ID: 950149964

View in Genome Browser
Species Human (GRCh38)
Location 3:10679297-10679319
Sequence ATTCCTGTGATGTAAGGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 150}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950149964 Original CRISPR ATTCCTGTGATGTAAGGTAT TGG (reversed) Intronic
907696263 1:56732446-56732468 ATTTCTGTGAAGAAAGGCATTGG - Intronic
910432982 1:87177119-87177141 TTTCCTGTGATGTTAGGTTTAGG + Intergenic
911034552 1:93527133-93527155 ATTTATTTGATGTAAGTTATAGG + Intronic
911034810 1:93530635-93530657 ATTCTTTTGATGTCAGGTGTTGG + Intronic
911846945 1:102765690-102765712 ATTCCTGAACTGTAAGGTTTGGG + Intergenic
912591537 1:110825301-110825323 ATTCCTGGGAAGTTAGGTATAGG + Intergenic
912678682 1:111712419-111712441 ATTCCTGTAATCTAAGACATTGG - Exonic
918262549 1:182808991-182809013 ATACCTTTGATGGAAGGTCTTGG + Intronic
918348818 1:183633149-183633171 TTTCCTGTGATGGAAGTTAAGGG + Exonic
920419087 1:205818202-205818224 ATTCCTTCCCTGTAAGGTATAGG - Intergenic
921609176 1:217190665-217190687 ATTCTTGTGGTATAAGGTACTGG - Intergenic
924832532 1:247613385-247613407 ATTCCTGTGAAGCAAGTTGTAGG + Intergenic
1065972257 10:30815000-30815022 ATTCCAGAGATGGAAGGTCTTGG - Intergenic
1067105084 10:43361255-43361277 ATACCTGTGATGTGGGGTTTGGG + Intergenic
1068699042 10:60000673-60000695 ATTCCTGTGATGACTGGTAGGGG - Intergenic
1071585280 10:86814370-86814392 ATTCCTGTTATATAAGAAATAGG + Intronic
1071762976 10:88630104-88630126 ATTCCTGTGAAGAAAGTCATTGG + Intergenic
1073169114 10:101487175-101487197 TTTCTTGTTATATAAGGTATAGG + Intronic
1073765552 10:106678640-106678662 ATGCCTGTTTTGTAAGCTATGGG + Intronic
1074202923 10:111255938-111255960 ATTCATGTGATCTAAGGATTAGG - Intergenic
1075232624 10:120694516-120694538 ATTTCTGTGAAGAAAGTTATTGG + Intergenic
1079191152 11:18277449-18277471 GTGCCTGTGATGTAGCGTATAGG - Intergenic
1085440860 11:76561220-76561242 AACCCTGTGATGTCAGGAATTGG - Intergenic
1085931410 11:81087897-81087919 TTTCCTGTGCTGAAAAGTATCGG - Intergenic
1086105779 11:83145153-83145175 CTTCCTGAGATTTAAGGGATAGG + Intergenic
1086730196 11:90239808-90239830 ATTCTTGGGATGTAATGTACAGG - Intergenic
1086999248 11:93396792-93396814 ATGCCTGAGATGTGAGGTACTGG - Intronic
1089460938 11:118653142-118653164 TTTCCTGTGAAGGAAGGGATGGG + Intronic
1090676459 11:129002120-129002142 ATTCCTGTGAAGTATGTCATTGG + Intronic
1093931581 12:24959883-24959905 ATTACTGGGGAGTAAGGTATAGG + Intergenic
1097654879 12:62346302-62346324 TTTACTGTGATGTGAAGTATAGG + Intronic
1098657414 12:73050575-73050597 ATTCTTGTGATTTTAAGTATTGG - Intergenic
1099549723 12:84028331-84028353 ATTCCATTGATGTTAGGTTTTGG + Intergenic
1099812752 12:87605603-87605625 ATTTCCTTGATGTAAGGTAGAGG - Intergenic
1101455920 12:104830037-104830059 ATTCCTGTACTGTAGGGTAGAGG - Intronic
1101456222 12:104834079-104834101 ATTCCTGTGAGGTGAGGCATTGG - Intronic
1102841599 12:116130672-116130694 CTTCCTGTGATGTACTGTATGGG + Intronic
1103737883 12:123071912-123071934 ATTCCTGAGATGGAAAGGATCGG - Intronic
1106468234 13:30031850-30031872 AGTCCTATGATGGAAGGCATGGG - Intergenic
1111134692 13:84025825-84025847 AATGCTGTGATCTAAGCTATTGG + Intergenic
1114197144 14:20488619-20488641 ATTCCTTTGCTGTGTGGTATTGG - Intergenic
1114959591 14:27868970-27868992 ATTCCTTCGATCTGAGGTATGGG + Intergenic
1116619130 14:47176266-47176288 ATTTCTGTGAAGAAAGGCATTGG - Intronic
1120485388 14:85107264-85107286 ACTGCTGTGATTTAAGGGATGGG - Intergenic
1120667813 14:87327837-87327859 AATCCTTTGATGTAAGCTAAAGG - Intergenic
1122999522 14:105285479-105285501 TTGCATGTGATGTAAGGTAAGGG - Intronic
1124470865 15:29984422-29984444 TTTAGTGTAATGTAAGGTATAGG - Intergenic
1130175672 15:81567457-81567479 ATTCCTGTAATGAAAGCTACTGG - Intergenic
1130365818 15:83237462-83237484 ATTCCTGTTATGTAAAGGTTTGG - Intergenic
1134876016 16:17699373-17699395 ATTGCTGGGTTGTAAGGTAGTGG + Intergenic
1139407741 16:66732795-66732817 CTTCCTGAGAAGTAAAGTATTGG + Intronic
1141015910 16:80449183-80449205 ATTGCTGTGATGAAGGGGATGGG + Intergenic
1203026129 16_KI270728v1_random:513996-514018 AATCCTGTGAAGAAAGGCATTGG - Intergenic
1203045592 16_KI270728v1_random:820435-820457 AATCCTGTGAAGAAAGGCATTGG + Intergenic
1146110056 17:30081208-30081230 ATTCCTGTGATTAATGCTATGGG - Intronic
1151456854 17:74231706-74231728 AGCCCCGTGATGTAAGGTAGTGG + Intronic
1152236522 17:79141908-79141930 CTTCCTGTGAGGTCAGGTAGGGG - Intronic
1203165170 17_GL000205v2_random:87148-87170 ATCCCTGTGATGAAAGTTCTGGG + Intergenic
1154142160 18:11833720-11833742 ATTCCTGTGATGTATGTGCTGGG - Intronic
1156775148 18:40778476-40778498 ATTCATGTGATGTAAAGCTTCGG - Intergenic
1159549321 18:69878283-69878305 TCTTCTGTGATGTAAGGTAATGG - Intronic
1164349483 19:27318488-27318510 AATTCTGTGATGTAAGTCATTGG + Intergenic
925049796 2:804022-804044 AATTCTGTGAAGTAAGGCATTGG - Intergenic
926570529 2:14524906-14524928 ATTCCTGTGGTTTAATGTTTAGG - Intergenic
926831466 2:16966961-16966983 TTTTCTGTGATGAAAGGCATGGG + Intergenic
930388558 2:50730582-50730604 TTTATTGTGATGTAATGTATTGG + Intronic
932150522 2:69367234-69367256 ATTCCTGGTATGTAAAGTATAGG - Intronic
932183126 2:69667570-69667592 TATCCTGTGATGTGATGTATGGG + Intronic
934941641 2:98507222-98507244 ATTCCTTTAATGTGAGGGATGGG - Intronic
936279641 2:111126339-111126361 ATACCTGTGAAGTAAAGTAGTGG + Intronic
936348707 2:111696074-111696096 ATTACTGTGTTATAAGGTAAGGG - Intergenic
937434958 2:121872736-121872758 ATTGCTGTGATTTCAGGTGTTGG - Intergenic
938694992 2:133827010-133827032 ATTCCTGTGCTGTATTCTATCGG - Intergenic
939169655 2:138679860-138679882 ATTCCTGTGATTGCAGGTATAGG - Intronic
939431296 2:142112094-142112116 ATAACTGTGATGTAAGTTATCGG - Intronic
940600279 2:155849726-155849748 ATTCCTGTGAAGTATGCTATTGG - Intergenic
940825121 2:158402488-158402510 TTTCCTGAGGTGTCAGGTATGGG + Intronic
941201013 2:162510523-162510545 ATTCATGTCAGGTGAGGTATTGG - Intronic
942647452 2:178128569-178128591 ATTCCTCTGATGTAGGAAATTGG - Intronic
943011839 2:182459699-182459721 ATTCCTGTTATGGAAGCTAAAGG - Intronic
943191326 2:184682176-184682198 ATTCCTGTGTTGAAAGGGGTGGG + Intronic
943908617 2:193533474-193533496 GTTCCTGTGATGCAAGGAAATGG + Intergenic
948047618 2:234955723-234955745 ATTCCTCTAATTTAAGGTTTGGG + Intronic
1170438248 20:16351979-16352001 ATTCCTTTAATGTAATGTTTTGG - Intronic
1171438667 20:25143662-25143684 ATTCCTGTGGTGGAAAATATAGG + Intergenic
1174320588 20:49738925-49738947 GTTCCTGAGACGTAAGGTTTTGG - Intergenic
1174823427 20:53747093-53747115 ATTCCTGTGATCTAAGCCATTGG + Intergenic
1175686336 20:61031223-61031245 GTTCCTGAAATGTAAGGTATGGG - Intergenic
1175830046 20:61959213-61959235 ATTCCTGTGAGACAAGGGATTGG - Intronic
1176406580 21:6371943-6371965 ATCCCTGTGATGAAAGTTCTGGG - Intergenic
950149964 3:10679297-10679319 ATTCCTGTGATGTAAGGTATTGG - Intronic
957521013 3:81318539-81318561 ATTTCTGTGAAGAAAGGAATTGG + Intergenic
957611348 3:82471429-82471451 ATTCATGTGATGTACCTTATAGG - Intergenic
960075552 3:113480951-113480973 TTTCCTCTTAAGTAAGGTATTGG - Intronic
960766712 3:121138374-121138396 ATTTCTGTGAAGAATGGTATTGG - Intronic
960963712 3:123090256-123090278 ATTCCTCTGCTGTCAGGAATAGG + Intronic
966579893 3:181549143-181549165 TTGCCTGTGATGTTAGCTATGGG + Intergenic
967270310 3:187727401-187727423 ATTCCAGGAATGTAAGATATAGG + Intronic
967863846 3:194174267-194174289 CTCCCTGTGCTGTAAGTTATAGG + Intergenic
972750744 4:41986177-41986199 TTGCCTGTGTTGTAAGGGATGGG + Exonic
973132123 4:46660833-46660855 ATTCCTGTTCAGTTAGGTATGGG - Intergenic
974550797 4:63371144-63371166 ATTCCTTTCATGTATTGTATGGG + Intergenic
976041611 4:80891974-80891996 ATTCCTGTGAAGAATGGCATTGG - Intronic
976072126 4:81253722-81253744 AGTCCTGTGAAGTGAGTTATAGG - Intergenic
976388668 4:84487051-84487073 ATTCCTGTGTTCTTGGGTATGGG - Intergenic
976442746 4:85094659-85094681 ATTCCTGTCATATAAGGTTCAGG - Intergenic
977264400 4:94837285-94837307 ATTTCTGTGAAGAAAGGCATTGG + Intronic
977974783 4:103251793-103251815 AATTCTGTGAAGAAAGGTATTGG + Intergenic
979005291 4:115287167-115287189 ATTCTTGTGATGTTGGCTATGGG + Intergenic
979657419 4:123211732-123211754 CTTCTAGTGATGTAAGGTAATGG - Intronic
983138339 4:164114490-164114512 ATTCCTGTCATTTAAAGAATGGG - Intronic
983257395 4:165416155-165416177 ATTGCTCTGAAGTAAGGTGTAGG + Intronic
984657119 4:182330205-182330227 ATTCATGTAATGTAAGTTTTCGG + Intronic
987612580 5:20225680-20225702 CTTCCTGTGATGTCAAGTACAGG + Intronic
988955796 5:36317152-36317174 ATTTCTGTGATGAATGTTATTGG + Intergenic
989290248 5:39755903-39755925 ATTTCTGGGAAATAAGGTATAGG + Intergenic
989442503 5:41489455-41489477 AATTCTGTGATGAAAGGCATTGG + Intronic
990017342 5:51080332-51080354 ATTCCTGAGATGGAAAGTCTGGG + Intergenic
991257171 5:64627988-64628010 TTTAGTGTGATGCAAGGTATTGG - Intergenic
992281676 5:75183876-75183898 ATTCCTGTGATGAATGTCATTGG - Intronic
995174323 5:109157043-109157065 ATTCCTGTGATTTATGGCCTAGG - Intronic
1202774760 5_GL000208v1_random:58970-58992 AATTCTGTGAAGAAAGGTATTGG + Intergenic
1003093495 6:3123745-3123767 CTTCCTGGGATGTTAGGTCTGGG + Exonic
1004349809 6:14881107-14881129 AGTCCTTTGTTGTAAGGTAAAGG - Intergenic
1004758050 6:18634902-18634924 AATCTTGTGATGTAATGAATAGG + Intergenic
1009696730 6:67115462-67115484 CTTCCTGTGAAGTTAGGTAGAGG - Intergenic
1010516467 6:76778037-76778059 ATTCCAGAGATGGAAGGTTTGGG - Intergenic
1010769677 6:79814034-79814056 AATCATGTGATGGAAGGTAATGG - Intergenic
1010968380 6:82238115-82238137 ATGCCTGTAATCTCAGGTATCGG + Intronic
1011982100 6:93392094-93392116 AATCCTGAGATGGAAGGAATTGG - Intronic
1012903643 6:105038026-105038048 ATTCCTGTGATCTTAGGTTTGGG + Intronic
1018609384 6:165632748-165632770 ATACTTGTGATGAAAGGTATTGG - Intronic
1021192532 7:17638170-17638192 ATTGCTGTGATGTAAGGAAAGGG + Intergenic
1021222289 7:17988354-17988376 CTTCCTGTGCTGAAATGTATGGG - Intergenic
1022219331 7:28297045-28297067 ATTGCTGTGCTGTAAGATAAGGG + Intergenic
1023519446 7:41035830-41035852 GTTCCTGTGAGGTGAGGTGTCGG - Intergenic
1024649695 7:51392620-51392642 ACTGCTGTGAGGTAGGGTATGGG + Intergenic
1025805831 7:64833523-64833545 TTTCCTGTGCAATAAGGTATAGG - Intronic
1026418113 7:70204108-70204130 ATACCAGTGATGTAAGATAGTGG + Intronic
1026502345 7:70953352-70953374 ATTCCTGTGATTCCAGGAATGGG + Intergenic
1032114767 7:129107558-129107580 TTGTGTGTGATGTAAGGTATGGG + Intergenic
1032925124 7:136595456-136595478 ATTCATATTAAGTAAGGTATGGG + Intergenic
1037562482 8:20087396-20087418 AATCCTGTGAGGTAGGGTAGGGG - Intergenic
1039307640 8:36279919-36279941 ATTGCTGTGTTGAATGGTATGGG + Intergenic
1039656766 8:39418250-39418272 ATTTCTGTGATGTGAGGGAGAGG - Intergenic
1040137140 8:43867820-43867842 ATTTCTGTGAAGAAAGGTATTGG - Intergenic
1040366011 8:46716850-46716872 CTTTCTGTGATGTAAGTTCTTGG + Intergenic
1042411908 8:68475817-68475839 CTCCCTGTGATGTGAGGTAGTGG + Intronic
1047187792 8:122649741-122649763 TTTCGTGTGATGTTAGGTGTGGG + Intergenic
1047272759 8:123378028-123378050 ATTCTTCTGAGGTAAGGTAGTGG - Intronic
1047711693 8:127559050-127559072 ATTCATCTGATGAAAGGTGTGGG + Intergenic
1051708179 9:19902392-19902414 ATTCATCTGTTGTAAGGTGTAGG - Intergenic
1053339728 9:37314185-37314207 CTTCCTTTGATGAAAGGTAAGGG - Intronic
1053718412 9:40920383-40920405 ATTTCTGTGATGAAAGTCATTGG - Intergenic
1055221926 9:73945586-73945608 ATTTATGTGCTGTAAGGTGTTGG - Intergenic
1058211535 9:102175445-102175467 ATTTCTGTGAAGTATGTTATTGG + Intergenic
1058411968 9:104743485-104743507 GTTCCTGTAATGTAAGTTATAGG - Intergenic
1059820901 9:117970938-117970960 TTTCCTGTGCTGTAAGGCATTGG - Intergenic
1060437761 9:123609455-123609477 ATTCCTATGAGGTAGGGCATGGG + Exonic
1187621076 X:21055566-21055588 ATTTCTGGGATGTATGATATAGG + Intergenic
1190594225 X:52037039-52037061 ATCCCTGGGATGTAGGTTATTGG - Intergenic
1191163254 X:57358318-57358340 ATTCATGTGATATAAAGTTTTGG - Intronic
1196606292 X:117661181-117661203 AATTCTGTGATGAAAGTTATTGG - Intergenic
1196934531 X:120716436-120716458 ATTTCTGAGATGTAGGTTATGGG - Intergenic
1198675451 X:139126055-139126077 ACTGCTGTCATGTAAAGTATAGG - Intronic
1199341584 X:146684024-146684046 ATTTCTGTGAAGTATGTTATTGG + Intergenic
1202585963 Y:26427539-26427561 GTTTCTGTGCTGTAAGGTTTTGG + Intergenic