ID: 950146251

View in Genome Browser
Species Human (GRCh38)
Location 3:10651979-10652001
Sequence CAGGTTCAGGTTTCTGTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 680
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 639}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950146243_950146251 14 Left 950146243 3:10651942-10651964 CCATTAACCTTGTGAACTAGAAG 0: 1
1: 0
2: 2
3: 13
4: 129
Right 950146251 3:10651979-10652001 CAGGTTCAGGTTTCTGTTTGGGG 0: 1
1: 0
2: 0
3: 40
4: 639
950146242_950146251 15 Left 950146242 3:10651941-10651963 CCCATTAACCTTGTGAACTAGAA 0: 1
1: 0
2: 2
3: 12
4: 120
Right 950146251 3:10651979-10652001 CAGGTTCAGGTTTCTGTTTGGGG 0: 1
1: 0
2: 0
3: 40
4: 639
950146244_950146251 7 Left 950146244 3:10651949-10651971 CCTTGTGAACTAGAAGAGAATGG 0: 1
1: 0
2: 3
3: 45
4: 493
Right 950146251 3:10651979-10652001 CAGGTTCAGGTTTCTGTTTGGGG 0: 1
1: 0
2: 0
3: 40
4: 639

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950146251 Original CRISPR CAGGTTCAGGTTTCTGTTTG GGG Intronic
901504043 1:9673040-9673062 CAGGTTCATCTTTCTGTATGAGG + Intronic
901765699 1:11498665-11498687 CAGGTACATGTATCTGTTAGGGG + Intronic
902760207 1:18575933-18575955 CTCTTTCAGGTTTGTGTTTGTGG - Intergenic
903657292 1:24957172-24957194 AAGGTTTAGGTTCCTCTTTGGGG - Intronic
904211951 1:28891699-28891721 CAGTTCCGGGTTTGTGTTTGTGG + Intronic
905000461 1:34664127-34664149 CAGGTTCAGTTTTCTGATGAGGG - Intergenic
906081831 1:43095862-43095884 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
906834578 1:49069429-49069451 CAGTTTCAGCTTTCTGCTTATGG + Intronic
906878349 1:49562506-49562528 CAGTTTCAGCTTTCTGCTTATGG + Intronic
906883577 1:49619914-49619936 CAGTTTCAGTTTTCTGCATGTGG - Intronic
906940964 1:50254987-50255009 CAGGTTTAGGGTTCAGTCTGTGG + Intergenic
907112234 1:51936467-51936489 CAGGTTCACATTTGTGTTTCAGG - Intronic
907957723 1:59246831-59246853 CAGTTTCAGTTTTCTGCTTATGG + Intergenic
908503819 1:64774375-64774397 CAGTTTCAGCTTTCTGCTTATGG + Intronic
908842259 1:68292036-68292058 CAGGTTCAAGGCTCTGTCTGGGG - Intergenic
909434192 1:75621031-75621053 CAGTTTCAGTTTTCTGTATATGG + Intergenic
909535903 1:76735815-76735837 CAGTTTCAGTTTTCTGTATATGG + Intergenic
909891659 1:81015110-81015132 CAGTTTCAGTTTTCTGTATATGG - Intergenic
910371662 1:86523473-86523495 CAGGTTGGGGTTCCTTTTTGTGG - Intergenic
910994940 1:93094659-93094681 CAGGTTCAGGTTTGCCTTTTTGG + Intronic
911561515 1:99411741-99411763 CAGTTTCAGTTTTCTTTTTATGG + Intergenic
912880927 1:113413075-113413097 CAGTTTCAGCTTTCTGTATATGG + Intronic
912885939 1:113474461-113474483 CAGTTTCAGCTTTCTGTATATGG + Intronic
913388557 1:118285696-118285718 CAGTTTCAGCTTTCTACTTGTGG - Intergenic
914401956 1:147329522-147329544 CAGTTTCAGTTTTCTGTATATGG - Intergenic
915598805 1:156909849-156909871 CAGGTACAGGCTCCAGTTTGGGG - Exonic
915641352 1:157229550-157229572 AAGGTCCAGGTTCCTGGTTGGGG + Intergenic
915649561 1:157299174-157299196 CAGTTTCAGTTTTCTGTATATGG - Intergenic
916059036 1:161086469-161086491 TAGGATCAGCTTTCTGTCTGAGG - Intronic
916643268 1:166755244-166755266 CAGCTTCATTTTTCTGTATGTGG - Intergenic
916645386 1:166779762-166779784 CAGTTTCAGTTTTCTGTATAAGG + Intergenic
917393189 1:174561798-174561820 CAGTTTCAGTTTTCTGCTTATGG - Intronic
918095656 1:181331778-181331800 CAGTTTCAGTTTTCTGCATGTGG + Intergenic
918386562 1:184013915-184013937 GAGGTCCATGTTTCTGTTTTGGG + Intronic
918685423 1:187408780-187408802 CATGTTTATTTTTCTGTTTGGGG + Intergenic
918853834 1:189725323-189725345 CAGTTTCAGTTTTCTGTATATGG + Intergenic
919065093 1:192684150-192684172 CAGTTTCAGCTTTCTGCTTATGG + Intergenic
920043585 1:203119372-203119394 CACGTACAGGTTTTTGTGTGAGG - Intronic
920093017 1:203467596-203467618 CATGATCAGGTTTGTGTTTGAGG + Intergenic
920382823 1:205545525-205545547 GTGGTTCAGGTTTCTCTCTGGGG - Intergenic
920895317 1:210042557-210042579 CAGTTTCAGTTTTCTGCTTATGG + Intronic
921770761 1:219036663-219036685 GAGCTTAAGGTTTCAGTTTGGGG + Intergenic
921976762 1:221211355-221211377 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
922213583 1:223503308-223503330 CAGGTAGAAGTTTGTGTTTGGGG - Intergenic
923943354 1:238854546-238854568 CAGTTTCAGTTTTCTGCCTGTGG - Intergenic
924137076 1:240979711-240979733 AAGGTTCAGGTTTCTGTCCTAGG - Intronic
924846149 1:247774255-247774277 CAGGCTCATGTTTCTTTTGGAGG - Intergenic
1062810880 10:463938-463960 CAGTTTCAGTTTTCTGCTTATGG - Intronic
1062918789 10:1264199-1264221 CAGCATGAGGTTTCTGTTTAGGG + Intronic
1062955389 10:1536756-1536778 CAATTTCAGTTTTCTGCTTGCGG - Intronic
1062981816 10:1730175-1730197 CAGATCCAGGTTTCTCTCTGTGG - Intronic
1063444947 10:6107076-6107098 CAGGTTCATATTTCTCCTTGAGG + Intronic
1063841876 10:10081484-10081506 GAAGTTCAGGTTTCTGGTTATGG + Intergenic
1064468567 10:15611777-15611799 CAGATTAAGAGTTCTGTTTGGGG - Intronic
1065487839 10:26252114-26252136 CAGGTCCAGGCTTGTGTTTTGGG - Intronic
1066542455 10:36462378-36462400 CAGGTTCATGTACCAGTTTGTGG + Intergenic
1067249009 10:44571657-44571679 CAGGTCCAGGTCTCAGTCTGTGG + Intergenic
1067271046 10:44791529-44791551 CAGGTGTGGGTTTCTGTCTGGGG - Intergenic
1067996283 10:51277159-51277181 CAGTTTCAGCTTTCTGTATATGG + Intronic
1068147236 10:53087665-53087687 CAGGTTCAGTTTTCTGCATATGG - Intergenic
1068495774 10:57783772-57783794 CAGTTTCAGCTTTCTGCATGTGG - Intergenic
1068623248 10:59209862-59209884 CAGTTTCAGTTTTCTGTATATGG - Intronic
1069182960 10:65386035-65386057 CAGTTTCAGCTTTCTATTTATGG + Intergenic
1069183357 10:65391371-65391393 CAGTTTCAGCTTTCTATTTATGG - Intergenic
1069435193 10:68375292-68375314 CAGATACAGGTGTCTATTTGAGG + Intronic
1069573698 10:69509781-69509803 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1070159969 10:73860444-73860466 AAGGGTCAGGATTTTGTTTGTGG - Intronic
1071894587 10:90051649-90051671 CTGGCTCAGGCTTCTGTTTCAGG + Intergenic
1072024069 10:91436418-91436440 CAGGGTAAGTATTCTGTTTGTGG + Intronic
1072123343 10:92423466-92423488 CAGGTTCAGTTTTCTGGTGAGGG - Intergenic
1073674695 10:105632449-105632471 CAGTTTCAGTTTTCTGCATGTGG + Intergenic
1074648048 10:115486935-115486957 CAGTTTCAGCTTTCTGTATATGG + Intronic
1074787703 10:116855570-116855592 CTGGTTCAAGTTGTTGTTTGGGG - Intronic
1075401439 10:122163953-122163975 CAGGTTCAGGTCGCTGGCTGGGG - Intronic
1075907282 10:126092709-126092731 CAGGGGCATCTTTCTGTTTGTGG - Intronic
1076242170 10:128916802-128916824 CAGATCCAGATTTCTGTCTGGGG + Intergenic
1078036327 11:7809156-7809178 CAGTTTCAGGCTTCTGCATGTGG - Intergenic
1078523410 11:12081994-12082016 CAGGTTCAGCTTTCTGCATATGG + Intergenic
1078998816 11:16732530-16732552 CAGTTTCAGTTTTCTGCATGTGG - Intronic
1079073794 11:17370675-17370697 CAACTGAAGGTTTCTGTTTGAGG + Intronic
1079865820 11:25732425-25732447 CAGATTCAGTTTTCTGCATGTGG - Intergenic
1079918052 11:26395738-26395760 CAGTTTCAGTTTTCTGTATATGG - Intronic
1080080049 11:28206305-28206327 CAGTTTCAGCTTTCTGCATGTGG + Intronic
1080528517 11:33151050-33151072 CAGGTACAGATTTCTCTTTGGGG - Intronic
1080680777 11:34473840-34473862 TAGGTACAGGTTTCCCTTTGGGG - Intergenic
1081243763 11:40738164-40738186 CAGTTTCAGTTTTCTGTATATGG - Intronic
1081347075 11:42001822-42001844 CAGCTTCAGTTTTCTGTATATGG + Intergenic
1081387042 11:42484172-42484194 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1081747498 11:45483309-45483331 CAGGCACAGCTTTGTGTTTGGGG + Intergenic
1084926361 11:72515732-72515754 CAGTTTCAACCTTCTGTTTGTGG - Intergenic
1086220886 11:84441815-84441837 CAGTTTCAGTTTTCTGTATATGG + Intronic
1086512335 11:87572542-87572564 CTGGTTTAAATTTCTGTTTGGGG + Intergenic
1086985636 11:93246113-93246135 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1087367481 11:97239308-97239330 CAGTTTCAGGATTTTGTCTGAGG - Intergenic
1087435973 11:98118015-98118037 CAGGTTCAGTTTTCTGCATATGG + Intergenic
1087572994 11:99954037-99954059 CAGGTTCAGCTTTCTGCATTTGG + Intronic
1087670949 11:101106020-101106042 CAGTTTCAGTTTTCTGCTTATGG - Intronic
1088074458 11:105829671-105829693 GAGGTGCTGGTGTCTGTTTGGGG + Intronic
1088405337 11:109469937-109469959 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
1088490624 11:110383982-110384004 CAGTTTCAGCTTTCTGCATGTGG + Intergenic
1088959126 11:114643454-114643476 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1089441766 11:118523482-118523504 CAGGTTCAGGACTCTGTCTTGGG - Exonic
1089600978 11:119614818-119614840 AAGGTTCAGGTGTCTGATGGGGG - Intergenic
1089686036 11:120147363-120147385 CTGGTTCAGCTTTGTGTATGAGG - Intronic
1089765571 11:120761646-120761668 CAGTTTCAGTTTTCTGTATATGG + Intronic
1090690063 11:129171368-129171390 CAGGTTCAGTTTTCTGTATATGG + Intronic
1090902334 11:131044076-131044098 AAGGCTCAGGCTTCTGGTTGAGG - Intergenic
1092162652 12:6324432-6324454 CAAATTCAGGTTTGTGTTTCGGG - Intronic
1092165525 12:6340416-6340438 CTGCTTCTGTTTTCTGTTTGGGG - Intronic
1092587519 12:9914657-9914679 CAGTTTCAGTTTTCTGTGTATGG - Intronic
1092732249 12:11545902-11545924 TAGCTTCTGGTTTCTGATTGAGG - Intergenic
1093521833 12:20060003-20060025 CAGTTTCAGTTTTCTGTGTATGG + Intergenic
1093522944 12:20071698-20071720 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
1093870559 12:24286036-24286058 CAGGTTAAAGTTTCAGCTTGTGG - Intergenic
1094060625 12:26311559-26311581 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1094274475 12:28655672-28655694 CAGTTTCAGTTTTCTGCATGTGG + Intergenic
1095127582 12:38500227-38500249 CAGTTTCAGCTTTCTGCATGTGG - Intergenic
1095404603 12:41854201-41854223 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1096009152 12:48198404-48198426 CAGCTTCAGCTTTCAGTGTGAGG + Intergenic
1097129304 12:56798657-56798679 CAGTTTCAGTTTTCTGTGTATGG - Intergenic
1097368996 12:58752763-58752785 CATGTTCATGTTTCTGTATGTGG - Intronic
1097452162 12:59750008-59750030 CAGTTTCAGTTTTCTGTATATGG - Intronic
1097634768 12:62109177-62109199 CAGTTTCAGTTTTCTGCATGTGG + Intronic
1097762910 12:63489308-63489330 CAGGTTCAGTTTTCTGCATATGG + Intergenic
1098053676 12:66480855-66480877 CAGTTTCAGTTTTCTGTGTATGG - Intronic
1098193162 12:67972220-67972242 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1098780599 12:74681321-74681343 CAGTTTCAGTTTTCTGCCTGTGG - Intergenic
1098788217 12:74786474-74786496 CAGTTTCAGTTTTCTGCATGTGG + Intergenic
1099353271 12:81600784-81600806 AACCTTGAGGTTTCTGTTTGAGG - Intronic
1099744485 12:86685233-86685255 CAGGTTCAGATTTCTGCATATGG + Intronic
1099797373 12:87416372-87416394 CAGTTTCAGTTTTCTGCTTATGG + Intergenic
1099962410 12:89409320-89409342 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1100759320 12:97789299-97789321 CAGTTTCAGCTTTCTGCATGTGG + Intergenic
1100996579 12:100307437-100307459 CAGTTTCAGTTTTCTGCATGTGG - Intronic
1102185325 12:110943195-110943217 CAGTTTCAGCTTTCTTTGTGGGG + Intergenic
1103053418 12:117800329-117800351 CAGGGCCAGGTTCCTGTCTGTGG + Intronic
1104171336 12:126284489-126284511 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1104488683 12:129175270-129175292 CAGTTTCAGTTTTCTGTATATGG + Intronic
1104596172 12:130121166-130121188 CAGGTTCAGGCTTTCCTTTGGGG + Intergenic
1105283902 13:18988640-18988662 CAGTTTCAGCTTTCTGTATATGG - Intergenic
1105552161 13:21407816-21407838 CAGTTTCAGTTTTCTGCATGTGG + Intronic
1106138742 13:26993380-26993402 CAGGTGCAGGTGTGTGATTGGGG + Intergenic
1106216770 13:27708697-27708719 CAGGTTCCAGTTTGTCTTTGTGG + Intergenic
1106735135 13:32581597-32581619 CAGTTTCACGTTTCTGTTCTAGG - Intergenic
1106784378 13:33092377-33092399 CAGGTTTAGGCTTTTGTATGTGG + Intergenic
1106914480 13:34497891-34497913 CAGTTTCAGCTTTCTGTGTATGG - Intergenic
1106964878 13:35051202-35051224 CAGGTTCAGGGTTCTTTCTTGGG + Intronic
1107459737 13:40590337-40590359 AAGGAGAAGGTTTCTGTTTGCGG - Intronic
1107472072 13:40700156-40700178 CAGGTTAAGATTTCTGTTCCAGG + Intergenic
1107500857 13:40974047-40974069 CAGGTACAGATTTCCCTTTGGGG + Intronic
1108029615 13:46215814-46215836 CAGTTTCAGTTTTCTGTGTATGG + Intronic
1108137643 13:47383057-47383079 CAGTTTCAGCTTTCTGTTTATGG - Intergenic
1108172303 13:47754210-47754232 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
1108264303 13:48689451-48689473 CAGGTTCAGTTTTCTGTATATGG + Intronic
1108305074 13:49123291-49123313 CAGTTTCAGTTTTCTGCATGTGG - Intronic
1108815215 13:54282524-54282546 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1109016055 13:57015726-57015748 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
1109049267 13:57457598-57457620 CAGGTCTAGGTTTCAGTTTTAGG + Intergenic
1109050790 13:57478727-57478749 CAGGTTCAGTTTTCTGCATATGG - Intergenic
1109656236 13:65394693-65394715 CAGATTAATGTATCTGTTTGTGG + Intergenic
1109677597 13:65699242-65699264 CTTGTTCAGATTTCAGTTTGGGG - Intergenic
1109889240 13:68586026-68586048 AATGTACAGTTTTCTGTTTGGGG - Intergenic
1110972773 13:81787345-81787367 CAGTTTCAGGTTTCTGCTTATGG - Intergenic
1111056572 13:82958097-82958119 CAGGTTCAGTTTTCTGCATACGG - Intergenic
1111346256 13:86958382-86958404 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
1111443220 13:88308471-88308493 CATGTACAATTTTCTGTTTGGGG - Intergenic
1111907971 13:94277628-94277650 CAGTTTCAGTTTTCTGCATGTGG + Intronic
1111955514 13:94753218-94753240 CAGGTACAGATTTCTTTCTGGGG - Intergenic
1112505107 13:99970668-99970690 CAGGTTCAGGTTTAAGTTCACGG + Exonic
1112898477 13:104331085-104331107 CAGTTTCAGTTTTCTGCTTATGG + Intergenic
1112911809 13:104494527-104494549 CAGGTTCAGTTTTCTGCATATGG + Intergenic
1113990098 13:114354070-114354092 TAGGTTAAGGTTTAGGTTTGAGG + Intergenic
1114073724 14:19137628-19137650 CAGGTTCAGGGTTCTTTCTTGGG + Intergenic
1114088540 14:19262357-19262379 CAGGTTCAGGGTTCTTTCTTGGG - Intergenic
1114346881 14:21805832-21805854 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
1114771659 14:25433969-25433991 CAGTTTCAGTTTTCTGCTTATGG - Intergenic
1114795976 14:25715217-25715239 CAGTTTCTGGTTTCTGTTTAAGG + Intergenic
1114796270 14:25718726-25718748 CAGGTTCAGCTTTCTATATATGG + Intergenic
1114869670 14:26641023-26641045 CAGTTTCAGTTTTCTGCATGTGG + Intergenic
1114956115 14:27821666-27821688 CAGTTTCAGTTTTCTGTATGTGG - Intergenic
1115385524 14:32791818-32791840 CAGTTTCAGTTTTCTGCTTATGG + Intronic
1115911699 14:38264096-38264118 CAGTTTCAGTTTTCTGCTTATGG + Intergenic
1115928401 14:38463254-38463276 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1116364876 14:44047445-44047467 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1116416478 14:44683840-44683862 CAGTTTCAGCTTTCTACTTGTGG - Intergenic
1116792074 14:49349777-49349799 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1116974534 14:51101012-51101034 GAGTTTCAGGTATCTGTGTGGGG + Intergenic
1117098411 14:52320767-52320789 TAGGTTTAGTTTTCTGTTAGGGG - Intronic
1117900195 14:60524449-60524471 CAGGTTCAGCTTTCTATATATGG + Intergenic
1118396610 14:65342479-65342501 AGGGTTCAAGTTTCCGTTTGAGG + Intergenic
1119134461 14:72204221-72204243 TAGCTTCAAGTTTCTGTTTGGGG - Intronic
1119607239 14:76030691-76030713 AAGGTTCAGGATACTGTTTTCGG + Intronic
1120218651 14:81707630-81707652 CAGTTTCAGGTTTCTACATGTGG + Intergenic
1120221046 14:81733982-81734004 CAGTTTCAGTTTTCTGTATACGG + Intergenic
1121069421 14:91003994-91004016 AAGGTCAAGGTTTCAGTTTGGGG + Intronic
1121564288 14:94896899-94896921 CAGGTTGAGGGTTCTGGTGGGGG - Intergenic
1121942912 14:98090297-98090319 CAGTTTCTGTTTTCTGCTTGTGG - Intergenic
1122737977 14:103854851-103854873 TAGGGTCAGGCTTCAGTTTGCGG + Intergenic
1124084650 15:26536357-26536379 CAGTTTCAGTTTTCTGCTTATGG - Intergenic
1125308935 15:38357459-38357481 CAGTTTCAGCTTTCTGTTACAGG + Intergenic
1126715389 15:51510986-51511008 CAGTTTCAGTTTTCTGCATGTGG - Intronic
1126752183 15:51887602-51887624 TCTGTACAGGTTTCTGTTTGGGG - Exonic
1126755848 15:51924136-51924158 CAGGGTCATCTTTCTGTATGTGG + Intronic
1127168419 15:56272236-56272258 CAGGTACAAGTTTCTTCTTGGGG - Intronic
1129482046 15:75834333-75834355 CTGTTTCAGGTGTCTTTTTGTGG + Intergenic
1130677991 15:85971010-85971032 CAGTTTCAGCTTTCTGTATATGG + Intergenic
1131320077 15:91380187-91380209 TATGTGCAGGTTTCTGTGTGTGG + Intergenic
1134038868 16:11052637-11052659 CAGGCACACGATTCTGTTTGTGG + Intronic
1134424160 16:14123478-14123500 CAGTTTCAGTTTTCTGCATGTGG + Intronic
1136781843 16:32909457-32909479 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1136887951 16:33944390-33944412 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1137503869 16:49033627-49033649 CAGTTTCAGCTTTCTGCATGCGG - Intergenic
1137857909 16:51814964-51814986 CAGCTTCATGTTTTTTTTTGGGG + Intergenic
1139584437 16:67892980-67893002 AAGTTTCAAGTTTCTGGTTGGGG - Intergenic
1139756256 16:69146277-69146299 TGAGTACAGGTTTCTGTTTGTGG - Intronic
1141852599 16:86657639-86657661 GAGGTTAAGGTTTCAGTGTGCGG - Intergenic
1142376713 16:89710506-89710528 CCGTTTCAAGCTTCTGTTTGGGG - Intronic
1203084498 16_KI270728v1_random:1173448-1173470 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1143829456 17:9639487-9639509 AAGGTTCATCCTTCTGTTTGGGG + Intronic
1144750683 17:17646213-17646235 GAGGTTCAGGTTTCCTTCTGGGG + Intergenic
1145761500 17:27428218-27428240 CAGTTTCAGCTTTCTGCATGTGG + Intergenic
1146608287 17:34281972-34281994 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1146743706 17:35309133-35309155 CAGATTCAGGTTTCTGCATATGG - Intergenic
1146745868 17:35329101-35329123 CAGTTTCAGTTTTCTGCTTATGG + Intergenic
1149105791 17:52962728-52962750 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
1151166015 17:72204433-72204455 CATGATCAGGTTCCTCTTTGTGG - Intergenic
1153755711 18:8280805-8280827 CAGGTGCAGGGTGCTGGTTGCGG - Intronic
1155911385 18:31508124-31508146 CAGTTTCAGTTTTCTGCATGTGG + Intronic
1155938552 18:31779735-31779757 CGGGTGCAGGTATGTGTTTGTGG - Intergenic
1156140761 18:34107802-34107824 CAAGTTCATGTTTCTGTGAGGGG - Intronic
1157178386 18:45473074-45473096 CAGGTTCAGTTTTCTGCATATGG + Intronic
1157278347 18:46328505-46328527 CAGGCTCAGGTTTCATTTTCTGG + Intronic
1158099088 18:53809114-53809136 CAGTTTCAGTTTTCTGTGTATGG - Intergenic
1158210477 18:55043763-55043785 CAGTTTCAGGTTTCTGCATATGG - Intergenic
1158297215 18:56011762-56011784 CAGTTTCAGTTTTCTGGATGTGG + Intergenic
1158560580 18:58510082-58510104 CAGTTTCAGCTTTCTGCATGTGG + Intronic
1158869591 18:61672092-61672114 AAGGATCAGGGTTCTATTTGTGG + Intergenic
1159290644 18:66414497-66414519 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
1165073520 19:33268764-33268786 CAGCTTCCTGTTTCTGTTTTGGG + Intergenic
1166938653 19:46350078-46350100 CAGGGTCAGGTTTGTGTTTTAGG + Intronic
1167014917 19:46834870-46834892 AAGGATAAGGTTTCTTTTTGGGG + Intergenic
1167172864 19:47844923-47844945 CAGGTTAAGATTTTTGTTGGGGG + Intergenic
1167801650 19:51746794-51746816 CAGGTTCAGGTAACTGATGGTGG + Exonic
1168138502 19:54368153-54368175 CAGGTTCAGTATTCAGCTTGAGG - Intronic
1168159463 19:54499855-54499877 CAGGTTCAGTATTCAGCTTGAGG + Intronic
926237940 2:11062484-11062506 CAGTTTCAGTTTTCTGTATATGG - Intergenic
926709021 2:15861176-15861198 CCAGTTCAGGTTTCTGTCTTTGG - Intergenic
927070370 2:19522724-19522746 AAGGTGAGGGTTTCTGTTTGTGG - Intergenic
930564491 2:53002372-53002394 CAGATTCAGGTTACATTTTGAGG - Intergenic
930589614 2:53311892-53311914 CAGGTTCAGGTGTCTAGCTGCGG + Intergenic
930810199 2:55532116-55532138 CAGCCTCAGACTTCTGTTTGAGG + Intronic
931839396 2:66132493-66132515 CAGATATAGGTGTCTGTTTGTGG - Intergenic
933105692 2:78322304-78322326 CAGCTTCAGGTTTCATTTTTAGG - Intergenic
933388176 2:81637648-81637670 CAGTTTCAGTTTTCTGCATGTGG + Intergenic
933603618 2:84358763-84358785 CAGTTTCAGTTTTCTGTGTATGG - Intergenic
934158064 2:89221660-89221682 CAGGAGGAGGTTTCTGTTAGGGG + Intergenic
934209200 2:89960764-89960786 CAGGAGGAGGTTTCTGTTAGGGG - Intergenic
934481163 2:94646321-94646343 CAGTTTCAGTTTTCTGTATATGG + Intergenic
934757636 2:96835377-96835399 CATGTACAGGTTTCTGTGTCAGG + Intronic
935231411 2:101100832-101100854 CAGTTTCAGTTTTCTGCATGTGG - Intronic
935683349 2:105658547-105658569 CAGCTTCATTTTTCTGTATGTGG - Intergenic
935961912 2:108434287-108434309 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
936256420 2:110918352-110918374 CAGTTTCAGTTTTCTGTATATGG - Intronic
936614799 2:114037750-114037772 GGGGTTCAGGTTTCTGGTTTGGG + Intergenic
936808193 2:116362803-116362825 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
936847787 2:116857459-116857481 CAGGTTCAGTCTTCTGTATGTGG - Intergenic
937188741 2:120071722-120071744 CAGGTTCAGTTTTCTGCATATGG - Intronic
937419894 2:121745454-121745476 CAGTTTCAGTTTTCTGTATATGG + Intronic
937807731 2:126165715-126165737 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
937822105 2:126322110-126322132 CAGCCCCAGGTTTCTGTTAGGGG + Intergenic
937823552 2:126339617-126339639 CAGTTTCAGTCTTCTGTTTATGG - Intergenic
938487663 2:131729013-131729035 CAGGTTCAGGGTTCTTTCTTGGG + Intronic
939206131 2:139106317-139106339 CAGTTTCAGTTTTCTGCTTATGG + Intergenic
939539992 2:143482108-143482130 CAGGTTAAGGTTAATGTTTATGG + Intronic
939666235 2:144955055-144955077 AATGTGCAAGTTTCTGTTTGGGG - Intergenic
940069757 2:149672694-149672716 CAGTTTCAGTTTTCTGCATGTGG + Intergenic
940439827 2:153701288-153701310 CAGTTTCAGTTTTCTGCTTATGG - Intergenic
940836880 2:158531950-158531972 AAGTTTCAGGTTTCTGCTGGTGG - Intronic
942302434 2:174574845-174574867 CAGATTCAGCTTTCTTTGTGAGG - Intronic
942407716 2:175673583-175673605 CAGTTTCAGTTTTCTGTATATGG - Intergenic
943095466 2:183423023-183423045 CAGGTTCAGGGTCCTTTCTGGGG + Intergenic
943274430 2:185848627-185848649 CAGTTTCAGCTTTCTGTATATGG + Intergenic
943697921 2:190956319-190956341 CAGGTTCAGTTTTCTGCATATGG + Intronic
943832558 2:192481186-192481208 CAGTTTCAGGTTTGTTTTTCAGG + Intergenic
944378421 2:199076534-199076556 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
944979660 2:205101897-205101919 GAGTTTGAGGTTTCTTTTTGGGG + Intronic
944984386 2:205158712-205158734 CAGGTTCTCCTTTCTGTTAGGGG - Intronic
944988298 2:205204647-205204669 CAGTTTCAGTTTTCTGCGTGTGG + Intronic
945490616 2:210450287-210450309 CAGTTTCAGTTTTCTGTATATGG - Intronic
946667488 2:222066358-222066380 CAGGATCAGCTTTGTGTTTGGGG - Intergenic
947269112 2:228313846-228313868 CAATTTCAGGCTTCTGTTTATGG + Intergenic
948545954 2:238729071-238729093 CAAGTTCACGTTGCTTTTTGAGG - Intergenic
948745816 2:240093032-240093054 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1169016550 20:2297449-2297471 CTGGCTCTGGTTTCTTTTTGTGG - Intronic
1169344520 20:4819962-4819984 CAGGTTGATGCTGCTGTTTGCGG - Intronic
1169785987 20:9359596-9359618 CAGGCTCAGGCTTCGGCTTGGGG + Intronic
1170306127 20:14940056-14940078 CAGGTTTAGGTTTTTGATTTAGG - Intronic
1171193979 20:23182467-23182489 CAGTTTCAGCTTTCTGTATATGG + Intergenic
1172055620 20:32152397-32152419 CAGCTTCAGGTTTCTGGCTTGGG - Intronic
1172181312 20:33005343-33005365 CATGTTCAGGTTTTAGTGTGTGG - Intergenic
1172994521 20:39060096-39060118 CAGGTACAGGGTTTTGTTTGGGG + Intergenic
1173027488 20:39322173-39322195 CAGGTTCAGGTTTGGTTTTTTGG + Intergenic
1173248398 20:41351824-41351846 CAGGTGCTGGCTTCTCTTTGGGG - Exonic
1173853558 20:46234317-46234339 CAGGTTCTGGTTTCCGCTTCTGG + Intronic
1175618071 20:60420444-60420466 CAGGTTCAGGCTTCTATGAGAGG - Intergenic
1175829798 20:61957158-61957180 CATGTGCAGGTGTCTTTTTGAGG - Intronic
1176046021 20:63093022-63093044 CTGGGTCTGGGTTCTGTTTGTGG - Intergenic
1176278529 20:64287463-64287485 CAGGTTCGGGGTTCGGGTTGGGG + Intronic
1177049985 21:16220985-16221007 CAGGTTCATGTTCTTTTTTGAGG + Intergenic
1177183720 21:17770953-17770975 CAGTTTCAGCTTTCTGCTTATGG + Intergenic
1177498242 21:21916938-21916960 CATGTTCAGGTTGTTGGTTGAGG - Intergenic
1177588187 21:23126625-23126647 CAGATTCAGGTATCTGTTATAGG - Intergenic
1177705599 21:24699973-24699995 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1178057303 21:28813870-28813892 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1178060408 21:28847817-28847839 CAGTTTCAGTTTTCTGTATGTGG + Intergenic
1178287170 21:31335311-31335333 CATGTTTAGGTTTCACTTTGTGG - Intronic
1178985698 21:37300997-37301019 CAAGTTCTGTTTTCTGTATGAGG + Intergenic
1179125650 21:38588396-38588418 CAGGTTCTGTGTTCTGTATGGGG + Intronic
1180492171 22:15859980-15860002 CAGGTTCAGGGTTCTTTCTTGGG + Intergenic
1181081133 22:20416302-20416324 CAGTTTCTGTTTTCTGCTTGTGG + Intergenic
1181665085 22:24389485-24389507 CAGGTTTATATTTGTGTTTGTGG + Intronic
1183111507 22:35652594-35652616 CAGTTTCAGCTTTCTGCGTGTGG + Intronic
1183153584 22:36056627-36056649 AAGGTCCAGTTTTCAGTTTGGGG + Intergenic
1184313550 22:43664805-43664827 CAGGCCCTGGTTTGTGTTTGAGG + Intronic
949273878 3:2255083-2255105 CAGTTTCAGTTTTCTGCTTACGG + Intronic
949380783 3:3443435-3443457 TTGGTACAGGTTTCTTTTTGAGG + Intergenic
949593087 3:5514067-5514089 CAGTTTCAGGTTTCTGCATATGG - Intergenic
949667866 3:6362126-6362148 CAGGTTCATTCTTCTGTATGTGG - Intergenic
950146251 3:10651979-10652001 CAGGTTCAGGTTTCTGTTTGGGG + Intronic
951548276 3:23851087-23851109 CAGTTTCATTTTTTTGTTTGTGG + Intronic
951572535 3:24080143-24080165 CAGTTTCAGCTTTCTATGTGTGG + Intergenic
951801361 3:26599848-26599870 CATGTCAAGGTTTCTGTTTAAGG + Intergenic
951859408 3:27235058-27235080 CAGTTTCAATTTTCTGCTTGTGG - Intronic
952010002 3:28889807-28889829 CAGTTTCAGTTTTCTGTATGTGG + Intergenic
952133099 3:30386887-30386909 CAGTTTCAGCTTTCTGCATGCGG + Intergenic
953043942 3:39278885-39278907 CAGGCTCAGGTTTGTGTGGGTGG - Intronic
953092149 3:39739162-39739184 CAGTTTCAGTTTTCTGCATGTGG + Intergenic
953181915 3:40603703-40603725 CAGATTCAGGTTTGGTTTTGTGG - Intergenic
953287100 3:41621557-41621579 CAGTTTCAGTTTTCTGCATGTGG - Intronic
953387247 3:42513598-42513620 CAGGTTCAGGTTTCAGTCTTGGG + Intronic
955095173 3:55790058-55790080 CAGGATCAGGTTCATGTTTGGGG - Intronic
956150755 3:66239889-66239911 CAGCTTCAGGTTTCAGTCTGTGG + Intronic
956350360 3:68328402-68328424 TAGTTTCAGATTTGTGTTTGGGG + Intronic
957596167 3:82269593-82269615 CAGTTTCAGTTTTCTGCATGTGG + Intergenic
957626575 3:82660183-82660205 CAGTTTCAGTTTTCTGTATATGG + Intergenic
957851523 3:85813736-85813758 CAGTTTCAGTTTTCTGTATATGG + Intronic
958127332 3:89373773-89373795 CTGGATCAGGCTTCTATTTGTGG + Intronic
958507542 3:94999397-94999419 CAGTTTCAGTTTTCTGCATGTGG + Intergenic
958649737 3:96923827-96923849 CAGTTTCAGTTTTCTGTATATGG + Intronic
958720009 3:97832512-97832534 CAGTTTCAGTTTTCTGCATGTGG - Intronic
958766695 3:98377657-98377679 CAGGTTCAGTTTTATGGGTGTGG - Intergenic
958972251 3:100624733-100624755 CAGTTTCAGTTTTCTGCATGTGG + Intronic
959216984 3:103463721-103463743 CAGTTTCAGTTTTCTGTATATGG - Intergenic
959454210 3:106538988-106539010 CAGTTTCAGTTTTCTGTATATGG - Intergenic
959921925 3:111877764-111877786 CAGTTTCAGTTTTCTGTATATGG + Intronic
960161518 3:114355312-114355334 CAGGTTTAGGTTTGTCTCTGTGG - Intronic
960536881 3:118824727-118824749 CTGGTGCTGTTTTCTGTTTGTGG - Intergenic
960786334 3:121376430-121376452 CAGTTTCAGTTTTCTGTATACGG + Intronic
961228465 3:125276763-125276785 CACATTCAGGCTTCTTTTTGGGG + Intronic
962180636 3:133202490-133202512 CAGGTTCAGTTTTCTGCATATGG + Intronic
962633951 3:137310205-137310227 CAGTTTCAGCTTTCTGTATATGG + Intergenic
962692780 3:137917180-137917202 CAGTTTCAGTTTTCTGCTTATGG + Intergenic
962743997 3:138383962-138383984 CAGGTGCAGCTTTCTCTTTTAGG - Intronic
963024593 3:140906398-140906420 CAGATTCAGGTTTCTTTGAGAGG + Intergenic
963460691 3:145611204-145611226 CAGCTTCAGGTTTCTGATGCTGG - Intergenic
963577231 3:147076199-147076221 CAGCTTCAGTTTTCTGCATGTGG + Intergenic
964029200 3:152116898-152116920 CAGTTTCAGTTTTCTGTCTATGG + Intergenic
965110176 3:164410951-164410973 CAGTTTCAGTTTTCTGTATATGG + Intergenic
965933814 3:174080747-174080769 CAGTTTCAGGTTTTTTTTTTTGG + Intronic
966408488 3:179624168-179624190 CAGATTGAGGCTTTTGTTTGAGG + Exonic
966548806 3:181182112-181182134 GATCTCCAGGTTTCTGTTTGTGG + Intergenic
966673184 3:182552513-182552535 CAGTTTCAATTTTCTGCTTGTGG + Intergenic
967145230 3:186600847-186600869 CAACTCCAGGCTTCTGTTTGGGG + Intergenic
967181045 3:186904726-186904748 CAGTTTCAGTTTTCTGCATGTGG + Intergenic
967758593 3:193198387-193198409 CAGTTTCAGTTTTCTGTATATGG + Intergenic
968108096 3:196017470-196017492 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
968267136 3:197370934-197370956 CCAGGTCAGGTTTCTGTCTGGGG - Intergenic
968860197 4:3162120-3162142 CAGTTTCAGTTTTCTGCATGTGG + Intronic
969163478 4:5282175-5282197 CAGTTTCAGGTATCTGCTAGGGG - Intronic
970141302 4:12985006-12985028 CAGGTTCAGTTTTCTGCATATGG + Intergenic
970169148 4:13272102-13272124 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
970286770 4:14526377-14526399 CAGTTTCAAGTTTCTGTATGTGG - Intergenic
971267571 4:25108667-25108689 CAGGTGGAGGTGTCTGCTTGGGG - Intergenic
971954134 4:33394175-33394197 CAGGCTCAGATGTCTTTTTGAGG - Intergenic
972948200 4:44284415-44284437 CAGTTTCAGTTTTCTGCATGTGG - Intronic
973806146 4:54527816-54527838 CAGGTGCGGGATTCTGTTTGAGG - Intergenic
974222416 4:58992902-58992924 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
974769092 4:66387520-66387542 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
974885720 4:67814610-67814632 CAGTTTCAGTTTTCTGTCTATGG - Intergenic
974968406 4:68794401-68794423 CAGTTTCAGTTTTCTGCATGTGG + Intergenic
975063422 4:70033999-70034021 CAGTTTCAGTTTTCTGTATATGG - Exonic
975097095 4:70469200-70469222 CAGTTTCAGTTTTCTGCATGTGG - Intronic
975104777 4:70555189-70555211 CAGTTTCAGTTTTCTGTATATGG - Intergenic
975479756 4:74864745-74864767 CAGTTTCAGTTTTCTGTGTATGG - Intergenic
975519150 4:75279798-75279820 CAGTTTCAGTTTTCTGTATATGG - Intergenic
975524735 4:75336483-75336505 CAGTTTCAGTTTTCTGTATATGG - Intergenic
975765130 4:77659628-77659650 CAGTTTCAGTTTTCTGTGTATGG - Intergenic
976452984 4:85213393-85213415 CAGTTTCAGTCTTCTGTATGTGG + Intergenic
976532706 4:86173414-86173436 CAGGTTCAGTTTTCTGCATATGG - Intronic
977142047 4:93386074-93386096 CAAGTTCAGCTTTGTGTTTTGGG - Intronic
977665568 4:99643579-99643601 CTGTCTCAGGTTTCTTTTTGGGG + Intronic
978172428 4:105689268-105689290 CAGTTTGAGGAATCTGTTTGAGG + Intronic
978185569 4:105853306-105853328 CAGTTTCAGTTTTCTGTGTATGG + Intronic
978236454 4:106466754-106466776 CAGTTTCAGTTTTCTGTGTATGG + Intergenic
978721536 4:111915913-111915935 CAGTTTCAGTTTTCTGCGTGTGG + Intergenic
979581820 4:122369717-122369739 CAGTTTCAGGTTTCTGCTTATGG - Intergenic
979587755 4:122441283-122441305 CAGTTTCAGGTTTCTGCATATGG + Intergenic
980151209 4:129050922-129050944 CAGTTTCTGTTTTCTGCTTGTGG + Intronic
980593583 4:134924216-134924238 CAGTTTCAGCTTTCTATATGTGG + Intergenic
981432689 4:144679570-144679592 CAGTTTCAGTTTTCTGTATATGG + Intronic
983051727 4:163055846-163055868 CAGTTTCAGTTTTCTGTATATGG + Intergenic
983079670 4:163369764-163369786 CAGTTTCAGCTTTCTGCATGTGG - Intergenic
983813276 4:172090892-172090914 CAGTTTCAGTTTTCTGCTTATGG + Intronic
983958445 4:173724001-173724023 CAGTTTCAGTTTTCTGTATATGG + Intergenic
983988759 4:174092913-174092935 CAGCTTCAGTTTTCTGCATGTGG + Intergenic
985108750 4:186525674-186525696 CAGATTCAGGTTTGAGTTTTAGG + Intronic
985232615 4:187837419-187837441 CAGTTTCAGTTTTCTGTATGTGG + Intergenic
985268037 4:188168098-188168120 CAGGCACAAGTTCCTGTTTGGGG - Intergenic
985984034 5:3498728-3498750 CAGTTTCAGTTTTCTGTATATGG - Intergenic
986484791 5:8224968-8224990 CAGTTTCAGTTTTCTGTGTATGG - Intergenic
986915001 5:12608846-12608868 CAAGTTCAGTTTTCTGCTTATGG + Intergenic
987183661 5:15392127-15392149 CACTTTCATGTTTCTGTTGGAGG + Intergenic
987514770 5:18891166-18891188 CAGTTTCAGTTTTCTGTATATGG - Intergenic
987547546 5:19332404-19332426 TGGGTTCAGGATTCTGTTTATGG + Intergenic
987833145 5:23124804-23124826 CAGTTTCAGTTTTCTGTATATGG + Intergenic
988084514 5:26458147-26458169 CAGGTTCAGTTTTCTGCATATGG + Intergenic
988110895 5:26817700-26817722 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
988268558 5:28984257-28984279 CAGTTTCAGTTTTCTGTATGTGG + Intergenic
988352664 5:30131562-30131584 CAGTTTCAGTTTTCTGCTTATGG + Intergenic
988390493 5:30622162-30622184 CAGCTTCAGTTTTCTGCATGTGG + Intergenic
989324907 5:40180966-40180988 CAGTTTCAGCTTTCTGCTTATGG - Intergenic
989820580 5:45791072-45791094 CAGTTTCAGCTTTCTGCTTATGG - Intergenic
989949909 5:50285039-50285061 CAGTTTCAGCTTTCTGCTTATGG - Intergenic
990183285 5:53186219-53186241 CAGGTTCAGTTTTCTGCATATGG + Intergenic
990218247 5:53558298-53558320 TAGGTTCAGGTTTTTGCTTGTGG - Intergenic
990437152 5:55804520-55804542 CAGTTTCAGCTTTCTTTTTATGG + Intronic
990668569 5:58101317-58101339 CAGTTTCAGGTTTCTGCATATGG + Intergenic
990871908 5:60441381-60441403 CAGTTTCAGTTTTCTGCTTATGG - Intronic
990940301 5:61196088-61196110 CAGTTTCAGGCTTCTGCATGTGG + Intergenic
991225454 5:64265424-64265446 CAGTTTCAGTTTTCTGCATGTGG + Intronic
992093229 5:73338175-73338197 CAGGTTCAAGTATCTGCTTTTGG + Intergenic
992142488 5:73813084-73813106 AAGGTTGAGGTTTATGTGTGTGG - Intronic
992254299 5:74906100-74906122 CAGTTTCAGGTTTCTGCATATGG + Intergenic
992358676 5:76012802-76012824 CAGTTTCAGTTTTCTGTATATGG + Intergenic
992488201 5:77215924-77215946 CAGGTTGAGACTTCTGATTGGGG + Intronic
992556720 5:77911027-77911049 TAGCTTCAAATTTCTGTTTGTGG + Intergenic
992814369 5:80421492-80421514 CAGTTTCAGCTTTCTTTTTATGG + Intronic
993163374 5:84318600-84318622 CAGTTTCAGCTTTCTGCATGTGG - Intronic
993221264 5:85100420-85100442 CAGTTTCAGTTTTCTGTATATGG + Intergenic
993253784 5:85560977-85560999 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
993892203 5:93488035-93488057 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
993895419 5:93527790-93527812 CAGGTTCAGTTTTCTGCATATGG - Intergenic
994707095 5:103220168-103220190 CAGTTTCAGTTTTCTGCATGTGG + Intergenic
994966473 5:106679120-106679142 CAGTTTCAGTTTTCTGCTTATGG + Intergenic
995182493 5:109241731-109241753 CAGTGTCAGTTTTCTGTCTGTGG + Intergenic
995211334 5:109542928-109542950 CAGTTTCAGCTTTCTGCATGTGG - Intergenic
995228610 5:109732560-109732582 CAGTTTCAGCTTTCTGCTTATGG + Intronic
995232501 5:109784476-109784498 CAGGTTCTGGCTTCTTTTTCAGG + Intronic
995316417 5:110779643-110779665 CAGTTTCAGTTTTCTGCTTATGG + Intergenic
995419711 5:111950340-111950362 CAGTTTCAGTTTTCTGTATATGG - Intronic
995612525 5:113925179-113925201 CAGGTTCAGCTTTCTGCATATGG - Intergenic
995668251 5:114569120-114569142 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
996043887 5:118848819-118848841 CAGTTTCAGTTTTCTGTGTATGG - Intronic
996277074 5:121680034-121680056 CAGGTTCAGATTTCTGCATATGG - Intergenic
997094625 5:130897215-130897237 CAGTTTCAGCTTTCTCTATGTGG - Intergenic
997278580 5:132621518-132621540 TAGGTTCAGTTTTCTTTTTTTGG + Intronic
999469226 5:151836740-151836762 CAGTTTCAGTTTTCTGCTTAAGG - Intronic
999852469 5:155557612-155557634 CAGGTACAGATTTCTTTTTGGGG - Intergenic
999935557 5:156482010-156482032 AAGGAGCAAGTTTCTGTTTGAGG - Intronic
1001167146 5:169379831-169379853 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
1001345937 5:170898717-170898739 CAGTTTCAGTTTTCTGTATATGG + Intronic
1001408490 5:171493963-171493985 CAGGTGCAGCTGTCTGCTTGTGG - Intergenic
1002754598 6:147784-147806 CAGGTTCGGGGTTCGGGTTGGGG - Intergenic
1003009442 6:2412888-2412910 GAGGTTCAGGTTGCTGCTTTGGG - Intergenic
1003249204 6:4410678-4410700 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1003309847 6:4960651-4960673 CAGGTACAGGTTTTTATTTGGGG + Intergenic
1003369651 6:5511857-5511879 CAGGTTCAGGAGTCTGTTAGAGG + Intronic
1003984166 6:11419007-11419029 CAGATTGAAGTTTCTATTTGGGG - Intergenic
1005841074 6:29744907-29744929 CAGGTTCAGGCTTCTATAGGAGG + Intergenic
1005870499 6:29971444-29971466 CAGGTTCAGGCTTCTGTCAGAGG + Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1006072288 6:31506648-31506670 CAGGCTCAGGCTTCTGTCAGAGG - Intronic
1006416611 6:33908073-33908095 CAGGTTAATGATTATGTTTGGGG + Intergenic
1006999248 6:38293611-38293633 CAGTTTCAGTTTTCTGCATGTGG - Intronic
1008060026 6:46987129-46987151 CAGCCTCAGGTATCTTTTTGTGG - Intergenic
1008250025 6:49228291-49228313 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
1008361524 6:50624785-50624807 CAGTTTCAGCTTTCTATATGTGG - Intergenic
1008407180 6:51131570-51131592 CAGTTTCAGTTTTCTGTGTATGG + Intergenic
1009241235 6:61188398-61188420 CAGTTTCAGTTTTCTGCTTATGG - Intergenic
1009661822 6:66622368-66622390 CAGTTTCAGCTTTCTGCATGTGG - Intergenic
1009724121 6:67514487-67514509 CAGTTTCAGCTTTCTGCTTATGG + Intergenic
1009731567 6:67614483-67614505 CAGTTTCAGCTTTCTGCATGTGG + Intergenic
1009802115 6:68551935-68551957 CAGTTTCAGTTTTCTGCTTATGG - Intergenic
1010077474 6:71817159-71817181 CAGTTTCAGCTTTCTGCATGTGG + Intergenic
1010355551 6:74928413-74928435 CAGGTTGAGGTGTCTGCCTGAGG + Intergenic
1010375358 6:75162453-75162475 CAGTTTCAGCTTTCTGTGTATGG - Intronic
1010822239 6:80429069-80429091 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1011012667 6:82719638-82719660 CAGTTTCAGCTTTCTATGTGTGG - Intergenic
1011308040 6:85950970-85950992 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
1011858485 6:91725185-91725207 CAGTTTCAGCTTTCTGTATATGG + Intergenic
1012096231 6:94965740-94965762 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1012425486 6:99109555-99109577 CAGGTTTTGGTTTCTGTCTTGGG + Intergenic
1012461366 6:99464759-99464781 GAGGTTTTGGTTTCTGTATGTGG - Intronic
1012963440 6:105647030-105647052 CAGGTTCAGGGGTCTGTGAGTGG - Intergenic
1013901457 6:115161847-115161869 CAGGTTCAGTTTTCTGCATATGG + Intergenic
1014043331 6:116854508-116854530 CAGTTTCAGTTTTCTCTATGTGG - Intergenic
1014059919 6:117059728-117059750 CAGTTTCAGTTTTCTGCATGTGG + Intergenic
1014113814 6:117650475-117650497 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1015282096 6:131444679-131444701 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
1015694928 6:135969565-135969587 CAGTTTCAGTTTTCTGTATATGG - Intronic
1016691209 6:146940127-146940149 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1016905530 6:149146899-149146921 CAGTTTCAGTTTTCTGCATGTGG + Intergenic
1017217171 6:151922256-151922278 CAGTTTCAATTTTCTGTATGTGG - Intronic
1017886624 6:158605305-158605327 CTGGTTCCGGTTTTTCTTTGTGG + Exonic
1018741427 6:166732177-166732199 CAGGTTGATGTTACTGTTTTTGG - Intronic
1018749121 6:166787617-166787639 CAGTTTCAGTTTTCTGCTTATGG - Intronic
1019207114 6:170371100-170371122 GAGGTAGAGGTTTCTTTTTGAGG - Intronic
1019238604 6:170645115-170645137 CAGGTTCAGTTTTCTGCATATGG + Intergenic
1019972831 7:4555663-4555685 CAGTTTCAGTTTTCTGCATGTGG + Intergenic
1020230108 7:6311856-6311878 TGGGTACAGGTTTCTTTTTGGGG + Intergenic
1020390952 7:7657510-7657532 CAGTTTCAGTTTTCTGTATATGG + Intronic
1020575650 7:9923801-9923823 CAGTTTCAGGTTTCTGCATATGG + Intergenic
1020806450 7:12795698-12795720 CAGGGTCAGGTTTCTGCTGATGG - Intergenic
1020810422 7:12844472-12844494 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1021060238 7:16102250-16102272 CAGTTTCAGTTTTCTGTATATGG - Intronic
1021072292 7:16255736-16255758 CAGTTTCAGCTTTCTGCTTATGG - Intronic
1022423887 7:30249163-30249185 CAGATTCTGTTTTGTGTTTGGGG + Intergenic
1022650097 7:32266716-32266738 CTGGTTCAGGTCTCTGTTTAAGG - Intronic
1024730614 7:52249960-52249982 CAGGGTGATGTTTCTGTTTAGGG - Intergenic
1024914961 7:54488700-54488722 TAGGTTCAGGTCTCTGGGTGGGG - Intergenic
1025600747 7:62994404-62994426 CAGTTTCAGGTTTCTATATATGG + Intergenic
1026669477 7:72375886-72375908 AAGAATGAGGTTTCTGTTTGGGG - Intronic
1026691046 7:72550241-72550263 GAGGGTTAGGTTTCTGCTTGGGG - Intergenic
1026731599 7:72916367-72916389 CAGTTTCAGCTTTCTGTATATGG + Intronic
1027112444 7:75451463-75451485 CAGTTTCAGTTTTCTGTATATGG - Intronic
1027284689 7:76636069-76636091 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1027850248 7:83442634-83442656 CGGGGTCAGGTTTTTGTTTGTGG + Intronic
1028336980 7:89670153-89670175 CAGTTTCAGTTTTCTGTATGTGG + Intergenic
1028627505 7:92893928-92893950 CAGGTTCAGTTTTCTGCATATGG + Intergenic
1028787860 7:94817011-94817033 CAGTTTCAGTTTTCTGCATGTGG + Intergenic
1028800107 7:94953155-94953177 CAGTTTCAGTTTTCTGCTTATGG + Intronic
1028800948 7:94965517-94965539 CAGTTTCAGTTTTCTGCTTATGG + Intronic
1029875490 7:103746210-103746232 CAGTTTCAGCTTTCTGTGTATGG - Intronic
1031641732 7:124172900-124172922 CAGTTTCAGCTTTCTGCATGTGG + Intergenic
1032882692 7:136106179-136106201 CAGTTTCATCTTTCTGTATGTGG + Intergenic
1032883015 7:136110100-136110122 CAGTTTCAGCTTTCTGCATGTGG + Intergenic
1033780042 7:144658132-144658154 AGGGTACAGGTTTCTTTTTGAGG + Intronic
1034138389 7:148793425-148793447 TGGGTGCAGGTTTCTTTTTGGGG - Intronic
1034368788 7:150575672-150575694 CAGTTTCAGCTTTCTATTTATGG + Intergenic
1036558449 8:9881495-9881517 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
1037029900 8:14092015-14092037 CAGGTTCAGCTTTCTGCGTATGG + Intronic
1039350046 8:36754356-36754378 TGGGTTCATGTTTGTGTTTGGGG - Intergenic
1040862172 8:52010429-52010451 CAGATTCATGTTTTTGTGTGAGG - Intergenic
1041608761 8:59818471-59818493 CAGTTTCAGCTTTCTGTATATGG - Intergenic
1041933792 8:63314963-63314985 CAGGTTCAGGCTGCTGTTGCTGG + Intergenic
1042167631 8:65961028-65961050 TAGGTTCAGGTTTTTATTTTTGG - Intergenic
1042196508 8:66235578-66235600 CAGTTTCAGTTTTCTGTGTATGG - Intergenic
1042231966 8:66566899-66566921 CAGGTTCATCTTCCTCTTTGAGG + Exonic
1042345777 8:67726177-67726199 CAGGTTGAGGTTACTGGTTAGGG + Intronic
1043309113 8:78836195-78836217 CAGTTTCAGTTTTCTGCTTATGG - Intergenic
1043602148 8:81953496-81953518 CTGGTTCCGATTTCTGTTAGGGG + Intergenic
1043785118 8:84389040-84389062 CAGTTTCAGCTTTCTATATGTGG + Intronic
1044100291 8:88127609-88127631 CATGTTAAGTTTTCTGTTTTTGG - Intronic
1044161994 8:88930761-88930783 CAGTTTCAGCTTTCTGCATGTGG - Intergenic
1044473393 8:92598579-92598601 CAGTTTCAGGCTTCTGTATATGG - Intergenic
1046171612 8:110515470-110515492 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1046245589 8:111556775-111556797 CAGTTTCAGTTTTCTGCTTATGG + Intergenic
1046603657 8:116346436-116346458 CAGTTTCAGTTTTCTGCTTATGG + Intergenic
1046756545 8:117978533-117978555 CTGGGTCATATTTCTGTTTGAGG + Intronic
1047134130 8:122056288-122056310 CAGTTTCAGTTTTCTGCTTTTGG - Intergenic
1048240534 8:132737122-132737144 GAGTATCAGGTTTCTTTTTGGGG + Intronic
1049965046 9:771655-771677 CAGTTTCAGTTTTCTGTGTATGG - Intergenic
1050000007 9:1067353-1067375 CAGTTTCAGTTTTCTGCTTATGG + Intergenic
1051391139 9:16565256-16565278 CAGGTTAAGGATTTTGTGTGTGG - Intronic
1051670028 9:19500341-19500363 CAGTTTCAGTTTTCTGCTTATGG + Intergenic
1051950946 9:22632110-22632132 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
1052270339 9:26621866-26621888 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1052335854 9:27319195-27319217 CAGTTTCAGTTTTCTGCATGTGG + Intergenic
1052379430 9:27754141-27754163 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
1052475232 9:28951184-28951206 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
1052753202 9:32513521-32513543 CAGTTTCAGTTTTCTGTATATGG - Intronic
1053676675 9:40437653-40437675 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1053926441 9:43063746-43063768 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1054287044 9:63187257-63187279 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1054289743 9:63273177-63273199 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1054387774 9:64577717-64577739 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1054507947 9:65938651-65938673 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1055080063 9:72259866-72259888 CAGGTTCAAGTTTTTACTTGAGG + Intergenic
1055208882 9:73765122-73765144 CAGGTTCAGTTTTCTGCATATGG - Intergenic
1055210753 9:73787970-73787992 CAGGTTCAGTTTTCTGCATATGG - Intergenic
1055342904 9:75304184-75304206 CAGTTTCAGGGTTCTGTATATGG + Intergenic
1055614683 9:78059155-78059177 CAGTTTCAGCTTTCTGCATGTGG - Intergenic
1056124183 9:83518935-83518957 CAGTTTCAGGTTTCTGCATATGG - Intronic
1056480362 9:86997360-86997382 CACCTTCTGGTCTCTGTTTGAGG + Intergenic
1056763386 9:89429891-89429913 CAGCTGTGGGTTTCTGTTTGGGG + Intronic
1057408219 9:94792910-94792932 CAACTTCAGGTTTGTGTTTGGGG + Exonic
1057807682 9:98232014-98232036 AGGGTGCAGGTTTCTTTTTGGGG + Intronic
1058260247 9:102819328-102819350 CAGTTTCAGTTTTCTGCTTATGG - Intergenic
1058609946 9:106764670-106764692 CAGTTTCAGTTTTCTGCTTATGG + Intergenic
1059409273 9:114122029-114122051 CAGGCTCAGCTTTCTCTCTGGGG + Intergenic
1059630714 9:116118878-116118900 CAGTTTCAGTTTTCTGCATGTGG + Intergenic
1059895570 9:118860553-118860575 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
1060277670 9:122194132-122194154 CAGGTTTAGGTCTATCTTTGGGG - Intronic
1060374936 9:123109198-123109220 CAGGTTCATGTTTCATGTTGAGG + Intergenic
1060521137 9:124294793-124294815 CAGGTTCAGGCTTGTGTGTTAGG + Intronic
1062002631 9:134224583-134224605 AAGGTTCTGGCTTCTGCTTGGGG + Intergenic
1185606120 X:1367903-1367925 CGGGTTCAGGGTCCTTTTTGGGG - Intronic
1186369629 X:8933361-8933383 CAGTTTCAGTTTTCTGCATGTGG + Intergenic
1187331219 X:18341430-18341452 CAGGTTCACGTCACAGTTTGTGG - Intronic
1187352684 X:18535542-18535564 CATCTTCAGGCCTCTGTTTGAGG + Intronic
1187730017 X:22243224-22243246 CAGGTTCAGTTTTCTGCATATGG - Intronic
1188018205 X:25128090-25128112 GAGGTTCATGTTTCTGTTTTAGG + Intergenic
1188202144 X:27304457-27304479 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1188267232 X:28092664-28092686 CAGGCTCTGGTTTTTGTTTGGGG + Intergenic
1189594953 X:42554301-42554323 CAGTTTCAGTTTTCTGCATGTGG + Intergenic
1189644236 X:43109206-43109228 AAGGTTCAGGTATGTGTCTGTGG + Intergenic
1190276456 X:48902586-48902608 CAGGTCCAGGCATCTTTTTGAGG - Intronic
1190530121 X:51366601-51366623 CAGGTTCAGTTTTCTGCATATGG - Intergenic
1190580968 X:51893217-51893239 CATGCTTAGGTCTCTGTTTGGGG - Intronic
1190593302 X:52026840-52026862 CAGTTTCAGTTTTCTGCATGTGG + Intergenic
1190946676 X:55101663-55101685 CTGTTTCAGGCTTCTGTTTTGGG + Intronic
1191099182 X:56706622-56706644 CAGTTTCAGTTTTCTGCATGTGG + Intergenic
1191120745 X:56901662-56901684 CAGTTTCAGTTTTCTGCTTATGG - Intergenic
1191121259 X:56908036-56908058 CAGTTTCAGCTTTCTGCATGTGG + Intergenic
1191134957 X:57053943-57053965 CAGTTTCAGTTTTCTGCTTATGG + Intergenic
1191160415 X:57324038-57324060 CAGTTTCAGCTTTCTGCTTATGG + Intronic
1191771170 X:64760262-64760284 CAGTTTCAGTTTTCTGCATGTGG + Intergenic
1191872509 X:65760632-65760654 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1192712192 X:73602712-73602734 CAGTTTCAGTTTTCTGCTTATGG + Intronic
1192811335 X:74549665-74549687 CAGGTCCAGTTTTCTTTTTCTGG - Intergenic
1192865566 X:75128392-75128414 CAGTTTCAGTTTTCTGCTTATGG - Intronic
1192887394 X:75349647-75349669 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1193072137 X:77317443-77317465 CAGTTTCAGTTGTCTGTTTATGG - Intergenic
1193264658 X:79454102-79454124 CAGTTTCAGCTTTCTGTATAGGG + Intergenic
1193353659 X:80490868-80490890 CAGGTTCAGCTTTCTGTGTATGG + Intergenic
1193464172 X:81827167-81827189 CAGTTTCAGCTTTCTGCATGTGG - Intergenic
1193493889 X:82186965-82186987 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1193547774 X:82850831-82850853 CAGTTTCAGCTTTCTGCTTATGG + Intergenic
1193623615 X:83789009-83789031 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1194376075 X:93135464-93135486 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
1194429812 X:93788127-93788149 GAGGTACAGGTTTCTTTTGGGGG - Intergenic
1194563288 X:95449106-95449128 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1194731017 X:97455883-97455905 CAGGTGCAAGTTTCAGTTTGAGG - Intronic
1194772294 X:97920489-97920511 CAGTTTCAGTTTTCTGCTTGTGG - Intergenic
1194782684 X:98044574-98044596 CAGTTTCAGTTTTCAGTATGTGG + Intergenic
1194811712 X:98395621-98395643 CAGTTTCAGTTTTCTGCTTGTGG - Intergenic
1195149072 X:102046970-102046992 CAGTTTCAGTTTTCTGCTTATGG + Intergenic
1195414675 X:104607182-104607204 CAGTTTCAGTTTTCTGTGTCTGG - Intronic
1195475488 X:105280222-105280244 CAGTTTCAGTTTTCTGCATGTGG - Intronic
1195564142 X:106322846-106322868 CAAGTTGATGTTTCTGTTGGGGG - Intergenic
1195810950 X:108828930-108828952 CTGGTCCAGGTTTTTGTTGGTGG + Intergenic
1196381318 X:115092917-115092939 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
1196808410 X:119608909-119608931 AAGGTTCAGTTGTCTGGTTGGGG - Intergenic
1197049142 X:122037866-122037888 CAGGTTCAGTTTTCTGCATATGG + Intergenic
1197302535 X:124798886-124798908 CAGTTTCAGTTTTCTGTGTATGG + Intronic
1197629640 X:128843497-128843519 CAGTTTCAGCTTTCTGCATGTGG + Intergenic
1197705573 X:129632254-129632276 CAGGTTCAGTTGTCTGTTGAGGG - Intergenic
1198042775 X:132870709-132870731 CAGTTTCAGTTTTCTGCATGTGG - Intronic
1198294942 X:135277685-135277707 CAGTTTCAGTTTTCTGCATGTGG + Intronic
1199186962 X:144926459-144926481 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1199437046 X:147824342-147824364 CAGTTTCAGTTTTCTGCATGTGG - Intergenic
1200228946 X:154434527-154434549 CAGGGTCAGGTCTGTGTTTTGGG + Intronic
1200268486 X:154659651-154659673 CAGGTGCAGGGTTCTGTGCGTGG - Intergenic
1200660055 Y:5946548-5946570 CAACTGCAGGTTTCTGTCTGTGG - Intergenic
1200767321 Y:7091165-7091187 CAGTTGCAGGTGTCTGTTTTGGG + Intronic
1200895115 Y:8367546-8367568 CAGTTTCAGCTTTCTGTATATGG + Intergenic
1201301530 Y:12509306-12509328 CAGTTTCAGTTTTCTGCATGTGG + Intergenic
1201392716 Y:13515628-13515650 CAGTTTCAGCTTTCTATATGTGG + Intergenic
1201394323 Y:13532049-13532071 CAGTTTCAGCTTTCTGCATGTGG + Intergenic
1201405344 Y:13644211-13644233 CAGTTTTGGGTTTCTTTTTGTGG + Intergenic
1201464769 Y:14268463-14268485 CAGTTTCAGCTTTCTGTATATGG + Intergenic
1201580576 Y:15507708-15507730 CAGTTTCAGTTTTCTGCTTATGG - Intergenic
1201623730 Y:15989361-15989383 CAGTTTCAGTTTTCTGCTTATGG - Intergenic
1201689590 Y:16748229-16748251 CAGTTTCAGCTTTCTGCATGTGG + Intergenic
1201704333 Y:16918979-16919001 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1201920166 Y:19225549-19225571 CAGTTTCAGCTTTCTGCTTATGG + Intergenic
1202173499 Y:22075954-22075976 CAGTTTCAGGTTTCTGCATATGG + Intronic
1202217861 Y:22510429-22510451 CAGTTTCAGGTTTCTGCATATGG - Intronic
1202325324 Y:23685630-23685652 CAGTTTCAGGTTTCTGCATATGG + Intergenic
1202545447 Y:25984424-25984446 CAGTTTCAGGTTTCTGCATATGG - Intergenic