ID: 950141603

View in Genome Browser
Species Human (GRCh38)
Location 3:10619844-10619866
Sequence GGGTGCACACAGATGCTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950141603 Original CRISPR GGGTGCACACAGATGCTAGT GGG Intronic
900198508 1:1390262-1390284 GGGGGCACACAGGTGCTGGATGG - Exonic
904345744 1:29867778-29867800 GGATGCAGTCAGATGGTAGTTGG + Intergenic
906165068 1:43680000-43680022 AGGCTCACACAGCTGCTAGTTGG + Intronic
906902372 1:49849090-49849112 GGGTACACACAGAAGCTCTTAGG - Intronic
907176365 1:52527118-52527140 AGGTACAAATAGATGCTAGTTGG - Intronic
909303889 1:74047634-74047656 GTGTGCTCACAGATGGTAGAGGG - Intronic
911469429 1:98298715-98298737 GGGTACACACACAAGATAGTTGG + Intergenic
915633098 1:157167191-157167213 GGCTGCACTGAGATGCTAATAGG - Intergenic
1064428817 10:15254148-15254170 GGGTGGACACAGATGGCAGAGGG + Intronic
1074555552 10:114485928-114485950 GGGTTCACACTGATGTTGGTAGG - Intronic
1075865369 10:125714233-125714255 GGGAGCACACAGAGGATAATGGG - Intergenic
1076730743 10:132437666-132437688 GGGTGCCCACAGAGGGAAGTGGG - Intergenic
1080450513 11:32375100-32375122 GGATGCAGACAGATACAAGTAGG + Intergenic
1081789186 11:45770889-45770911 TGGTGCAGACAGAAGCAAGTAGG + Intergenic
1083068438 11:59949938-59949960 GGGTCTATACAGATGCCAGTAGG - Intergenic
1083660304 11:64248951-64248973 GGGTGCACACAGATTAAAGGGGG + Intergenic
1096693754 12:53336096-53336118 GGGTGCCCACAGATGCCTATGGG - Intronic
1101496652 12:105260817-105260839 GGGTGCACATAGATGGGAGGAGG - Intronic
1105602498 13:21899860-21899882 GGGTGGACACAGAGGCCAGTTGG - Intergenic
1105831354 13:24165310-24165332 GGGTGCAGATGGATGCTGGTGGG - Intronic
1105847192 13:24303334-24303356 GTGTCCACACAGATGCTAACTGG + Exonic
1109249122 13:59997153-59997175 GGGTGCAAACATATGGTAGAAGG - Intronic
1109520970 13:63510506-63510528 GTGTGCACATACATGCAAGTGGG + Intergenic
1112703986 13:102045172-102045194 GTGTGCACATAGATGCTTGATGG - Intronic
1113542813 13:111122202-111122224 GAGTGCACACAGCTGCTGGTTGG + Intronic
1113630097 13:111876424-111876446 CGGTGCACACAGAGGGCAGTGGG + Intergenic
1113933292 13:113979976-113979998 GGGTGCACACACATGGGAGGAGG - Intronic
1114450420 14:22821967-22821989 AGGTTCACACATATGCAAGTGGG + Intronic
1115416357 14:33139273-33139295 ATGTGCACATAGATGCTAGCTGG - Intronic
1121142073 14:91551822-91551844 GGGTGCACCAAGATTCTAATGGG + Intergenic
1121327084 14:93027368-93027390 GGGTGCACAGAGGTGCTCGATGG - Intronic
1121953583 14:98194162-98194184 GGTTGCACACCTATGCAAGTAGG + Intergenic
1127327316 15:57908183-57908205 GGATGCAGACAGCTTCTAGTTGG + Intergenic
1129840568 15:78740833-78740855 GTGTGCACACACATGCTATGAGG + Intergenic
1143014722 17:3885557-3885579 GGGTCCACACCGTTTCTAGTAGG + Exonic
1145932426 17:28695557-28695579 GGGTGCACAGAGATGGTGGGAGG - Intronic
1149375120 17:56035988-56036010 AGGAGCACACAGATGGTAGAAGG - Intergenic
1152603594 17:81277831-81277853 GGCTGCACACAGATGCTCCATGG - Intronic
1156155918 18:34301491-34301513 ATGTGCACAGAGATGCTATTTGG - Intergenic
1159178872 18:64874884-64874906 GGGGTCACACAGATGCTGCTGGG - Intergenic
1159816211 18:73077048-73077070 TGGAACACACAGATTCTAGTTGG - Intergenic
1160146538 18:76370293-76370315 AGGTGCACACAGCTGGTTGTTGG - Intronic
1161931977 19:7346871-7346893 CGGTGCACACAGATGGTTTTGGG - Intergenic
1165825869 19:38705456-38705478 GTGTGCACACAGGTGCTTGCAGG - Intronic
1166381334 19:42356793-42356815 CGGTGGACACAGATGCTGGCGGG + Exonic
925136580 2:1527559-1527581 GGTTGCACACAGTTGGTATTTGG - Intronic
925628437 2:5865198-5865220 AGGAGCACACAGAGGCTAGCTGG - Intergenic
926205656 2:10833027-10833049 GGGAGCTCACAGATGATATTGGG + Intronic
926630971 2:15136000-15136022 GGGCACACACAGATGCAAGAGGG + Intergenic
936502643 2:113078288-113078310 GGGCCAACACAGATGCTACTGGG + Intergenic
943058012 2:183007753-183007775 GAGTGCACTGAGATGCTATTTGG + Intronic
1172965496 20:38831388-38831410 GGGTGAACACAGCAGCTAGGCGG - Intronic
1175717733 20:61266609-61266631 GGGTGCAGAGAGATGCTGGTGGG + Intronic
1176044858 20:63087325-63087347 GGGTGTACACAGATGCGTCTGGG + Intergenic
1180875957 22:19175369-19175391 GGGTGCACCCAGATCCTTCTTGG + Intergenic
1181003932 22:20000607-20000629 GGCTGCACACATGTGCCAGTAGG - Intronic
1181125222 22:20698091-20698113 GGGGGCTCACAGCTGCTGGTGGG + Intergenic
1181187926 22:21119607-21119629 GGGGGCGCACAGCTGCTGGTGGG - Intergenic
1181211272 22:21290886-21290908 GGGGGCGCACAGCTGCTGGTGGG + Intergenic
1181398234 22:22636002-22636024 GGGGGCTCACAGCTGCTGGTGGG - Intergenic
1181706201 22:24650681-24650703 GGGGGCTCACAGCTGCTGGTGGG - Intergenic
1183579667 22:38716403-38716425 GGCAGCACCCAGAAGCTAGTGGG + Intronic
1184053586 22:42028068-42028090 GTGTGCACAAAGATGCATGTGGG + Exonic
1203215677 22_KI270731v1_random:4545-4567 GGGGGCTCACAGCTGCTGGTGGG - Intergenic
1203274949 22_KI270734v1_random:80846-80868 GGGGGCTCACAGCTGCTGGTGGG + Intergenic
950121855 3:10487223-10487245 GTGCGCACACACATGCTTGTGGG - Intronic
950141603 3:10619844-10619866 GGGTGCACACAGATGCTAGTGGG + Intronic
954420562 3:50416884-50416906 GGGTGCACACAGATACACGTGGG + Intronic
954956096 3:54519312-54519334 GGGTTCACAGAGATGTGAGTAGG + Intronic
957569146 3:81924178-81924200 GTTTGCACACAGCTGCTGGTGGG + Intergenic
961647164 3:128398723-128398745 GGGCTCACACAGCTGCGAGTGGG - Intronic
969724234 4:8910051-8910073 GAGTGCAGACAGAGGCTGGTGGG - Intergenic
971505120 4:27358310-27358332 GGGTGCTCTAAGTTGCTAGTGGG + Intergenic
984062083 4:175002378-175002400 GGTTGCACAGAGATGTCAGTTGG + Intergenic
988192941 5:27963387-27963409 GTGTGCACACAGTTGCCAGCAGG - Intergenic
990884945 5:60580579-60580601 GGGAGCACACAGACATTAGTTGG - Intergenic
997713327 5:136024187-136024209 GGATGCCCACAGATGATTGTTGG - Intergenic
1001493081 5:172169170-172169192 AGGTGCAAAGAGATTCTAGTCGG - Intronic
1002394567 5:178942677-178942699 GGGTCCACACACCTGCTATTAGG - Exonic
1003872361 6:10412949-10412971 GGGCGCGCACAGACGCTAGGCGG + Intronic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1018405488 6:163477362-163477384 GAGAGCACACAGATTCTAGCTGG - Intronic
1021194423 7:17659396-17659418 GGCAGCACTCAGATGCTACTTGG - Intergenic
1021627730 7:22610935-22610957 TGGTGGACACAGAAGCTAGAAGG - Intronic
1023482976 7:40654859-40654881 GTCTGCACACAGATTCAAGTGGG + Intronic
1033577229 7:142697079-142697101 GGGTCCACACAGTTGGTTGTGGG + Intergenic
1034551650 7:151824491-151824513 GGCTCCACACAGAGGCTACTAGG - Intronic
1042752241 8:72170644-72170666 GTGTGCACACACACACTAGTGGG + Intergenic
1046217960 8:111174204-111174226 GGTTGGACTCAGATGGTAGTTGG - Intergenic
1046290269 8:112149970-112149992 GGGTGCACACAGATGGTTGTTGG + Intergenic
1048199326 8:132358725-132358747 GGGTCCACAGACATGCTTGTGGG + Intronic
1049167141 8:141133483-141133505 GAGTGGACACAGATGCTAGTGGG + Intronic
1049307016 8:141909389-141909411 GGGTGAACAGAGCTGCTGGTGGG - Intergenic
1052890715 9:33696965-33696987 GGGTCCACACAGTTGGTTGTGGG + Intergenic
1057181859 9:93034859-93034881 GGGTCCACCCAGGTGCCAGTAGG - Intronic
1062016599 9:134294268-134294290 GGGTCCACACAGATGCCACCAGG + Intergenic
1187682950 X:21786430-21786452 GGGCGCACACAAAGGCTAGAAGG + Intergenic
1188493059 X:30756171-30756193 ATGTGCACACACATGCTGGTGGG - Intergenic
1189244843 X:39555380-39555402 GGGTGCAGTCAGATGCCAGGTGG - Intergenic
1189560803 X:42189628-42189650 GTTTGGACACAGATGCTTGTTGG - Intergenic
1190012841 X:46800023-46800045 GGGGGAAAACAGATGCTAATAGG + Intergenic
1190157625 X:48006559-48006581 GGGTGCACAGGGATCCCAGTGGG + Intronic
1190173397 X:48129444-48129466 GGGTGCACAGGGATCCCAGTGGG + Intergenic
1192183260 X:68929495-68929517 GGGAACACAGAGATGCCAGTAGG - Intergenic
1193016200 X:76737157-76737179 GTCTGCCCACAGATGCTATTAGG - Intergenic
1193563314 X:83047157-83047179 GAGTGAACACAGATGGTAGCAGG - Intergenic
1194867467 X:99086345-99086367 GGGTGGCCAGAGATGCTGGTTGG - Intergenic
1197113992 X:122810133-122810155 AGATGAACACAGATGCAAGTAGG - Intergenic
1198706249 X:139451612-139451634 GGGTTCACACAAATGCATGTGGG + Intergenic
1200022379 X:153222780-153222802 TGGTGCACACAGATGAAAGCAGG - Intergenic