ID: 950141289

View in Genome Browser
Species Human (GRCh38)
Location 3:10617831-10617853
Sequence TGCCCCAAGGGAGCACGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950141286_950141289 1 Left 950141286 3:10617807-10617829 CCAGGAAGACGCAAAGCTGGTGT 0: 1
1: 0
2: 0
3: 13
4: 125
Right 950141289 3:10617831-10617853 TGCCCCAAGGGAGCACGAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 124
950141283_950141289 23 Left 950141283 3:10617785-10617807 CCAGCAACATGAGTGTGCAGGAC 0: 1
1: 0
2: 0
3: 9
4: 108
Right 950141289 3:10617831-10617853 TGCCCCAAGGGAGCACGAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950141289 Original CRISPR TGCCCCAAGGGAGCACGAGC TGG Intronic
900405032 1:2489180-2489202 GGCCCCAAGGCAGAAAGAGCAGG - Intronic
902679970 1:18036438-18036460 TGCCCCAAGAGAGAAGTAGCCGG + Intergenic
903169575 1:21543849-21543871 TGCCTCCAGGGAGCATCAGCTGG - Intronic
912454382 1:109788034-109788056 TGCGACAAGGCAGCATGAGCTGG + Intergenic
913445212 1:118943813-118943835 GGCTCCCAGGGAGCACGAGCAGG + Intronic
914665854 1:149832141-149832163 TGCGCCAAGGGAGGACGGGAGGG - Intergenic
914669911 1:149861653-149861675 TGCGCCAAGGGAGGACGGGAGGG + Intronic
918195099 1:182213733-182213755 TGCCCTAAGGGAGAAAGGGCAGG + Intergenic
919789155 1:201279152-201279174 TGCCCCATGAGAGCAAGATCTGG + Intergenic
920367309 1:205455053-205455075 TGCCCCCGGGGAACAAGAGCTGG - Intronic
920685955 1:208109163-208109185 TGCCCGAATGGAGCACCAGTTGG + Intronic
1063387188 10:5623313-5623335 GGCCACACGGGGGCACGAGCGGG - Intergenic
1064870504 10:19931711-19931733 TGCCCCACAGGAGCATCAGCTGG + Intronic
1066010382 10:31188818-31188840 TGCCACAAGGGAGAAGCAGCTGG + Intergenic
1066222265 10:33346711-33346733 TGCTCCCAGGGAGCACGAAATGG - Intergenic
1067960947 10:50848784-50848806 GGACCCAAGGGAACAGGAGCAGG - Intronic
1070736164 10:78865229-78865251 TCCCCAAAGGGAGCAGGGGCAGG - Intergenic
1072549108 10:96463690-96463712 GGTCCCAAGGGAGCTGGAGCTGG - Intronic
1075091093 10:119444537-119444559 GGCCCCAAGGGGGCATGGGCTGG - Intronic
1075681894 10:124339246-124339268 TGCCCCAAGTGGGCTGGAGCTGG + Intergenic
1075995511 10:126873468-126873490 TTCCCCAGGGGAGCAGGAGGGGG - Intergenic
1076735155 10:132455693-132455715 TGTGCCAAGGGAGCACGAGTTGG + Intergenic
1086229803 11:84554792-84554814 TGCTCCAAGAGAGCACAAGAAGG + Intronic
1089502368 11:118940165-118940187 TGCCCTAAGGGTGCAGGAGATGG - Intronic
1092530388 12:9339322-9339344 AGCCCCAGGGGAGCAGGGGCTGG + Intergenic
1097262196 12:57726209-57726231 CGCCCCTAGGGGGCACAAGCGGG + Intronic
1101871085 12:108566117-108566139 TGCCCCAAGGGACCAGGTTCAGG + Intronic
1102036163 12:109771595-109771617 AGCCCCTGGGGAGCAGGAGCCGG + Intergenic
1102301029 12:111771456-111771478 TTTCCCAATGGAGCTCGAGCTGG - Intronic
1102453437 12:113057293-113057315 TGCCCCAAGGGAAAGCGGGCGGG + Intronic
1104537235 12:129629291-129629313 TGCCACCAGGGAGCATTAGCTGG - Intronic
1112301964 13:98239200-98239222 AGCCCCAAGGGAACAAGTGCCGG + Intronic
1113473231 13:110561568-110561590 TGCGCCCAGGGCGCACGAGCCGG - Exonic
1115643426 14:35350200-35350222 GGCCCCAAGGAAACACGTGCTGG - Intergenic
1117191025 14:53292007-53292029 CTTCACAAGGGAGCACGAGCCGG + Intergenic
1118086796 14:62426837-62426859 TGATCCAGGGGAGCACCAGCTGG + Intergenic
1118751395 14:68810241-68810263 TTCCCTAAGGGAGCAGGAGTTGG + Intergenic
1119208441 14:72812065-72812087 TGCCCCAAGTGAGCTCCAGGAGG + Intronic
1121422347 14:93824596-93824618 TGCTCCCAGGGAGCCCCAGCAGG + Intergenic
1122437823 14:101711599-101711621 TGCCACAGGGGAGCAGCAGCTGG + Intergenic
1122977803 14:105178154-105178176 TGGCCCAAGGAAGCATCAGCAGG - Intronic
1124803258 15:32856045-32856067 TGCACCAAGGGAACAGCAGCTGG + Intronic
1126422529 15:48489975-48489997 TGCCCCGACGGAGCAGCAGCAGG + Exonic
1132292639 15:100714088-100714110 GGCCCCCTGGGAGCACGTGCAGG + Intergenic
1132973175 16:2698772-2698794 GGCACCAAGGGAGCTCCAGCAGG - Intronic
1133271581 16:4613233-4613255 TGCCCCAAGGCAGCCCCACCCGG - Intronic
1139700368 16:68704394-68704416 TCCACCAAGGGAGCGCTAGCAGG - Intronic
1142066655 16:88066832-88066854 TCTCCCAAGGGAGCACGAGAGGG - Intronic
1142347983 16:89566042-89566064 CGCCCCCGGGGAGCACGGGCTGG + Exonic
1144411424 17:15005684-15005706 TGTCCCAAGGAAGCACACGCTGG - Intergenic
1156298914 18:35818212-35818234 TGCACCCAGGGAGCACCACCAGG + Intergenic
1160858013 19:1226104-1226126 TGCCCCAGGGGAGCACGGGAGGG + Intronic
1160858912 19:1229444-1229466 CGCCGCAAGGGCGCACGCGCGGG + Exonic
1163145817 19:15379031-15379053 TGTCCCAAGCCAGCACGCGCCGG + Intronic
1163222283 19:15930264-15930286 AGCCCCAAGAGAGAAGGAGCAGG - Intronic
1165955313 19:39498860-39498882 GGCCCCAAGGGACCAAGGGCGGG - Intergenic
1167866782 19:52335416-52335438 TGGCCCAAGGCAGAACGAACGGG - Intergenic
1167866944 19:52336483-52336505 TGGCCCAAGGCAGAACGAGCGGG - Exonic
929056475 2:37881319-37881341 TGCCCCAAGGTTGCAGGAGTTGG - Intergenic
929663950 2:43818831-43818853 TGCCTCAAGGGATCATGAGAAGG - Intronic
932505009 2:72220391-72220413 TGCCCCCAGGGGGCATGAGGAGG - Intronic
932594496 2:73085794-73085816 TGCCACATGGGAGCACTAGAGGG + Intronic
934614149 2:95761076-95761098 TGCCCCATGGGGGCAAGAGTGGG + Intergenic
934840540 2:97621554-97621576 TGCCCCATGGCAGGATGAGCAGG + Intergenic
936470608 2:112795733-112795755 CTCCCCAAGAGAGAACGAGCAGG + Intergenic
937204090 2:120224543-120224565 TGCCCCAGGCGGGCATGAGCAGG + Intergenic
937320494 2:120957988-120958010 TGGCCCAAGGGAGGGCCAGCCGG + Intronic
938107975 2:128546268-128546290 TGCCCATAGGGAGGATGAGCTGG + Intergenic
938231871 2:129668678-129668700 TACCACAAGGGACCAAGAGCAGG + Intergenic
940116863 2:150219228-150219250 TGCCCCATGGGAGGTGGAGCCGG + Intergenic
945993183 2:216413174-216413196 TGGCCAAAGGGAGCCCCAGCAGG + Intronic
947526340 2:230878783-230878805 TGCCCCCCAGGAGCACAAGCAGG + Exonic
947916790 2:233837855-233837877 CTCCCCCAGGGAGCACAAGCTGG + Intronic
948547530 2:238743359-238743381 GGCCCCAAGAGAGCAAGCGCTGG - Intergenic
1168881849 20:1212971-1212993 TGACCCAAGGAAGCAAAAGCAGG + Intergenic
1169962576 20:11177916-11177938 TTCCCCAAGGGAGAGAGAGCTGG - Intergenic
1173096290 20:40031794-40031816 TGGCCCAAGGGAGAACAAGATGG - Intergenic
1175384167 20:58583696-58583718 TACCCCAGGGGAGCAGGAGCAGG + Intergenic
1175929036 20:62484955-62484977 TGCACCCAGGGAGCACTGGCTGG + Intergenic
1181616959 22:24061449-24061471 TGCCCCAGGGGAGCATGGCCTGG - Intronic
1183060439 22:35333403-35333425 GGCCCCAAGTGAGGCCGAGCCGG + Exonic
1183357314 22:37366703-37366725 TGCACCAAGGGAGGAGGAGGAGG - Intergenic
1184596524 22:45517378-45517400 TGCCCCAAGGGAGGAGCGGCCGG - Intronic
1184774899 22:46618268-46618290 TGCCCCGGGGGAGCACCAGGCGG + Intronic
950141289 3:10617831-10617853 TGCCCCAAGGGAGCACGAGCTGG + Intronic
957193733 3:77040971-77040993 TGCCCCCAAGGAGCCCGTGCCGG - Intronic
961053372 3:123766505-123766527 TGCCCCAGGGGAGCAGCAGTAGG + Intronic
961648188 3:128403800-128403822 TGCTCCAAGGGAGGAGGAGGAGG - Intronic
961762688 3:129183458-129183480 GGCCCCAAGGGCGCACGGGCGGG + Intronic
962273394 3:133994643-133994665 CCCCCCAAGGGTGCATGAGCAGG - Intronic
962463904 3:135639312-135639334 TGGCCCAGGGGAGTACCAGCAGG - Intergenic
962463970 3:135639677-135639699 TGGCCCATGGGGGCACCAGCAGG - Intergenic
975655931 4:76641326-76641348 TGTCCCAAGGGAGGATGAGCAGG - Intronic
981784300 4:148460629-148460651 TGCCCCAGAGGAGCGCGAGAAGG - Intergenic
983768946 4:171523752-171523774 TGCCCCTGGGGAGCAGGAACTGG + Intergenic
1202762859 4_GL000008v2_random:126859-126881 TGGCCCAAGGCAGGACAAGCTGG - Intergenic
985485237 5:145092-145114 TGGCCCCAGAGAGCAAGAGCTGG - Intronic
985636490 5:1038226-1038248 TGCCACAGTGGAGCACGAGGTGG + Exonic
987092930 5:14523448-14523470 TGGCCAATGGGAGCACCAGCAGG - Intronic
988034590 5:25809820-25809842 TGACACAAGGGAGCAGAAGCAGG + Intergenic
989379192 5:40797664-40797686 TGAGCCAAGGGAGCACAACCCGG + Intronic
990342657 5:54839026-54839048 TGCACCAGGGGAGAACCAGCTGG + Intergenic
992515988 5:77492498-77492520 TGCTCCGAGTGAGCACGCGCGGG + Exonic
995406722 5:111806217-111806239 TGACCCAAGGGGGCAAGAGGTGG - Intronic
1001543715 5:172557120-172557142 TGCCAAAAGGGAGCAGAAGCAGG - Intergenic
1002790394 6:433421-433443 TGCCCCAGGGCAGCATGAGGAGG + Intergenic
1003654962 6:7998535-7998557 TGCCCCAAGGGACAGCGAGTGGG - Intronic
1005853655 6:29843478-29843500 TGCCCCAAGGGGGCAGCTGCTGG + Intergenic
1007284600 6:40738399-40738421 TGTCCCCAGGGAGCCCCAGCCGG - Intergenic
1007412671 6:41673972-41673994 GGCCCCCAGGGAACAGGAGCAGG + Intergenic
1010400049 6:75438147-75438169 TGCCCCAAAAGACCACTAGCAGG - Intronic
1013626315 6:111940746-111940768 TGCCCAAAGGGAGCTCTGGCAGG + Intergenic
1023764546 7:43498369-43498391 TGCCCCAAGGGATCAACATCTGG - Intronic
1023905598 7:44519641-44519663 GGCCCTAAGGGAGCTCGTGCTGG - Intronic
1025864265 7:65365673-65365695 TGCCCCCAGGAAGCACCTGCAGG + Intergenic
1026845408 7:73696326-73696348 TGCTCCCTGGGAGCACGAGATGG - Intronic
1030316965 7:108125976-108125998 TGCCCCAAAGGAGCAGCAGGAGG + Intronic
1038036478 8:23690911-23690933 TGGCCCAAGGGATCACCAGGGGG + Intergenic
1040743883 8:50616530-50616552 TGCTCACAGGAAGCACGAGCAGG + Intronic
1047781618 8:128116299-128116321 TTCACCAAGGGACCATGAGCAGG + Intergenic
1047917918 8:129603058-129603080 TGCTCCAAGGCTGCACGAGCAGG + Intergenic
1048374246 8:133808791-133808813 TGCCCCAAGGAAGCAGCAGTGGG + Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049285725 8:141774214-141774236 TGACCCCAGGGACCACGTGCTGG - Intergenic
1049402630 8:142436373-142436395 TGCTGCAAGGCAGCACTAGCTGG - Intergenic
1050614494 9:7388022-7388044 AGCCCCAAGAGAGCTCGTGCAGG + Intergenic
1057075254 9:92135163-92135185 TGCCCCAGGGGTGCACAATCTGG - Intergenic
1057669646 9:97076853-97076875 TGCCCCGTGGGCGCAGGAGCAGG - Intergenic
1060527171 9:124327222-124327244 TGCCCTGAGGGAGCAGGACCTGG + Intronic
1061188547 9:129069143-129069165 AGGCCCGGGGGAGCACGAGCTGG + Intronic
1061540070 9:131273407-131273429 TGCACCCAGGGAGAATGAGCTGG + Intronic
1062119861 9:134828340-134828362 TGCCCCATGGCAGCGTGAGCTGG + Intronic
1203543622 Un_KI270743v1:111740-111762 TGGCCCAAGGCAGGACAAGCTGG - Intergenic
1186944794 X:14553780-14553802 TGCCCAAGGGGAGAAGGAGCTGG - Intronic
1200150661 X:153949878-153949900 AGCCCCAGGGGAGCTGGAGCAGG + Intronic