTGAAGTTCAGTGG + Intergenic
1118571572 14:67200028-67200050 TTCTGGACACCCAGGCTCTGGGG + Intronic
1120414553 14:84202903-84202925 ATCTGGAGACCAAATCCCAGAGG - Intergenic
1121232296 14:92366621-92366643 TTCTGGGCTCCAAACCTCAGCGG - Intronic
1121313070 14:92945616-92945638 CTGGGGACACCAAGGCTCAGTGG - Intronic
1121440302 14:93944690-93944712 CTCTGTCCCCCAAGGCTCAGAGG - Intronic
1121834159 14:97077099-97077121 CACTGGACAGCAGGGCTCAGCGG + Intergenic
1123180585 14:106466658-106466680 CCCTGGACAAGAGAGCTCAGCGG - Intergenic
1202946312 14_KI270726v1_random:30003-30025 CCCTGGACAAGAAAGCTCAACGG + Intergenic
1124376231 15:29130661-29130683 CTCTGGAAACCAAATCTGACCGG - Intronic
1124648572 15:31457980-31458002 CTCTGCCCACAAAAGCTAAGGGG - Intergenic
1126493935 15:49269658-49269680 CTCTGAACCCCAGAACTCAGGGG + Intronic
1127747336 15:61992724-61992746 CTGTGGATACCACAGCTCAGTGG + Intronic
1128283215 15:66414584-66414606 CTCTGGACACTGAAGCTCAGGGG - Intronic
1128991519 15:72264668-72264690 TCCTGGAGTCCAAAGCTCAGTGG + Intronic
1129456146 15:75677061-75677083 GGCTGGACCCCAAACCTCAGAGG - Exonic
1129637879 15:77341520-77341542 CTGTGAACACCAAAGCTCAGTGG - Intronic
1131915254 15:97258087-97258109 CTCTGGACACAAAATCTCTGTGG - Intergenic
1132297196 15:100748317-100748339 CTGTGGACACCCAAGCTGTGGGG + Intergenic
1134570067 16:15283416-15283438 CCCTGGACACCAAGGCTTGGGGG - Intergenic
1134732309 16:16472633-16472655 CCCTGGACACCAAGGCTTGGGGG + Intergenic
1134820839 16:17246062-17246084 CTATAGACACCAAAGTGCAGTGG + Intronic
1134935127 16:18239330-18239352 CCCTGGACACCAAGGCTTGGGGG - Intergenic
1135272034 16:21077816-21077838 GTCAGGAAACCAACGCTCAGAGG + Intronic
1135827426 16:25741797-25741819 GTAAGGACACCAAGGCTCAGAGG + Intronic
1136225501 16:28857716-28857738 CTCCGGACACTGAAACTCAGTGG - Intronic
1136265257 16:29113292-29113314 CTCTGGCCTCCACAGCTGAGAGG - Intergenic
1137759217 16:50927128-50927150 CTCCACTCACCAAAGCTCAGGGG + Intergenic
1139310607 16:66024984-66025006 CTGTAGACACTGAAGCTCAGTGG - Intergenic
1141891389 16:86928964-86928986 CCCTGGTCTCCAAAGGTCAGTGG - Intergenic
1142054063 16:87981224-87981246 CTCTGGCCTCCACAGCTGAGAGG - Intronic
1143076020 17:4343958-4343980 CTCTGGAGACTAAAGCTCTGGGG + Intronic
1143317545 17:6043972-6043994 ACCTGGACACCAAAGTCCAGAGG + Intronic
1143401557 17:6648306-6648328 CTCTGGACACCATGGCACAATGG + Intronic
1144244585 17:13350180-13350202 CTCTGGAAACAAGAGCTCTGGGG + Intergenic
1144393352 17:14817789-14817811 CTCTGTACACCAAAACCCTGTGG - Intergenic
1144487699 17:15681043-15681065 CTATGGACAGCCAAGGTCAGAGG - Intronic
1144613315 17:16745190-16745212 CACTCGACACCATGGCTCAGAGG + Intronic
1144729686 17:17519286-17519308 CTCTGAACACAAAAGGTGAGAGG + Intronic
1144874220 17:18388746-18388768 CTCTGAACACCACCGCTCAGGGG + Intronic
1145132981 17:20375266-20375288 CACTCGACACCATGGCTCAGAGG + Intergenic
1145158008 17:20555672-20555694 CTCTGAGCACCACCGCTCAGCGG - Intergenic
1145772047 17:27500259-27500281 CTCTGGACCCTAATGCTCAAGGG - Intronic
1145776879 17:27535226-27535248 CACTGCAAACCAAGGCTCAGGGG - Intronic
1146595394 17:34163918-34163940 CGCTGGTCACCAAAGATCAGAGG - Intronic
1146986045 17:37219200-37219222 CTCTGGACACTGAAGGTCAATGG + Intronic
1147319622 17:39637861-39637883 CTCTGTACACTGAATCTCAGTGG + Intronic
1147664119 17:42134932-42134954 CTCTGGACACTACAGGTCAGTGG + Intronic
1148384795 17:47226616-47226638 GTATGGACACCAAAACACAGTGG + Intergenic
1148808151 17:50274466-50274488 CTCTACACAGGAAAGCTCAGTGG + Exonic
1150653061 17:67022420-67022442 TTCTGGCCAGCACAGCTCAGAGG + Intronic
1151498869 17:74476060-74476082 CTCTGGACACCAAAGCTTGGAGG - Intronic
1151828906 17:76538299-76538321 CTCTGGACGCCCAGGCTCTGGGG + Intronic
1153181630 18:2441676-2441698 CTCTGGAAACCGAAGCTCAGTGG - Intergenic
1153651037 18:7240494-7240516 TCCTGGACAGCAAGGCTCAGGGG + Intergenic
1154293606 18:13131325-13131347 CTCTGGGCACCAAGGCTTTGGGG - Intergenic
1155276052 18:24188402-24188424 CTCTGGAGACCAAGGCACAAAGG + Intronic
1155779847 18:29817483-29817505 CTCTGTACACCAAACCTCTAAGG + Intergenic
1156278084 18:35603990-35604012 ATCTGCACACCAAACCCCAGTGG - Intronic
1159275940 18:66221711-66221733 CTCTGGACTCCAAAGCTTAGGGG - Intergenic
1159537637 18:69735590-69735612 CCTTGGACATCAAGGCTCAGGGG - Intronic
1161052045 19:2169250-2169272 CTCAGGACACTCAAGCTCAGAGG - Intronic
1161523656 19:4739767-4739789 CTCTGGACCCCAAAGCTTGGTGG + Intergenic
1163547700 19:17949397-17949419 CTCTGGGCACAAAAGCACACAGG + Intergenic
1164628682 19:29746719-29746741 CACAGGACCCCAAGGCTCAGGGG + Intergenic
1164788924 19:30959603-30959625 CTCTGGAGATCAAAGCCCTGGGG - Intergenic
1165093339 19:33397671-33397693 GTCTGGGCAGCAAAGCCCAGTGG + Intronic
1165146293 19:33732935-33732957 CTCTAGACACTGAGGCTCAGAGG - Intronic
1165406926 19:35636736-35636758 CAAGGGACACCAAGGCTCAGAGG + Intronic
1167751240 19:51381481-51381503 CTCTGGACACTGAAGCTCAGTGG + Intronic
925814319 2:7732787-7732809 CGCTGGACACCAAAGCTCAGGGG - Intergenic
927732164 2:25483145-25483167 CTCTGGTACCCACAGCTCAGTGG - Intronic
928832584 2:35505807-35505829 TTCTGGATACCAAAACTTAGTGG + Intergenic
929028421 2:37627776-37627798 TTCTGGAGAACAAAGCTCACTGG - Intergenic
931075919 2:58711278-58711300 CTGAGGTCACCAAAGCTCAGAGG - Intergenic
932055219 2:68436745-68436767 CTCTCCACACCATGGCTCAGAGG - Intergenic
932426843 2:71643167-71643189 TTCTAGACACCAGAGCTAAGAGG + Intronic
934731759 2:96663329-96663351 CAGTGGACACCACAGCACAGAGG - Intergenic
934781555 2:96972484-96972506 CTCTCGCCCCCAAACCTCAGTGG + Intronic
934792433 2:97072925-97072947 GTGTGGACACCAAAGCAGAGAGG - Intergenic
934814185 2:97310784-97310806 GTGTGGACACCAAAGCAGAGAGG + Intergenic
934823509 2:97397699-97397721 GTGTGGACACCAAAGCAGAGAGG - Intergenic
935749251 2:106215873-106215895 CTCTAGACACTGAGGCTCAGGGG + Intergenic
936054273 2:109249378-109249400 ATGAGGAAACCAAAGCTCAGAGG + Intronic
936229481 2:110687512-110687534 CTCTGAACACCAAAGCTCAGTGG - Intergenic
936478693 2:112865032-112865054 CTCTGGACATTGGAGCTCAGAGG + Intergenic
937364627 2:121252655-121252677 CTGGGGCCACCAAAGCTCAAAGG + Intronic
937840032 2:126515543-126515565 TTCTGGACACAGAGGCTCAGTGG - Intergenic
937873002 2:126799081-126799103 CACTGGACCCCAACGTTCAGTGG - Intergenic
937888787 2:126919220-126919242 CTCTGGATACCGAGGCTCAGTGG - Intergenic
937920627 2:127127030-127127052 GTCTGGACACTGAAGCTCAGTGG + Intergenic
938384639 2:130855565-130855587 ACCTGGGCACCAAGGCTCAGGGG - Intronic
939732935 2:145807922-145807944 CTTTGGACATGGAAGCTCAGTGG + Intergenic
941900366 2:170672265-170672287 CTCTGCCCTCCAAAGCTGAGAGG - Intergenic
944481434 2:200161428-200161450 CTCTGGACACTGAAGCTCAGCGG - Intergenic
945273206 2:207962300-207962322 CTCAGGACACTGAAGCTCAGAGG + Intronic
946781992 2:223201423-223201445 CTATGTACCCCAAAACTCAGTGG + Intergenic
947697607 2:232205044-232205066 CTCTTGACAGCAAAACTCAGAGG - Intronic
947766301 2:232640037-232640059 CTTTGGCCACCAACACTCAGGGG - Intronic
948260019 2:236596936-236596958 ATGTGGAAACCAAAGCTCCGAGG - Intergenic
948900528 2:240954609-240954631 CTCTGGACACCAAAATGCAGTGG - Intronic
1169408556 20:5347385-5347407 CTGAGGACACCGAGGCTCAGAGG + Intergenic
1169883854 20:10376164-10376186 CTCTGGACACCGAGGTTCCGTGG - Intergenic
1171425065 20:25043840-25043862 ATGAGGACACCAAAGCCCAGAGG + Intronic
1173306195 20:41852363-41852385 CTGTAGACACCAAAGCTAAGAGG - Intergenic
1173666306 20:44765799-44765821 CTCGGGACAACAAAGAACAGAGG + Intronic
1175110222 20:56642637-56642659 CCCTGGCCAGCTAAGCTCAGTGG + Intergenic
1175697167 20:61111255-61111277 CTTTTGACCCCAAAGCTCAAGGG - Intergenic
1175721320 20:61289280-61289302 GTAGGGACACCAAAGCTCACAGG + Intronic
1175767965 20:61604154-61604176 CTTTGGACACAAAAGCTAATCGG - Intronic
1175942819 20:62545839-62545861 CTTTGGACACTGGAGCTCAGAGG - Intergenic
1176843740 21:13860646-13860668 TTCTGGACAGCAAAGCTCAAGGG - Intergenic
1176846413 21:13879966-13879988 TTCTGGGCAGCAAAGCTCAAGGG - Intergenic
1177443780 21:21165290-21165312 TTCTGGACACCCAAGCTCAGAGG - Intronic
1178253756 21:31031489-31031511 GTTGGGAAACCAAAGCTCAGAGG - Intergenic
1178552834 21:33556010-33556032 CTCTGCACACTAAAAATCAGGGG - Intronic
1183345913 22:37307556-37307578 CTCTGGACCCCTGAGCTCTGAGG + Intronic
1184558793 22:45248994-45249016 CTCTGCTCACCAAAGCTTTGGGG - Intergenic
1184667878 22:45998047-45998069 ATCTGGACCCCAGACCTCAGGGG + Intergenic
949100165 3:133738-133760 CCCTGGACACCAAAGCTTACTGG - Intergenic
949792782 3:7811605-7811627 CTCTGGACACTAAAGCTCAAGGG + Intergenic
950140693 3:10613125-10613147 CTCTGGACACCAAAGCTCAGTGG + Intronic
950333086 3:12172619-12172641 CTGTGAACACTGAAGCTCAGAGG - Intronic
950631967 3:14287818-14287840 TTCTGGAACCCACAGCTCAGAGG + Intergenic
953422163 3:42762538-42762560 CCCTGGACACCAAGACTCAGGGG + Intronic
956391107 3:68773419-68773441 CTTTGGACACCAAAGCTTGGTGG - Intronic
956806704 3:72821369-72821391 CTCATGAAACCAGAGCTCAGGGG + Intronic
956807206 3:72827392-72827414 CCTTGGACACCACAGCGCAGAGG + Intronic
957939701 3:86990375-86990397 CTGTGGTCACCGGAGCTCAGAGG - Intronic
960591020 3:119365475-119365497 CTCTGGACACCGATGGACAGAGG - Intronic
963057895 3:141202166-141202188 CTCTGAACACCATGGCCCAGAGG + Intergenic
963135548 3:141900335-141900357 CTCTGGACACTGAAGTTCAGTGG + Intronic
963922417 3:150918659-150918681 CTCTGCTCACCACAGCACAGCGG + Intronic
964352313 3:155815361-155815383 CTGTGGACACCAAAGCTTGGGGG + Intergenic
964776700 3:160287096-160287118 TTCTGAACGCCAAAGCTCAGCGG + Intronic
964915177 3:161832206-161832228 CTCTGGACACTGAAGCTCAGTGG - Intergenic
965346762 3:167560467-167560489 CTCTAGACACTAAAGCTGAATGG - Intronic
965408825 3:168304167-168304189 CTCTGGACACTGAGGCTCAGCGG - Intergenic
965686959 3:171314339-171314361 CTCTTGAGACCACTGCTCAGAGG - Intronic
966887266 3:184383563-184383585 CACTGGAGACCAAGCCTCAGCGG + Exonic
967281911 3:187831313-187831335 CTGTGGACACCAGTGTTCAGAGG - Intergenic
967973077 3:195013314-195013336 CTCATGTCACCAAAACTCAGGGG + Intergenic
968707034 4:2084013-2084035 CTCTGGCCACCAGCCCTCAGGGG - Intronic
969371366 4:6733450-6733472 CTGTGCTCACCAAACCTCAGAGG + Intergenic
971686483 4:29776191-29776213 TTCAGGACACCAAAGCACAAAGG + Intergenic
972116765 4:35645483-35645505 GTCAGGAAACCAAGGCTCAGAGG - Intergenic
972528216 4:39937067-39937089 CTGTGAACACTAAAGCTCAGGGG - Intronic
973367201 4:49217334-49217356 TTCTGGACAGCAAAGCTGAAGGG - Intergenic
975849812 4:78560551-78560573 TTCTGGACACTGAGGCTCAGAGG - Intronic
976022947 4:80652770-80652792 CTCTGGACACCAAAACAAGGAGG - Intronic
976630129 4:87228039-87228061 CTCTGGATTCCAAAGCTTGGTGG + Intronic
976783409 4:88787853-88787875 CTCTGGAGGTCAAAGTTCAGAGG - Exonic
977772440 4:100875711-100875733 CTCTGGACACTGAAGTTCAGTGG - Intronic
980049026 4:128020494-128020516 CTCTGGACTGCAAGGCTCAGGGG - Intronic
980352701 4:131701680-131701702 CTCTGCACGCCAAAGGTTAGTGG - Intergenic
981295489 4:143126340-143126362 CTCTAGACACTGAAGCTCAGTGG - Intergenic
981362804 4:143866717-143866739 CTGTGGACAGCAGAGCTAAGAGG + Intergenic
981373530 4:143987517-143987539 CTGTGGACAGCAGAGCTAAGAGG + Intergenic
981520095 4:145652232-145652254 CTTGGGACACTAAAGCTCAGGGG - Intronic
983712942 4:170742323-170742345 TTCTGGATACCAAAGTTCGGTGG - Intergenic
986254351 5:6089358-6089380 CTCTGTACACCAATGTTCTGTGG + Intergenic
986424145 5:7613584-7613606 CTTTGCACACCAAAGCTCAGTGG - Intronic
990703752 5:58503628-58503650 CCATGGAAACCAAAGCTCGGTGG + Intergenic
993396120 5:87391118-87391140 GTCTGTACACCAAGGCTCAGAGG - Intronic
993590216 5:89785339-89785361 ATCAGGACACCTAAGATCAGAGG + Intergenic
994560600 5:101366206-101366228 TTCTGGACCCCAATACTCAGGGG + Intergenic
996144373 5:119955627-119955649 CTCTGGATGCTGAAGCTCAGTGG + Intergenic
997775301 5:136599046-136599068 CTCTAGACAACAAGGCTCAGTGG - Intergenic
998033147 5:138890644-138890666 CTCTGAACACTGAAACTCAGTGG - Intronic
1000262608 5:159602399-159602421 CTCTGGAAACCAAGGCTCAAAGG - Intergenic
1000391586 5:160728427-160728449 CTCTGGATACCATGGCTCAAGGG + Intronic
1001644220 5:173268405-173268427 CTGAGGACAGCAAAGCCCAGTGG + Intergenic
1001719870 5:173848090-173848112 CTCTGAAGACCCAAACTCAGGGG + Intergenic
1001923851 5:175621995-175622017 CTCTGGACACCAAGGCTTGGTGG - Intergenic
1002051473 5:176573993-176574015 CTGAGGACACTGAAGCTCAGGGG + Intronic
1003048607 6:2760402-2760424 CTCTGGACATAGAAACTCAGTGG - Intergenic
1003168097 6:3698997-3699019 CTCTAGACACCAAAGCTCATTGG + Intergenic
1003497996 6:6681250-6681272 GTGTGAACATCAAAGCTCAGAGG - Intergenic
1003778840 6:9399380-9399402 CACTGCAGACCAAATCTCAGAGG + Intergenic
1005356789 6:24992015-24992037 CTCTTGACACCAAAGCCCTAGGG + Intronic
1006576167 6:35048081-35048103 CTCTGGAAGCCAGAGCTCCGTGG + Intronic
1007249533 6:40486409-40486431 CTCTGTACTCCAGGGCTCAGGGG - Intronic
1007391584 6:41552485-41552507 CTCTGGGAAAGAAAGCTCAGAGG - Intronic
1007792726 6:44321624-44321646 CTCTGAAAACCACCGCTCAGAGG - Intronic
1008952969 6:57181105-57181127 CTCTCCACAGCAAAGCACAGGGG - Intronic
1010572368 6:77492706-77492728 CTGTGGACTTCAAAGCTCCGGGG + Intergenic
1012678333 6:102145903-102145925 ATTTGTACACCAAACCTCAGTGG - Intergenic
1013336850 6:109172258-109172280 ATCTGGACACCAAGGCTTGGTGG - Intergenic
1016574019 6:145547374-145547396 CTCTGGTCACTACAGTTCAGTGG + Intronic
1017047940 6:150364758-150364780 GTGTGGACACCAGAGCTCCGGGG + Intergenic
1017781462 6:157718820-157718842 CTCTGCAAACCAAGGCTCTGAGG - Intronic
1017999889 6:159569746-159569768 CTCTGGACACTGAAGCTCAGTGG - Intergenic
1019368984 7:650985-651007 CTCTGGACCAGGAAGCTCAGAGG + Intronic
1019538537 7:1541134-1541156 CTCGGGTCACCAGAGCACAGGGG - Exonic
1020154702 7:5713214-5713236 CTCTGGAAAGCAGAGCTGAGTGG + Intronic
1020401769 7:7786728-7786750 ATCTGGAAACCAGAGCACAGTGG - Intronic
1020613314 7:10427640-10427662 TCCTGGACACCAAGGCTCAGGGG - Intergenic
1022031352 7:26494041-26494063 CTCTGGTCATTAAATCTCAGGGG - Intergenic
1022628927 7:32067034-32067056 TTCTGCACACTAACGCTCAGAGG - Intronic
1024102574 7:46047868-46047890 CTCGTGACAGCAAAGATCAGCGG - Intergenic
1024858203 7:53806258-53806280 CCCTGGACACTAATGCTCAGTGG - Intergenic
1026061420 7:67030091-67030113 CCCTGGACACTGAAGCTCAGTGG - Intronic
1026422171 7:70250938-70250960 ATCTGTACACCAAACCTCTGTGG + Intronic
1026716930 7:72797343-72797365 CCCTGGACACTGAAGCTCAGTGG + Intronic
1027832909 7:83203249-83203271 CTCTGGACATGAAAGGTAAGTGG - Intergenic
1030213970 7:107024238-107024260 CTCTTGATTTCAAAGCTCAGTGG - Intergenic
1031591929 7:123604092-123604114 CTCTGGAAGAAAAAGCTCAGTGG + Exonic
1031641912 7:124174931-124174953 TTCTGAACATCAAAGCTCAGTGG - Intergenic
1032109426 7:129062887-129062909 CTCTGAACACCAAAGTTCAGTGG + Intergenic
1032625882 7:133590880-133590902 CGATGGACAGCAAAGCTAAGAGG + Intronic
1034282618 7:149864577-149864599 CTCTTGCCACCAAAACTCAGGGG - Exonic
1035205155 7:157290132-157290154 CCCTGGGCACCAAAGCCCTGGGG - Intergenic
1035851974 8:2929425-2929447 CTCTGGAGGCCAAAGGTCATGGG + Intergenic
1035987250 8:4448057-4448079 CACTGGACAGCTAAGCTTAGGGG - Intronic
1037186301 8:16067616-16067638 CTATGAACATCAAGGCTCAGTGG - Intergenic
1039488741 8:37931777-37931799 CTCTGGACACCAAGGCTTAGGGG - Intergenic
1039883424 8:41641343-41641365 CTCTGGAGTCCAGATCTCAGAGG + Intergenic
1040430855 8:47340796-47340818 TTCTGGATACTAAAGCTCAGTGG + Intronic
1041671071 8:60492473-60492495 CTCTGGACACCTAGGCTTGGAGG - Intergenic
1041905206 8:63025408-63025430 CTCTAGACACCAAAACTCACTGG + Intronic
1044372321 8:91426628-91426650 AACTAGACACCACAGCTCAGAGG + Intergenic
1045856128 8:106767593-106767615 ATAAGAACACCAAAGCTCAGAGG - Intronic
1047291301 8:123532588-123532610 CTCTGGACCTCAAATCACAGAGG + Intronic
1051123029 9:13773108-13773130 CTCTGGGCAACAAGGCTGAGAGG + Intergenic
1051664587 9:19456791-19456813 CTTTGAAGACCAGAGCTCAGGGG + Intergenic
1051890804 9:21940801-21940823 CTCTGAACCCCAAAGTTTAGAGG + Intronic
1052517253 9:29498927-29498949 TTCTGGACACCTATGCTCATGGG + Intergenic
1052974078 9:34399095-34399117 CTCTGGACACCAATCCTGGGAGG - Exonic
1053189389 9:36049198-36049220 CTCTGGACATAGAAGCTCAGTGG - Intronic
1057533989 9:95880341-95880363 CTCTGGACAGCAATGCTTTGTGG - Intronic
1058012863 9:99997859-99997881 TACTCGACACCACAGCTCAGAGG + Intronic
1061634647 9:131899609-131899631 CGGTGGACAGCAAAGCTCAATGG + Intronic
1061793783 9:133071768-133071790 CTCTTGATACCAAGGCTCATGGG - Exonic
1203695902 Un_GL000214v1:96676-96698 CTCTGGATGGCAAAGCTCCGGGG + Intergenic
1203640371 Un_KI270751v1:7387-7409 CTCTGGATGGCAAAGCTCCGGGG - Intergenic
1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG + Intergenic
1186688913 X:11953974-11953996 CTCTGGACACCAAAGGATGGAGG + Intergenic
1187935773 X:24334516-24334538 TTCTGGACACCAAGGCTCAGGGG - Intergenic
1188826256 X:34839119-34839141 ATCTGTACACCAAACCTCCGTGG - Intergenic
1189276951 X:39793612-39793634 CTCTTGAGAGCAAAGTTCAGTGG - Intergenic
1189315288 X:40051117-40051139 CTCTGGAAACCAAAGCAGACTGG - Intronic
1190246268 X:48692550-48692572 ATGCGGAAACCAAAGCTCAGAGG - Intergenic
1195312787 X:103649280-103649302 CTCTGGACACCTGATCTAAGTGG + Intergenic
1195313140 X:103653423-103653445 CTCTGGACACCTGATCTAAGTGG + Intergenic
1196007010 X:110847562-110847584 CTGTGTAAACGAAAGCTCAGTGG - Intergenic
1199305663 X:146264843-146264865 GTCTGGACCAGAAAGCTCAGAGG + Intergenic
1201146797 Y:11069163-11069185 TTCTGGGCAGCAAAGCTGAGGGG - Intergenic