ID: 950145345

View in Genome Browser
Species Human (GRCh38)
Location 3:10645958-10645980
Sequence GGGTCCCACCCAGGATCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950145345_950145352 17 Left 950145345 3:10645958-10645980 CCACTTGATCCTGGGTGGGACCC 0: 1
1: 0
2: 1
3: 12
4: 182
Right 950145352 3:10645998-10646020 ACACATGCAGCCTGGCTAGTTGG 0: 1
1: 0
2: 1
3: 4
4: 125
950145345_950145351 9 Left 950145345 3:10645958-10645980 CCACTTGATCCTGGGTGGGACCC 0: 1
1: 0
2: 1
3: 12
4: 182
Right 950145351 3:10645990-10646012 AGACATTGACACATGCAGCCTGG 0: 1
1: 0
2: 1
3: 28
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950145345 Original CRISPR GGGTCCCACCCAGGATCAAG TGG (reversed) Intronic
905389852 1:37629499-37629521 GGGGGCCACCCAGGAACTAGGGG - Intronic
906205658 1:43985131-43985153 GGGCCACAGCCAGGAGCAAGCGG - Intronic
906415950 1:45621629-45621651 GGGCCTCACCCAGGATCATAGGG + Exonic
906935524 1:50211056-50211078 GGGTCCCACACAGGAAGAGGAGG + Intergenic
908190666 1:61700471-61700493 GGCTCCCACCCCAGCTCAAGTGG + Intronic
912412832 1:109490008-109490030 GGGTCCCACCCCGGGGCATGGGG - Exonic
914757492 1:150572229-150572251 GGGTTCCTCCCAGGTTCACGTGG + Intergenic
915399585 1:155612498-155612520 GGCTCCCACCCAAGGACAAGGGG - Exonic
915416696 1:155748055-155748077 GGCTCCCACCCAAGGACAAGGGG - Intergenic
920953576 1:210597426-210597448 AGGACCCACCCAGGACCAGGAGG - Intronic
922555401 1:226528597-226528619 AGGTCCCACCTAAGCTCAAGGGG + Intergenic
922568313 1:226616495-226616517 AGGTTCCACCCAGGAAGAAGAGG + Intergenic
922820213 1:228479432-228479454 GGGGACCACCCAGGAGGAAGGGG + Intergenic
923296957 1:232603496-232603518 GGGTGTCACTCAGGGTCAAGAGG + Intergenic
924458147 1:244234522-244234544 GTGACCCACCCAGGATCAGGTGG - Intergenic
1064249194 10:13693849-13693871 GGGTCCCAGCCATGCTCAGGGGG + Intronic
1066242563 10:33552415-33552437 GGTTTCCACCCAGGAACAAGAGG + Intergenic
1067533261 10:47089865-47089887 GGGTTCCATCATGGATCAAGGGG + Intergenic
1068639895 10:59391692-59391714 AGGCCCCACCCAGAATCAAAGGG - Intergenic
1069559357 10:69418711-69418733 GCGGGCCACCCAGGATGAAGGGG + Intergenic
1069797233 10:71061249-71061271 GGGTTCTTCCCAGAATCAAGAGG - Intergenic
1069836547 10:71312811-71312833 GAGGTCCACCCAGGATCCAGGGG - Intergenic
1073176625 10:101561012-101561034 GGGTCTCAGCCAGGAAGAAGTGG - Intergenic
1073422797 10:103438106-103438128 AAGACCCACTCAGGATCAAGGGG + Intronic
1074669754 10:115776478-115776500 AGATCCCACCCAGATTCAAGAGG - Intronic
1076311073 10:129507954-129507976 GTATCCCACCCAGAATCCAGTGG - Intronic
1076525553 10:131110411-131110433 GGCTCCCTCCCAGCATTAAGGGG + Intronic
1079152199 11:17910071-17910093 GGGTCCAAACTTGGATCAAGGGG + Intronic
1079435113 11:20439329-20439351 AAATCCCAGCCAGGATCAAGTGG - Intronic
1079785191 11:24663705-24663727 GGGTCCCTCCCAGGATGCATGGG - Intronic
1080386284 11:31812965-31812987 GGGTCCCAGGCAGGAACGAGAGG - Intronic
1081999863 11:47388351-47388373 GGGCCCCAGCCAGGGTCAACTGG + Intergenic
1083927285 11:65815726-65815748 GGGTCCCACAGAAGCTCAAGAGG - Intergenic
1084195314 11:67521196-67521218 GGGTCCAGGCCAGGATCAGGGGG - Intronic
1084594601 11:70109476-70109498 GAGTCCCATCCAGGGTCAAAAGG + Intronic
1084625356 11:70302182-70302204 AGGTCCCATTCAGCATCAAGGGG + Intronic
1084637949 11:70405628-70405650 GGGCCCCACCCATGTTCATGGGG - Intronic
1085457548 11:76673640-76673662 GGGTCCTACGCAGGAGCAAGTGG + Intergenic
1088495787 11:110430205-110430227 GGGTCCCGCGCTGGATCCAGCGG + Exonic
1092166763 12:6347384-6347406 GTTTCCCACCCAAGTTCAAGAGG + Exonic
1092737731 12:11599122-11599144 GTGTCCAACTCAGGGTCAAGTGG - Intergenic
1093973181 12:25393076-25393098 AGGTCACACCCAGGCTCTAGCGG - Intergenic
1100923893 12:99521978-99522000 TGGACCCACCCAGGACCTAGGGG - Intronic
1102162660 12:110782243-110782265 AGGTTCCACCCAGGAACAGGAGG + Intergenic
1102497077 12:113327149-113327171 GGGTCCCACCCAGCACAAGGAGG + Intronic
1104531424 12:129574745-129574767 GGGTCCCACACATGAACAACTGG + Intronic
1108987043 13:56604833-56604855 GGGTCCCTCCCAGCAGCAATTGG - Intergenic
1111202241 13:84954134-84954156 AGGTTCCACCCAGGAAGAAGAGG + Intergenic
1113972569 13:114200985-114201007 GGGACCCACACAGGATGCAGGGG - Intergenic
1117277744 14:54206692-54206714 CAGTCCAACCCAAGATCAAGGGG + Intergenic
1120864854 14:89286953-89286975 GGGTCCAATCCAGGGTGAAGTGG + Intronic
1120960530 14:90120656-90120678 GGGTCCCTCCCACGATCTATGGG + Intronic
1121281895 14:92705026-92705048 GTGTCCCTCCCAGAATCAAAAGG - Intronic
1122823052 14:104356642-104356664 GGAGCCCACCCAGCACCAAGGGG - Intergenic
1125457067 15:39870658-39870680 AGGTCCCACCCACATTCAAGGGG - Intronic
1126404667 15:48311386-48311408 AGGTCCCTCCCAGACTCAAGAGG + Intergenic
1130922143 15:88356689-88356711 TGGGCCCACCCAGGTTCAAGGGG + Intergenic
1131705075 15:94984863-94984885 GGTTAGCACCCAGGATCCAGGGG - Intergenic
1131740644 15:95387084-95387106 GGTTACCTCCCAGGAGCAAGTGG + Intergenic
1137445384 16:48528520-48528542 AGGTCCCACCCATACTCAAGGGG + Intergenic
1138454489 16:57113554-57113576 GGGACCCACCCAGGAAGATGGGG - Intronic
1138529806 16:57628765-57628787 GGGTCCCACGCAGGGCCAGGCGG - Intronic
1138714963 16:59010096-59010118 GGGTCCCTCCCATGATGAATGGG + Intergenic
1139752806 16:69119704-69119726 GGGCCCAACCCAAGACCAAGTGG - Exonic
1142003127 16:87675397-87675419 AGGTCCTGCCCAGGAGCAAGAGG - Intronic
1142558450 17:795450-795472 GGCTCCCAGCCAGGAGCCAGCGG - Intergenic
1142870256 17:2815122-2815144 GGGCCCCACCCAGGCTGATGAGG - Intronic
1144887410 17:18472700-18472722 GAGCACCACCCAGGCTCAAGGGG - Intergenic
1145144806 17:20471594-20471616 GAGCACCACCCAGGCTCAAGGGG + Intergenic
1145296205 17:21594140-21594162 GGGTCCCACTCTGGATCAACAGG - Intergenic
1145367583 17:22277922-22277944 GGGGCCCACTCTGGATCAACAGG + Intergenic
1146354121 17:32119788-32119810 GAGCACCACCCAGGCTCAAGGGG - Intergenic
1147607876 17:41784696-41784718 GATCCCCACCCAGGATAAAGGGG + Intronic
1148496527 17:48056277-48056299 GGGCCCCACCCAGGACTAACTGG + Intronic
1148689738 17:49520329-49520351 TGATCCCACCCAGGCTCAACTGG + Intergenic
1151227496 17:72657924-72657946 AGGACCCACCCAGCATCAATGGG - Intronic
1153698158 18:7664752-7664774 AGGACCCAGCCAGGTTCAAGGGG + Intronic
1156475358 18:37402459-37402481 GGGGTCCACCCAGGCTCAAAGGG - Intronic
1156570162 18:38243734-38243756 GGCTCCCACCAAGAATCAAAAGG - Intergenic
1156881327 18:42084491-42084513 GGATCCCATCCTGGATCAGGTGG - Exonic
1158879922 18:61768345-61768367 GGGTCCCTCCCAGGAACTTGGGG - Intergenic
1159655126 18:71023996-71024018 AGGTCCCACCCAGGAAGAGGAGG + Intergenic
1161377458 19:3947292-3947314 GGGTCCCACACAGGAGCAGGAGG - Intergenic
1162498063 19:11034547-11034569 GTTTCCCACCCAGGGGCAAGGGG - Intronic
925080603 2:1061160-1061182 GCGTCCAACCCAGGATCACGCGG - Intronic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
925140082 2:1544112-1544134 GTGTCCCACCCAGTCTCATGTGG - Intergenic
925316968 2:2934010-2934032 GGGTCTCAGCGAGGAGCAAGTGG - Intergenic
926087193 2:10027918-10027940 AAGTCCCACCCATGCTCAAGTGG - Intergenic
926131206 2:10303996-10304018 AGGCCCCACCCACGATAAAGGGG - Intronic
926711695 2:15887295-15887317 ATGTCCCACCCATGTTCAAGGGG - Intergenic
931193250 2:60025439-60025461 GGGAGTCACCCAGGATCCAGTGG - Intergenic
931255738 2:60570495-60570517 CGGTGCCGCCCAGGATCAAATGG - Intergenic
933716264 2:85363185-85363207 GGGTCCCACCCAGACTCCAAGGG - Intronic
935186599 2:100739839-100739861 AGGTCCCACCCATACTCAAGGGG - Intergenic
935269032 2:101417790-101417812 GGTCCCCACCCAGGTTGAAGGGG + Intronic
935362564 2:102259805-102259827 GGGTCTCACTCAGAATCAACTGG - Intergenic
936007913 2:108906714-108906736 GGCTCCCATCCCGGATCACGTGG + Intronic
936260972 2:110959354-110959376 GGATCCCACTCAGCATCAGGTGG + Intronic
937150522 2:119682869-119682891 TGGTCCCACTCAGGACCCAGGGG + Intronic
938733937 2:134169022-134169044 GGTGCCCACCCAGGATCCAATGG - Intronic
939614568 2:144348083-144348105 GGGTCCCATCCCAGACCAAGCGG + Intergenic
941607782 2:167621650-167621672 GGGTCCCTCCCATGAACACGTGG - Intergenic
944319450 2:198321240-198321262 GTGTCCCATTTAGGATCAAGGGG + Intronic
945648407 2:212530523-212530545 GGGTCCCAATCACTATCAAGGGG - Intronic
948184349 2:236008194-236008216 GGGCCCCAGCCAGTATCATGAGG - Intronic
1169471061 20:5885990-5886012 TGCTCCCACCCAGGATGAAGGGG - Intergenic
1170574813 20:17654234-17654256 GGGTCACACTCAGGATGTAGGGG - Intronic
1171342322 20:24440095-24440117 TGGTCCCACCCAGATTCAAAGGG + Intergenic
1175445547 20:59017295-59017317 GGATCCAGCCCAGGATCATGGGG + Intergenic
1176077593 20:63255281-63255303 GGGTCCCAGCCAGGCCCGAGAGG + Intronic
1178044297 21:28676659-28676681 GGGTACCACCCAGGAAGAGGAGG - Intergenic
1179067537 21:38040075-38040097 AGGTCCCACCCAGACTCAAAGGG - Intronic
1179360700 21:40705708-40705730 GGGTCCCTCCCAGGACCCATGGG + Intronic
1179456219 21:41502322-41502344 GACTCCCACCCAAGATCCAGGGG + Intronic
950145345 3:10645958-10645980 GGGTCCCACCCAGGATCAAGTGG - Intronic
951981739 3:28574950-28574972 AGCTACTACCCAGGATCAAGTGG + Intergenic
952581313 3:34836896-34836918 GGCTCCCACCCAGGTCCAAGAGG - Intergenic
952861953 3:37820273-37820295 GTGTCCCAACCTGAATCAAGGGG + Exonic
953052293 3:39355849-39355871 AGGTCCATTCCAGGATCAAGGGG - Intergenic
953582037 3:44166325-44166347 GGGCCCCACCCAGACTCCAGAGG + Intergenic
954380183 3:50215190-50215212 GTGTCGCACCCTGGATCAAAGGG + Intronic
956779282 3:72591545-72591567 GGGTCCAACCCAGCAGCATGGGG - Intergenic
957312984 3:78543474-78543496 GGGTTCCACCCAGGATGACCTGG - Intergenic
962193653 3:133337078-133337100 AGGTGCCACCCAGGAGCCAGGGG - Intronic
963771326 3:149389225-149389247 AGGTCCCACCCACACTCAAGAGG + Intergenic
964073093 3:152659122-152659144 AGGTTCCACCCAGGAAGAAGAGG + Intergenic
965099651 3:164279036-164279058 TGGACCCACCCAGGACCAGGGGG + Intergenic
966314026 3:178625275-178625297 GGGGCCCACCCAGGACAAGGGGG + Intronic
967531018 3:190549177-190549199 GGTTCCCACCCAGGAACAAGAGG + Intronic
968415996 4:434412-434434 CATTCCCACCCAGGATGAAGAGG - Intronic
971278963 4:25225397-25225419 GGGTCCCTCCCAGGACATAGGGG + Intronic
973289943 4:48461154-48461176 GGGTGCCACCTAGGTGCAAGAGG - Intergenic
974481498 4:62449540-62449562 GGGTCCCACCCACGTTCCAGAGG - Intergenic
976201876 4:82586968-82586990 GGGCCCCAACCAGGCTGAAGAGG - Intergenic
980973503 4:139588691-139588713 GAGGCTCACCCAGCATCAAGGGG - Intronic
986168469 5:5296139-5296161 GGGACCCACCCAGAACCAAAGGG - Intronic
986416727 5:7536369-7536391 GGATCCCAGCCAAGAACAAGAGG + Intronic
988426111 5:31066658-31066680 AGGTCCCACCCACATTCAAGAGG + Intergenic
992482846 5:77168478-77168500 GGGTCCCACCAGGGCACAAGTGG - Intergenic
994852669 5:105075763-105075785 GGATCCCACACAGGAACAGGAGG + Intergenic
994903345 5:105803953-105803975 GGTCCCCACCCAGGTTCATGAGG - Intergenic
996389434 5:122943771-122943793 AGGTCCCACTCATGCTCAAGAGG + Intronic
996467107 5:123815709-123815731 GGGACACAACCAAGATCAAGAGG - Intergenic
996763085 5:127005469-127005491 GGGACTTACCCAGGATCACGTGG - Intronic
997438457 5:133891863-133891885 GTTTCCCACCCAGGATAAAAAGG + Intergenic
998872642 5:146567848-146567870 AGGTCCCACCCACACTCAAGAGG - Intergenic
999247373 5:150162312-150162334 GGGGCCTACCCAGGAGCCAGAGG + Intergenic
999422255 5:151454994-151455016 GGGTCAGAACTAGGATCAAGAGG - Intronic
1003072907 6:2958636-2958658 GGGACCCACCCAGTGCCAAGTGG + Intronic
1003498822 6:6687271-6687293 GGCTCCCAGCCAGGATCCGGAGG - Intergenic
1004423358 6:15490672-15490694 GGGTCTCACCAAGGAGCAAATGG + Intronic
1005681019 6:28208140-28208162 AGGTGCCACCCAGGGTCACGCGG - Intergenic
1007692657 6:43712833-43712855 GTGTCCCAGCCAGGATAATGAGG + Intergenic
1007920375 6:45603941-45603963 GGGTCCCTCCCATGAACATGGGG + Intronic
1008354511 6:50535398-50535420 GGCTCACATCCAGGGTCAAGTGG - Intergenic
1008879977 6:56371936-56371958 GGGTCCAACCCAGTCACAAGGGG - Intronic
1010324520 6:74549754-74549776 TGGGCCCACCCAGGGCCAAGGGG - Intergenic
1012254555 6:97016773-97016795 AGGTCCCTCCCAGGATTATGGGG - Intronic
1016774197 6:147886512-147886534 AGGTCCCACCCACACTCAAGGGG - Intergenic
1017770509 6:157640511-157640533 GGGTCCCTCTCAGGATCAGCAGG - Intronic
1019428401 7:987835-987857 GGGACCCCCCCAGGATACAGAGG - Intronic
1019649460 7:2148856-2148878 GGGTCCCTCCTTGGATCAGGAGG - Intronic
1022524750 7:31029682-31029704 GGGTCCCACAAATGACCAAGAGG + Intergenic
1023746868 7:43330128-43330150 AGCACCCACCCAGGCTCAAGGGG - Intronic
1024310821 7:47967294-47967316 GGGGCCCAGCCAGAATCAAGAGG + Intronic
1027782240 7:82534206-82534228 AGGTCCCACCCACACTCAAGGGG - Intergenic
1028107976 7:86902739-86902761 GGTTGCCACCCAGGAATAAGAGG - Intronic
1033330274 7:140411734-140411756 GGGTCCCACCCCAGATCTACTGG + Intronic
1036993445 8:13627093-13627115 GAGTCCCACCCAGGAAGGAGAGG + Intergenic
1040758519 8:50809259-50809281 AGGTTCCACCCAGGAAGAAGAGG - Intergenic
1041205694 8:55495706-55495728 GGGTCCCACCCAGCTGCGAGAGG + Intronic
1041401296 8:57448200-57448222 GGTTCCCACCCAGGAACAGAAGG + Intergenic
1046946238 8:119976777-119976799 GGTCCCCACCCAGGGTCAAGAGG - Intronic
1049649013 8:143755016-143755038 AGGTCCCACCCACACTCAAGGGG + Intergenic
1049991542 9:996249-996271 GGGTCCAGCCAAGGAGCAAGTGG + Intergenic
1051434513 9:17016803-17016825 GGTTCCCACACAGGAACAGGAGG + Intergenic
1054793360 9:69276368-69276390 AAGTCCCACCCAGGTTGAAGAGG + Intergenic
1055474362 9:76646776-76646798 GGGTACCAAACAGGATGAAGAGG - Intronic
1059081215 9:111252492-111252514 GGGTCCCTCCCAGGATACATGGG - Intergenic
1060880364 9:127113787-127113809 GGGTCCCACCCAGTCTCCGGTGG + Intronic
1060973053 9:127749710-127749732 GGGTCAGACCCAGGATCTGGGGG + Intronic
1061530413 9:131207622-131207644 AAGTCCCATCCAGGTTCAAGAGG + Intronic
1061757854 9:132827717-132827739 GGGGCCCACACAGGAGCCAGGGG - Intronic
1062433508 9:136536006-136536028 GGATCCCTCCCAGGAGCAACGGG + Intronic
1186395240 X:9201652-9201674 AGGTCCCACCCTAGACCAAGAGG + Intergenic
1187424038 X:19161132-19161154 GGGTCCCACCCTGGAGCACCAGG - Intergenic
1188443791 X:30235981-30236003 GGGTCAGACCCAGGATCACCAGG + Exonic
1189281656 X:39823359-39823381 AAGACCCACCCAGGTTCAAGTGG - Intergenic
1189289356 X:39874299-39874321 GTCACCCACCCAGGTTCAAGGGG - Intergenic
1189519546 X:41751658-41751680 TGGTCCCAGCCAGGAGCAAAGGG - Intronic
1193168379 X:78307603-78307625 AGGTCCCACTCAGACTCAAGGGG + Intronic
1193498131 X:82238603-82238625 AGGTCCCACCCAGCAAGAAGTGG + Intergenic
1194520237 X:94909477-94909499 GGGACCCACCCAGGGAAAAGTGG - Intergenic
1195763769 X:108274939-108274961 AGGTCCCACCCACACTCAAGAGG + Intronic
1201601376 Y:15731902-15731924 GGTGCCCACACATGATCAAGTGG + Intergenic