ID: 950150203

View in Genome Browser
Species Human (GRCh38)
Location 3:10680880-10680902
Sequence CTCCATGTGGAGGTGGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 1, 2: 6, 3: 75, 4: 430}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950150194_950150203 29 Left 950150194 3:10680828-10680850 CCTGATAGAGTCTGGATGTTGTC 0: 1
1: 0
2: 2
3: 28
4: 147
Right 950150203 3:10680880-10680902 CTCCATGTGGAGGTGGGGCCTGG 0: 1
1: 1
2: 6
3: 75
4: 430
950150197_950150203 2 Left 950150197 3:10680855-10680877 CCGAATCTCATGTTGAAATGGGA 0: 11
1: 763
2: 1956
3: 4087
4: 8212
Right 950150203 3:10680880-10680902 CTCCATGTGGAGGTGGGGCCTGG 0: 1
1: 1
2: 6
3: 75
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950150203 Original CRISPR CTCCATGTGGAGGTGGGGCC TGG Intronic
900307947 1:2019980-2020002 CTCGCTGTGGAGGGTGGGCCCGG + Intronic
900318234 1:2069957-2069979 CGCCCTGTGGAGGAGGTGCCGGG + Intronic
900756960 1:4442667-4442689 CTCCAGGTGGAGGTGGGAGCAGG + Intergenic
901414243 1:9105847-9105869 CTCCATGTGGAGGTGGGGACTGG - Intronic
901868473 1:12123466-12123488 CTGGGGGTGGAGGTGGGGCCTGG + Intronic
902571266 1:17348350-17348372 TGCAAGGTGGAGGTGGGGCCGGG + Intronic
903193196 1:21668163-21668185 CTACCTGTGCAGGGGGGGCCAGG + Intronic
903326344 1:22570951-22570973 ACCCATGAGGAGGTGGGTCCTGG + Intronic
903575089 1:24334738-24334760 CTCCAGGTGGAGGTGGGGAAGGG - Intronic
903773228 1:25777269-25777291 CTCCATGGGCTGGTGGGGCCTGG - Intronic
904314740 1:29652932-29652954 CTACTGTTGGAGGTGGGGCCTGG - Intergenic
904413016 1:30336322-30336344 CCCCATGAGGAGGCAGGGCCTGG - Intergenic
904449245 1:30600499-30600521 CTCCATGTGGGGCTGTGGACGGG - Intergenic
906073669 1:43036032-43036054 CTCCAAGTGGCGTGGGGGCCTGG + Intergenic
906787499 1:48628823-48628845 ATCCATGTGGGGGTGGGGGGTGG - Intronic
907838616 1:58134978-58135000 CTTCATGTGGAGATGAGGTCTGG + Intronic
909724627 1:78819520-78819542 CTCATTGTTGAGGTGGGGCCTGG + Intergenic
910123518 1:83816018-83816040 CTCCATGTACAGCTGGGGCTGGG - Intergenic
911211471 1:95142945-95142967 CTCCATCTGGAGGCGGGGTTGGG + Intronic
912412164 1:109487041-109487063 CTGGAGGTGGGGGTGGGGCCCGG - Exonic
913025344 1:114832780-114832802 ACCCAGGTAGAGGTGGGGCCAGG + Intergenic
913270270 1:117086511-117086533 CTCAATGTGGAGGTGAGGCTGGG + Exonic
914946130 1:152068093-152068115 CTCTCTCTGGAGGTGGGGCCTGG - Intergenic
915194962 1:154182638-154182660 CTCCATGGGGAAGTGGGGGAGGG + Intronic
915300252 1:154947605-154947627 CTCCAGAGGCAGGTGGGGCCTGG - Intronic
918189699 1:182162385-182162407 CAGCATGTGGAGGTAGGCCCAGG + Intergenic
918225089 1:182474082-182474104 TTCCATGTGGAGGTGGCTCTTGG - Exonic
919747785 1:201019554-201019576 CTCCAAGTGGAGGTGAGGCGGGG - Intronic
919806126 1:201381983-201382005 CTCCTTGTGGGTGTGGGGCTTGG - Intronic
920313175 1:205060417-205060439 AAGCATGTGGAAGTGGGGCCAGG + Intronic
920349473 1:205328494-205328516 TTCCAAGTGGAGGCAGGGCCAGG - Intergenic
921405269 1:214772214-214772236 TTCACAGTGGAGGTGGGGCCTGG - Intergenic
921637362 1:217512209-217512231 CTACCTGTGGAGCTGAGGCCAGG + Intronic
922016777 1:221656250-221656272 TGCTAGGTGGAGGTGGGGCCTGG + Intergenic
922247727 1:223817193-223817215 CTGCATGTGGAGGAGGGGGAGGG + Intronic
922452880 1:225750913-225750935 CTCCATGGGCATGTGGAGCCTGG - Intergenic
923321826 1:232841956-232841978 CTCACGTTGGAGGTGGGGCCTGG - Intergenic
923728115 1:236524421-236524443 CTCCACTTGGAGGTGGCGCTCGG - Intronic
923885218 1:238146830-238146852 TTAGGTGTGGAGGTGGGGCCTGG + Intergenic
924004029 1:239587172-239587194 CAGCACGTGGAGGTGAGGCCAGG - Intronic
924463820 1:244282844-244282866 ATGCTTGTGAAGGTGGGGCCTGG - Intergenic
924793245 1:247272441-247272463 CTAAAGTTGGAGGTGGGGCCTGG - Intergenic
924942765 1:248823972-248823994 CTCCATGTGGAAGAGATGCCTGG - Intronic
1063282517 10:4645769-4645791 CTGAATGTGGAGGAGGAGCCAGG - Intergenic
1063624834 10:7679299-7679321 GTCTATGTGGAGGTGGGGCAGGG + Intergenic
1064402838 10:15035607-15035629 CCCCTGCTGGAGGTGGGGCCTGG - Intronic
1065192034 10:23221348-23221370 GTCCATTTGGAGAAGGGGCCTGG - Intronic
1065326169 10:24552459-24552481 GGCCAGGAGGAGGTGGGGCCTGG - Intergenic
1066108927 10:32179484-32179506 CTCCATCTGGAGTAGGGGCTGGG - Intergenic
1066282577 10:33932018-33932040 CTCCATCTGGAGTAGGGGCTGGG + Intergenic
1067076773 10:43191998-43192020 CTTCATCTTGAGGTGGGCCCTGG + Intergenic
1067819783 10:49518564-49518586 CATCAAGTGGAGGTGGGGGCAGG - Intronic
1068434463 10:56973022-56973044 CCCCATTTGGAGGTGGGGCTTGG - Intergenic
1069718892 10:70537895-70537917 CTTCATGAGCAGGTGGGGCCTGG + Exonic
1070597574 10:77843436-77843458 CTCCCTGAGGAGGTAGGGCTAGG - Exonic
1070659612 10:78295125-78295147 CTACCTGTGCTGGTGGGGCCTGG + Intergenic
1071257395 10:83883824-83883846 CTGCTGTTGGAGGTGGGGCCTGG + Intergenic
1071971845 10:90915843-90915865 CTGCATGTGGCGGTGAGGACTGG - Exonic
1072310011 10:94145667-94145689 CACCACCTGGAGGTGGGGCCAGG - Intronic
1072680066 10:97499507-97499529 CTCCTGGTGGGGGTGGGGGCAGG + Intronic
1073125662 10:101147209-101147231 CTCCCTGGGGAGGAGGAGCCAGG - Intergenic
1073331577 10:102673437-102673459 CTTTAAGTGCAGGTGGGGCCTGG - Intergenic
1073643478 10:105276260-105276282 CTTCAGGTGGAAGTGGGGGCAGG - Intergenic
1074290208 10:112132628-112132650 CTAATGGTGGAGGTGGGGCCTGG + Intergenic
1074867585 10:117553861-117553883 CTGCAGGTGGAGGTGGGGGCAGG - Intergenic
1075082062 10:119390957-119390979 CTCCACGTGGTGGAGGGGACAGG - Intronic
1075204155 10:120432238-120432260 CTCCAGGTGGGGCTGGGGCTAGG + Intergenic
1075522388 10:123150780-123150802 CTCCACGTGGAGGGTGGGACCGG + Intergenic
1075832115 10:125420131-125420153 CTGCATGTGGGTGTGGGGACAGG + Intergenic
1075995640 10:126874087-126874109 TTCCAGGAGGAGGTGGGGGCAGG - Intergenic
1076116427 10:127905065-127905087 GCCCAGGTTGAGGTGGGGCCAGG - Intergenic
1076362517 10:129899397-129899419 GTCCATGGTGAGGCGGGGCCTGG - Intronic
1076695174 10:132243925-132243947 CTGCAGGTGGTGGTGGGCCCAGG - Intronic
1077014798 11:394743-394765 CTCCAGGCACAGGTGGGGCCTGG - Intronic
1077113588 11:872893-872915 CTCCAGGAGGAGGTGAGGCTGGG + Intronic
1077252661 11:1567468-1567490 CTCAGTGTGGAGTTGGGGCTGGG - Intronic
1077443028 11:2577550-2577572 CTCCATGTGACGGGGAGGCCTGG + Intronic
1077956344 11:7023951-7023973 CTAACAGTGGAGGTGGGGCCTGG - Intronic
1078268615 11:9773944-9773966 CCCCAACTGGAGGTGGGGCCTGG - Intergenic
1080030576 11:27656508-27656530 GTCTAGGTGGAGGTGGGGCATGG - Exonic
1081854547 11:46295425-46295447 CTCCCTGCGGGGGTGGGGGCGGG + Intronic
1082090009 11:48081439-48081461 CTCCATGTGGGGCTTGGGCTTGG + Intronic
1082634846 11:55583466-55583488 TTCCATGTGGAGCTGCGGCCCGG - Intergenic
1082802122 11:57422752-57422774 CTGAATGTGGAGGTGGTGGCTGG - Intronic
1083661727 11:64254553-64254575 CTGCCCGTGGGGGTGGGGCCCGG + Intronic
1085053731 11:73392513-73392535 CCCCAAGTGGAGCTGGGGCTGGG - Intronic
1086229008 11:84546146-84546168 CTACTGCTGGAGGTGGGGCCTGG + Intronic
1087024018 11:93632102-93632124 CAGCATGTGCAGGTGGGGCCTGG - Intergenic
1087475799 11:98632999-98633021 CTCCATCTGGAGCAGGGGCTTGG + Intergenic
1089459083 11:118642237-118642259 CTCCATCTGGAGGTGGGAATGGG - Exonic
1089628673 11:119769971-119769993 CTTCATGGGGAGGTGGGACCAGG + Intergenic
1090402308 11:126456650-126456672 CTCCCCGTGGACTTGGGGCCTGG + Intronic
1091741581 12:2963543-2963565 GCCCAGGTGGAGGTGGGGGCAGG + Intronic
1093028498 12:14266578-14266600 CTCCATGTGAAGTTTGGTCCTGG + Intergenic
1096109568 12:49020835-49020857 CTCCATCTGGACATGGGGGCAGG - Exonic
1096497644 12:52047642-52047664 CAGCTTGGGGAGGTGGGGCCTGG + Intronic
1096551750 12:52377862-52377884 CTCCAAGAGGACATGGGGCCAGG + Exonic
1096574444 12:52544062-52544084 CTAGATGTGGGGGTGGGGACTGG + Exonic
1096633551 12:52944821-52944843 CTGCCTGTGGAGGTGGGAACGGG - Intronic
1098637213 12:72799108-72799130 CACCATTTGGAGATGGGGACTGG + Intergenic
1099968736 12:89478412-89478434 ATAAATGTGGATGTGGGGCCAGG - Intronic
1100095380 12:91027481-91027503 CCCATTGTGGAGGTAGGGCCTGG + Intergenic
1101227973 12:102708846-102708868 ATCCATGTGAAGGAGGGTCCAGG + Intergenic
1101855249 12:108436988-108437010 GTGCATGGGGAGCTGGGGCCTGG - Intergenic
1102462608 12:113109454-113109476 CTCCATGTGAATCCGGGGCCTGG + Intronic
1103910200 12:124348045-124348067 CTCCATCTGGAGGTAGCGCAGGG - Intronic
1103978221 12:124717722-124717744 CTCCATCTTCAGGTAGGGCCCGG - Intergenic
1104245994 12:127041946-127041968 CCCAGTGTTGAGGTGGGGCCTGG - Intergenic
1104370050 12:128216404-128216426 CCCAGTGTTGAGGTGGGGCCTGG + Intergenic
1104463455 12:128972300-128972322 CTACACGTGGAGCTGGAGCCAGG - Intronic
1104737245 12:131143204-131143226 CTCGCTGTGGAGGAGGGGCCGGG - Intergenic
1104826279 12:131711577-131711599 CACCAGGAGGAGGTGGGGACAGG - Intronic
1105278072 13:18947752-18947774 GTCCATGTGCAGGTGGGTGCAGG - Intergenic
1105327669 13:19384623-19384645 CTCCTGGGGGAGGTGGGGACAGG + Intergenic
1105678860 13:22705334-22705356 CTCCATGAGGAGCTGGGCCGGGG + Intergenic
1105864232 13:24445055-24445077 CTCCTGGGGGAGGTGGGGACAGG - Intronic
1105979464 13:25503536-25503558 CTCCATTTGCACATGGGGCCAGG + Intronic
1106292079 13:28373164-28373186 CACCGTGTGGAGGTGGGGGAGGG + Intronic
1106351250 13:28932620-28932642 CTCCAGGTTGAGGTGGGTTCAGG - Intronic
1107114636 13:36733749-36733771 CTCATGTTGGAGGTGGGGCCTGG + Intergenic
1107179985 13:37447639-37447661 GTGCATGAGGAGGTGGGGCAAGG + Intergenic
1107299909 13:38954910-38954932 CTCCATGTGGTTGTGGGGACAGG - Intergenic
1108521639 13:51251747-51251769 CTCGGTGTGGTGGTGGCGCCAGG - Exonic
1108970055 13:56362843-56362865 TCCTATGTGGAGGTGGGGCATGG - Intergenic
1110868763 13:80425557-80425579 CCCAGTGTTGAGGTGGGGCCTGG - Intergenic
1112874809 13:104024119-104024141 CCCAAATTGGAGGTGGGGCCTGG - Intergenic
1113716411 13:112511536-112511558 ATCCAAGAGGAGCTGGGGCCAGG + Intronic
1113767352 13:112889591-112889613 CTCCATGCGGCGCTGGGGTCAGG + Intergenic
1113908364 13:113830620-113830642 AGCCATGGGGAGGAGGGGCCCGG - Intronic
1113908392 13:113830695-113830717 AGCCATGGGGAGGAGGGGCCCGG - Intronic
1113908419 13:113830771-113830793 AGCCATGGGGAGGAGGGGCCCGG - Intronic
1114598570 14:23935144-23935166 CCCAGTGTGGAGGTGGGGCCTGG - Intergenic
1114680147 14:24477459-24477481 CTCCATGTGGTGGAGGGGAGGGG + Intergenic
1115116222 14:29883250-29883272 CTTAATGCGGAGGTGGGGCCTGG - Intronic
1115433625 14:33348903-33348925 CTCCATTTGGAGTTAGGTCCCGG + Intronic
1118311085 14:64693626-64693648 CTCCATTAGGCTGTGGGGCCCGG + Intergenic
1119031834 14:71198833-71198855 CTACTGCTGGAGGTGGGGCCAGG + Intergenic
1120800462 14:88682752-88682774 CTCCATCTGGAGGAGGGGCTGGG - Intronic
1121322422 14:92999700-92999722 CTCCATTTACAGGTGAGGCCCGG - Intronic
1121454828 14:94031477-94031499 CTAAATTTGGAGGTGGGGCTCGG + Intronic
1121715359 14:96070093-96070115 CTACAAGTGGAGGTGAGGTCTGG - Intronic
1121964153 14:98288883-98288905 CTTCATGCGGAGGTGGGGAGGGG + Intergenic
1122113895 14:99518295-99518317 CTCCATGTGGAGGCGGGAGCCGG - Intronic
1122198733 14:100109029-100109051 CTCGATGCTGAGCTGGGGCCTGG - Intronic
1122650536 14:103223978-103224000 CTGCAGGTGGAGGTGGATCCTGG - Intergenic
1122769914 14:104093309-104093331 CTCCAGGTGGAAGGGGGGCCGGG + Intronic
1123029789 14:105446251-105446273 CTTCATGTGTCGGTGGGGGCAGG + Intronic
1202899535 14_GL000194v1_random:27378-27400 CGCCGTGGAGAGGTGGGGCCTGG - Intergenic
1124870318 15:33534889-33534911 CTCCATTTAGAGGTTGGGCTAGG + Intronic
1125274832 15:37979044-37979066 GATCATGGGGAGGTGGGGCCTGG - Intergenic
1126800887 15:52295631-52295653 CGCCATGGGCAGGAGGGGCCGGG + Exonic
1127262292 15:57335169-57335191 CTCCATGTCAGGGTGAGGCCAGG + Intergenic
1127354222 15:58182653-58182675 ATCCATCTGGATTTGGGGCCTGG + Intronic
1128482870 15:68054690-68054712 CCCCATGGGGAGCTGGGGCTGGG + Intronic
1128566070 15:68700982-68701004 CTCCCTGAGGAGCTGGGGGCGGG + Intronic
1129294899 15:74594825-74594847 CCCCTGGAGGAGGTGGGGCCTGG + Intronic
1129697793 15:77750445-77750467 CTCCATGTGGAGCTGGGGACTGG - Intronic
1130897349 15:88181771-88181793 TGCCACGTGGAGGTGGGGCCTGG - Intronic
1131405822 15:92163630-92163652 CTCCAGGTGGGGGTGGGGGCGGG + Exonic
1131453463 15:92565080-92565102 CTCATGTTGGAGGTGGGGCCTGG - Intergenic
1131733837 15:95311376-95311398 CTCATGTTGGAGGTGGGGCCTGG + Intergenic
1131988515 15:98068625-98068647 CTCCAAGAGGAGGTTGGACCTGG - Intergenic
1132283521 15:100641940-100641962 CTGCAAGTGGTGGTGGGGCCAGG + Intronic
1132594761 16:743659-743681 CTCCGGGTGGAGCTGGGGCGGGG + Intronic
1132615683 16:840225-840247 CTCCCTGTGGAGGGGCAGCCTGG + Intergenic
1132703321 16:1231095-1231117 GTCCATGGGGAGCTGGGGCTGGG - Intergenic
1132703359 16:1231195-1231217 GACCATGGGGAGCTGGGGCCGGG - Intergenic
1132703408 16:1231328-1231350 GACCATGGGGAGCTGGGGCCGGG - Intergenic
1132703461 16:1231461-1231483 GACCATGGGGAGCTGGGGCCGGG - Intergenic
1132708042 16:1254906-1254928 GTCCATGGGGAGCTGGGGCCGGG + Intergenic
1132708126 16:1255136-1255158 GTCCATGGGGAGCTGGGGCTGGG + Intergenic
1132708138 16:1255169-1255191 CTCCATGGGGAGCTGGGGCTGGG + Intergenic
1132737640 16:1394813-1394835 GGCCATGGGGGGGTGGGGCCAGG - Intronic
1132854823 16:2040044-2040066 CTCCCTGTGGGGGTGGGGGCTGG + Exonic
1132906651 16:2285944-2285966 CTCCAGGAGGAGGTGGGGCTCGG - Intronic
1133296416 16:4754826-4754848 CCCAATGTGGAGGTGGGGCCTGG + Intronic
1133873964 16:9715609-9715631 AAACATTTGGAGGTGGGGCCTGG + Intergenic
1134089402 16:11383642-11383664 CACACTGTGGAGGAGGGGCCAGG + Exonic
1135038064 16:19094891-19094913 TTCCATGTGGAGCTGAGGTCGGG + Intergenic
1137057233 16:35751549-35751571 CTCCTTGTGGGGGTGTGCCCTGG + Intergenic
1137677701 16:50311839-50311861 CTCCATCTGGAGATGGGGTGGGG + Intronic
1138073656 16:54019101-54019123 CTACATCTGGATGTGGTGCCTGG - Intronic
1138230974 16:55335954-55335976 CCCAATTTTGAGGTGGGGCCTGG - Intergenic
1138438872 16:57022490-57022512 CTGCAGGAGGAGGTGGGGCTGGG - Intronic
1138553683 16:57760331-57760353 CGCTCTGTGGAGCTGGGGCCTGG - Exonic
1138605879 16:58088398-58088420 GTCCATGTCCAGGTGGGCCCTGG - Intergenic
1139041743 16:63006282-63006304 TCCAATGTGAAGGTGGGGCCTGG - Intergenic
1139431310 16:66912393-66912415 CTCCCTGAGGATGTGGAGCCCGG - Exonic
1140859509 16:79006675-79006697 ATCCAGGTGTAGGTGGGGCTGGG + Intronic
1141395753 16:83702920-83702942 ATGCATGTGGAGGTGGGGCAGGG + Intronic
1141438993 16:84017129-84017151 CTTCCTGGGGAGGTGAGGCCTGG - Exonic
1141625331 16:85258552-85258574 CTCCAGGTGGAGGGGGAGCTGGG + Intergenic
1141776671 16:86127740-86127762 CTCCAAGCAGAGGTGGGGGCTGG + Intergenic
1141789595 16:86225557-86225579 CTCCATATGGTGCTGGGTCCTGG - Intergenic
1142186447 16:88697140-88697162 CGCAAGGTGGAAGTGGGGCCGGG + Exonic
1142200748 16:88760076-88760098 CTGCTTGTGGAGGGTGGGCCAGG - Intronic
1142231094 16:88900643-88900665 CTGCATGTGGAGGTGGTACATGG + Intronic
1142679133 17:1535366-1535388 CTCCCTGTGGAGGAGGGGCATGG - Intronic
1143003483 17:3811065-3811087 CTGCAGGTGGAGGAGGCGCCAGG - Intergenic
1143099469 17:4497569-4497591 CTGCCTGTGGACGTGGGGTCCGG + Intergenic
1143137377 17:4719415-4719437 CACCATGTGAGGGTGGGGCTGGG + Exonic
1143479169 17:7218795-7218817 CTCCTTGTGGAGGGGAGGTCTGG - Intronic
1143831762 17:9657778-9657800 CCACATGTGGAGGGAGGGCCTGG - Intronic
1144773924 17:17774648-17774670 CTGGCTGTGGAGGTGCGGCCGGG - Intronic
1144784423 17:17823812-17823834 CGCCGTGGGGAGGTGGGGCGGGG - Intronic
1145165710 17:20612191-20612213 CTAGTGGTGGAGGTGGGGCCTGG - Intergenic
1145224573 17:21117184-21117206 CTCCAGCAGGCGGTGGGGCCTGG - Intergenic
1145921578 17:28613968-28613990 CCCAATGTGGGGGTGGGGCAGGG - Intronic
1146011334 17:29197111-29197133 CTTCATGTGCAGGTGGGGTTGGG - Intergenic
1146661168 17:34666009-34666031 CCGCAGGAGGAGGTGGGGCCTGG + Intergenic
1147050008 17:37787186-37787208 CTGCATGTGGGTGTGGGGGCTGG + Intergenic
1147463800 17:40594524-40594546 CCAAATTTGGAGGTGGGGCCTGG + Intergenic
1147770819 17:42866784-42866806 CTGGCTGTGGAGGTGTGGCCAGG + Intergenic
1147818649 17:43228575-43228597 CCCCAGGTGGGGGTGGGGACAGG + Intergenic
1147831932 17:43303277-43303299 CCCCAGGTGGGGGTGGGGACAGG + Intergenic
1148071922 17:44913717-44913739 ATCCACGAGGAGGTGAGGCCAGG - Exonic
1148756671 17:49976664-49976686 CTCCCAGTGGAGGAGGTGCCCGG + Intergenic
1148818636 17:50347447-50347469 CTCCAAAAGGAGGTGGGGGCGGG + Intronic
1148912509 17:50950393-50950415 CTCCCTGTCGAGGGGGAGCCTGG + Intergenic
1149347009 17:55749107-55749129 CTGCATGGGGAGGTGGGGAGAGG + Intergenic
1149533202 17:57411998-57412020 CTCCGTCTGGGGGCGGGGCCGGG + Intronic
1151122333 17:71807270-71807292 CTCATGTTGGAGGTGGGGCCTGG - Intergenic
1151477058 17:74350217-74350239 CTCAATGTGGGAGTGGGGTCTGG + Intronic
1151787026 17:76280022-76280044 TGCCATGCGGAGGTGAGGCCTGG - Exonic
1151945592 17:77318286-77318308 GGCCAAGTGGAGATGGGGCCCGG - Intronic
1152378135 17:79929098-79929120 CTCCACTGGGAGCTGGGGCCAGG + Intergenic
1152438317 17:80289292-80289314 GTCAATGTGGAGGCTGGGCCAGG + Intronic
1152636653 17:81432939-81432961 CTCCCTGTGGGGTTGGTGCCTGG + Intronic
1152643714 17:81459453-81459475 ACCCATGAGCAGGTGGGGCCTGG - Intronic
1152862085 17:82702412-82702434 ATCCATCTGGAGGTGGCACCAGG - Intergenic
1153841607 18:9012959-9012981 TCCCCAGTGGAGGTGGGGCCTGG - Intergenic
1154102450 18:11488815-11488837 CTCTCTGTGGAGGTGGGACAGGG - Intergenic
1155465278 18:26127902-26127924 CGTAATTTGGAGGTGGGGCCTGG + Intergenic
1156637530 18:39049318-39049340 AGCCATTTGGAGGTGGGGACAGG + Intergenic
1157331099 18:46704519-46704541 GAGCATGTGGAGGTGGGGCAGGG - Intronic
1157539842 18:48492995-48493017 CACCATGTGGAGGAGAGGCGAGG - Intergenic
1157741039 18:50093519-50093541 CTCCATCTGGAAGAGGGGCTGGG + Intronic
1159616277 18:70583712-70583734 TCTCATGTAGAGGTGGGGCCTGG + Intergenic
1160224569 18:77002129-77002151 CTCCATGTGGAGTTGCCGCCTGG + Intronic
1160463825 18:79059224-79059246 CTCCATATGGCGGTTGGGCCGGG + Intergenic
1160575179 18:79849098-79849120 CTCGATGTGGAGGCGGGGCCTGG - Intergenic
1160870448 19:1275426-1275448 CACCAGGCGGAGGCGGGGCCCGG + Exonic
1160893378 19:1391154-1391176 CTCCATGGGGAGGTGAGTGCAGG + Exonic
1161316252 19:3618978-3619000 CTCCATGTAGACCTGGGGGCAGG + Exonic
1161446115 19:4320198-4320220 TTCCACGTGGAGTTGGGGTCTGG + Intronic
1161703585 19:5807421-5807443 CTCAAGGTGGAGGTGGTGGCCGG + Intergenic
1161727189 19:5936330-5936352 CTGCATGTGGAGATGACGCCAGG - Intronic
1162185496 19:8901611-8901633 CTCCCTGTTGAGGTGGGGTTTGG + Intronic
1162833698 19:13302774-13302796 CTCCACTGGGAGCTGGGGCCGGG + Intronic
1162962407 19:14136037-14136059 CTCTATGGGGAGGTCGGGGCGGG + Intronic
1163038375 19:14584785-14584807 CTGCATGTGGATGTGGGGACAGG - Intronic
1163039070 19:14589046-14589068 CTGCATGTGGATGTGGGGACAGG - Intronic
1164760114 19:30722321-30722343 CTGCATGTGGAGGGAAGGCCTGG + Intergenic
1164857295 19:31534970-31534992 CCGCATGTGGACATGGGGCCTGG - Intergenic
1164960249 19:32422034-32422056 GTTCATGTGGGGGTGAGGCCAGG - Intronic
1164972583 19:32545177-32545199 CTCCATGGGCAGCTGGGTCCAGG + Intergenic
1165062500 19:33211705-33211727 GTCCAGGTGGGGGTGGGGCAGGG - Intronic
1165320322 19:35080839-35080861 CTCCATGTGGACTTGGGCCTGGG - Intergenic
1165328199 19:35126254-35126276 CTCCATGGTGAGGCTGGGCCTGG - Exonic
1165831209 19:38731283-38731305 CTCCCTGAGGAGGTGGGGTGGGG - Exonic
1166369625 19:42293678-42293700 CTACAGCTGGAGCTGGGGCCGGG - Exonic
1166416987 19:42602353-42602375 CTTGATGTGGGGGTGGGGCAGGG - Intronic
1166733308 19:45070648-45070670 CTCCAACTGGAGGTGGGTACAGG - Intronic
1167042089 19:47028323-47028345 CTCCAGGCGGAGGTGGAGGCAGG + Intronic
1167400022 19:49259426-49259448 CTACTGTTGGAGGTGGGGCCTGG + Intergenic
1167583421 19:50359630-50359652 CTCAGTGTGAAGGTGGGCCCAGG - Exonic
1167793066 19:51692569-51692591 TTCCTTGGGGAGGAGGGGCCGGG + Intergenic
1168287556 19:55342149-55342171 CTCCAAGTGGGGGTTGGGGCCGG + Intronic
1168358465 19:55717868-55717890 GTCCCTGTGGAGCTGGGGCGTGG - Intronic
1168703810 19:58456721-58456743 TTCCATTTGCAGGTGGGGACAGG + Exonic
925117910 2:1396127-1396149 TTCCAAGGGGAGATGGGGCCTGG - Intronic
925198271 2:1945345-1945367 CGCCATGTTCAGGTGGGGACTGG + Intronic
925972237 2:9113661-9113683 TGCCCTGAGGAGGTGGGGCCCGG - Intergenic
926111436 2:10186839-10186861 CAATCTGTGGAGGTGGGGCCTGG - Intronic
927684402 2:25160748-25160770 ATCCATTTGGGGGTGGGGGCAGG + Intergenic
932931882 2:76050777-76050799 CCCCAGTTGGAGGTGGGGCCTGG + Intergenic
935433638 2:103004515-103004537 CTGCAGGTGGAGGTGGCCCCAGG - Intergenic
935556920 2:104519992-104520014 CCCAATGTGGAGGTGGAACCAGG + Intergenic
935579784 2:104746517-104746539 CTCCAAGCAGAGGCGGGGCCAGG - Intergenic
937058956 2:118967368-118967390 ATCCATGTGGAGGTGTGACATGG + Intronic
937913317 2:127086848-127086870 CGCCATGTGGGGGTGAGGCCAGG - Intronic
938103117 2:128511894-128511916 CCCACGGTGGAGGTGGGGCCTGG - Intergenic
938108743 2:128550527-128550549 CTCTTAGTGGATGTGGGGCCTGG + Intergenic
939404392 2:141737056-141737078 CTAAATGTGGAAGTCGGGCCAGG + Intronic
942301567 2:174567850-174567872 CTCCATGTGAAGGTGAGGTGTGG - Exonic
944479648 2:200143761-200143783 CCCCATATTGAGGTGGGGACTGG - Intergenic
945617723 2:212094116-212094138 CCCTATGTTGAGGTGGGGCCTGG + Intronic
946310343 2:218879631-218879653 GACCATGTGCAGGTGGGGCCAGG + Intergenic
947472035 2:230409608-230409630 GTGCATGAGGAAGTGGGGCCGGG - Intergenic
947762040 2:232610236-232610258 CTCCTTGTGGAGGTTGGGTGTGG + Intronic
948659594 2:239498859-239498881 CTGCAAAGGGAGGTGGGGCCAGG + Intergenic
948698548 2:239746605-239746627 CCACATGCCGAGGTGGGGCCTGG + Intergenic
948830500 2:240596276-240596298 CTCAGTGTGGAGGAGCGGCCGGG - Intronic
948897910 2:240935735-240935757 CTCCCCGTGGGGGTGGGGGCAGG + Intronic
1168772919 20:427677-427699 CTCCATCTGGGGCTGGGGCTGGG - Intronic
1168813281 20:720122-720144 CTCCAGCTGGAGGTTGGGACTGG + Intergenic
1169066671 20:2697871-2697893 CTCCAGGGGGAGGTCTGGCCTGG - Intronic
1170273263 20:14552312-14552334 CTCTATGTGGGGGTGGGGGTGGG + Intronic
1171092286 20:22296618-22296640 CAACATGTGGGGCTGGGGCCAGG + Intergenic
1171160301 20:22916361-22916383 CATCATGTGGGGGTGGGGCTAGG + Intergenic
1171258276 20:23708564-23708586 CTCCATCTGGAGTAGGGGCTGGG + Intergenic
1171275499 20:23853607-23853629 CTCCATCTGGAGTAGGGGCTGGG + Intergenic
1172093752 20:32450770-32450792 CCCCATGTGTAGGGGGGGCAGGG + Intronic
1172511660 20:35505014-35505036 CTCCATGGGGAGTAAGGGCCAGG + Intronic
1174053822 20:47785166-47785188 CTGCTTGCGGAGGTGGGTCCGGG - Intronic
1174124138 20:48290267-48290289 CTCCCTGTGGATGGGGTGCCTGG + Intergenic
1175745412 20:61453541-61453563 CTCTGTGTGGAGCTGGGTCCAGG + Intronic
1175921182 20:62451266-62451288 CCCCAGGTGGAGGAGGGGCTGGG - Intergenic
1176024500 20:62978831-62978853 GTCCCTGAGGAGGAGGGGCCCGG - Intergenic
1176060729 20:63171608-63171630 CTCCCTGTGTAACTGGGGCCAGG - Intergenic
1176618911 21:9042150-9042172 CGCCGTGGAGAGGTGGGGCCTGG - Intergenic
1176963626 21:15187757-15187779 CCCAGTGTGGAGGTGGGGCCTGG - Intergenic
1177995348 21:28089907-28089929 CATCAGGTGGAGGTGGGGCTAGG + Intergenic
1179427589 21:41294248-41294270 TTCCAGGGGGAGGTGAGGCCTGG - Intergenic
1179652149 21:42818492-42818514 GTCCAGGTGGTGGAGGGGCCAGG + Intergenic
1179988345 21:44933040-44933062 CTCCCTGGGGATGAGGGGCCAGG - Intronic
1180037518 21:45257416-45257438 CTCACTGTGGAGATGAGGCCCGG - Intergenic
1180063689 21:45402463-45402485 CTTCCTGGGCAGGTGGGGCCTGG - Intergenic
1180101734 21:45590751-45590773 CTCGAGGTGGAGGTGGGGGGCGG - Intergenic
1180148904 21:45937697-45937719 TTGCAGGTGCAGGTGGGGCCAGG + Intronic
1181920331 22:26315562-26315584 CCCCTTGTGGACTTGGGGCCAGG + Intronic
1182331783 22:29556056-29556078 CAGCATGTGTGGGTGGGGCCAGG - Intronic
1183037639 22:35152208-35152230 CTCCATGTGTAGGCCGGGCGTGG - Intergenic
1183383279 22:37501249-37501271 CCCCATGTGATCGTGGGGCCTGG + Intronic
1184418155 22:44364040-44364062 CCCCAGGGGGAGGTGGGGTCAGG - Intergenic
1184586945 22:45454352-45454374 CTCTGTGGGGAGGTGGGGACAGG - Intergenic
1185072114 22:48662125-48662147 CTCCAGGTGGACGTGGGGCTGGG + Intronic
1185357262 22:50381209-50381231 CCCCATGCTGAGGTGGAGCCTGG - Intronic
949434415 3:4013054-4013076 CCCCATATGGAGGTGGGGAGGGG + Intronic
950074442 3:10177404-10177426 TTCAGAGTGGAGGTGGGGCCAGG - Intronic
950150203 3:10680880-10680902 CTCCATGTGGAGGTGGGGCCTGG + Intronic
950388441 3:12677772-12677794 CTCCACCTTGGGGTGGGGCCAGG + Intergenic
950705337 3:14776024-14776046 CTCCCTGTGGAGGTGCATCCAGG + Intergenic
952860800 3:37810813-37810835 GTGCATGCGTAGGTGGGGCCAGG - Intronic
953147642 3:40293456-40293478 CTCGAAGTGGAGGTGGGGTGTGG - Intergenic
953152073 3:40333791-40333813 CTCCCTGTGTAGTTGGGGCGGGG - Intergenic
953916915 3:46926216-46926238 CTCCAGGAGGAGGTGGCGCCTGG + Intronic
955419689 3:58724092-58724114 CTCCATGCTGTGGAGGGGCCTGG + Intronic
957434307 3:80153969-80153991 CCTCTTTTGGAGGTGGGGCCTGG + Intergenic
957909841 3:86606976-86606998 CCCAATGTTCAGGTGGGGCCTGG - Intergenic
957914283 3:86666842-86666864 CTGATTTTGGAGGTGGGGCCTGG + Intergenic
958731192 3:97962359-97962381 CTCCATGTGGGGGGGGGGGGGGG - Intronic
959046975 3:101485136-101485158 CATCAGGTGGAGGTGGGGCTAGG - Intronic
959149324 3:102590052-102590074 CCCAATGTGGAGGAGGGGCCTGG + Intergenic
959426879 3:106201252-106201274 CTCGTGTTGGAGGTGGGGCCTGG + Intergenic
962343311 3:134602668-134602690 CTCTCTGTGGAGGTGGGGCAGGG + Intronic
962390241 3:134965748-134965770 CTCAAGGTGGAGGTGGGGGCGGG - Intronic
962852570 3:139318948-139318970 CCACATGTGGATGTGGGCCCGGG + Intronic
962880492 3:139572124-139572146 CTCCAGCTTGAGGTGGGGGCTGG + Intronic
965273098 3:166644456-166644478 CTCCATGTGGATGTTGAGCATGG + Intergenic
967014346 3:185468123-185468145 CTACTGTTGGAGGTGGGGCCTGG - Intronic
967090364 3:186129841-186129863 CTGCATGTGGAAGTGGGGGATGG - Intronic
968089621 3:195892160-195892182 CTCCATGAGGTGCGGGGGCCAGG - Intronic
968128790 3:196179979-196180001 CTCCAGGTGGAGTTGGAGCTGGG - Intergenic
968454295 4:689207-689229 CTGCGGGCGGAGGTGGGGCCGGG + Exonic
968516331 4:1017143-1017165 CTCCAGGAGGACTTGGGGCCTGG + Intronic
968649523 4:1754951-1754973 TTCCTGGGGGAGGTGGGGCCTGG + Intergenic
968950279 4:3687887-3687909 GTCCATCTGGAGGTGGGGCTGGG + Intergenic
969452937 4:7285326-7285348 CAACATGAGGAGATGGGGCCGGG - Intronic
969459633 4:7322170-7322192 GGCCATGTGGGGGTGGGGCTTGG - Intronic
969613582 4:8240068-8240090 CCCCATGTGGAGGAGGTGCCTGG + Intronic
970790596 4:19853805-19853827 CTAATTTTGGAGGTGGGGCCTGG - Intergenic
971933760 4:33119481-33119503 CCCATTGTGGAGTTGGGGCCTGG - Intergenic
972011496 4:34189103-34189125 CTCAATGTTGAAGTGGGGCCTGG + Intergenic
972274049 4:37540777-37540799 CCCCATGTAGAGGTGGGGGTGGG + Intronic
973293286 4:48490547-48490569 CTCCTGGCGCAGGTGGGGCCGGG + Exonic
975538458 4:75477124-75477146 CTCAATGTGGAGGTTGGGCCTGG - Intergenic
976563615 4:86529406-86529428 TTCTAGGTGGAGGTGGGGGCCGG - Intronic
977499402 4:97820896-97820918 CTTATTTTGGAGGTGGGGCCTGG - Intronic
979192988 4:117885978-117886000 GTCCATGTGGAGATGGGGACAGG - Intergenic
979338714 4:119494083-119494105 CTCCATGAGGAGCTGAGGCTTGG - Intergenic
979602974 4:122606514-122606536 CCCCAGCTGGGGGTGGGGCCTGG + Intergenic
980708003 4:136524358-136524380 CACCTTGTGGAGTTGGGGCATGG + Intergenic
981698264 4:147580698-147580720 CTCAATGTTGAGGTGGGGTCTGG - Intergenic
981702124 4:147618255-147618277 CTACAGGTGGAGGTGGGACCGGG + Intronic
983460211 4:168017426-168017448 CCAGTTGTGGAGGTGGGGCCTGG - Intergenic
984144813 4:176047187-176047209 CTCCATGAGGAACTGGGGCATGG + Intergenic
984550503 4:181153633-181153655 CTGCATGTGGAGGTATGGCACGG - Intergenic
986135994 5:4978460-4978482 CTCAAGCTGGAGGTGGGGCCTGG + Intergenic
986153141 5:5146265-5146287 ATCCATGTGGAAGTCGTGCCTGG - Exonic
989499622 5:42150249-42150271 CCACATGTGGAGGAGGGGCCTGG + Intergenic
989623808 5:43410576-43410598 TCCCATGTGAAGGTGGGTCCTGG + Intronic
991637816 5:68723748-68723770 CCCCCAGTGGAGGTGGGGCCTGG - Intergenic
992190647 5:74288158-74288180 CTCCTTGTAGAGGTGGGGCAGGG - Intergenic
993013336 5:82508636-82508658 ATCCATGTGGGAGTGGGACCAGG - Intergenic
993545480 5:89207195-89207217 CTCAGTGTGGAGGTGGGGAGAGG + Intergenic
994321935 5:98404491-98404513 TTCCAGGTGGAGCTGGGGCTGGG + Intergenic
994425308 5:99577346-99577368 GTCAAATTGGAGGTGGGGCCTGG + Intergenic
994436031 5:99734889-99734911 GTCAAATTGGAGGTGGGGCCTGG - Intergenic
996009052 5:118460189-118460211 CCCCACGTGAAGGTGGGCCCTGG + Intergenic
997387839 5:133487688-133487710 CTCCCTGTACAGGTGTGGCCAGG + Intronic
998506881 5:142679358-142679380 TTCCATGAGGAGGTGAGGCTTGG - Intronic
998767327 5:145502375-145502397 CTCGTGTTGGAGGTGGGGCCTGG - Intronic
999285835 5:150393716-150393738 ATCAAAGTGCAGGTGGGGCCAGG + Intronic
999314602 5:150575585-150575607 CTCCAGGTGAAGGTAGGGACCGG + Intergenic
999389658 5:151180863-151180885 CTAATTGTGGATGTGGGGCCTGG - Intergenic
999439448 5:151590279-151590301 CTCAATCTGGAGCTGGCGCCTGG - Intergenic
999720918 5:154398648-154398670 CTCCATGTGGTTGTGGGGATTGG - Intronic
1001120465 5:168975807-168975829 CTCCATTTGGAGGTAGGGATTGG - Intronic
1001335703 5:170795098-170795120 CTCTAAGTGGAGGTGGGGAGGGG + Intronic
1001921965 5:175607828-175607850 TTCCATGTGGAGGCTGGGCACGG + Intergenic
1002185432 5:177452608-177452630 CTCCACCTGGGGGTGGAGCCAGG + Intronic
1003586853 6:7398226-7398248 CTCTATGTGGAGGCTGGGGCAGG + Intronic
1003882393 6:10490440-10490462 CAGCATCTGAAGGTGGGGCCTGG - Intergenic
1004267129 6:14158577-14158599 CCCGATGTTGAGGTGGGGCCTGG + Intergenic
1004506816 6:16253599-16253621 CCCCCAGTGGAGGTGGGGCCTGG - Intronic
1006114819 6:31769951-31769973 CTCCCCCTGGTGGTGGGGCCAGG + Intronic
1006160676 6:32039071-32039093 CTGCAGGAGGAGGTGGGGGCTGG - Intronic
1006180483 6:32150817-32150839 CTGCCTGTGGCGGTGGGGCTGGG + Exonic
1006583264 6:35088707-35088729 CTGCAGGCGGAGGTGAGGCCTGG - Exonic
1007082557 6:39118363-39118385 CCCAGTGTGGAGGTGCGGCCTGG + Intergenic
1007119284 6:39366943-39366965 GTTAATGTGGAGGTGGCGCCAGG + Intronic
1007274446 6:40663057-40663079 GTGGATGTGGAGGTGGGGTCTGG - Intergenic
1008966443 6:57317570-57317592 CGCCAAGGGGAGGTGGGGCAGGG + Intronic
1011610246 6:89143800-89143822 CTTTATGTGGAGCTGGGGGCAGG - Intergenic
1014074126 6:117217090-117217112 CCCCTGTTGGAGGTGGGGCCTGG - Intergenic
1016078474 6:139826723-139826745 ATCCATGTGGAAGTGGACCCAGG + Intergenic
1017038717 6:150290233-150290255 GTTCTTGTGGAGGTGGCGCCTGG + Intergenic
1017348405 6:153411497-153411519 CTCCATCTTGAGGAGGGGCTTGG - Intergenic
1017676873 6:156823224-156823246 CTCAATGAGTAGGTGGGCCCTGG + Intronic
1017712195 6:157180932-157180954 CAGCATGTGGAGGTGGGGCATGG - Intronic
1018138270 6:160800009-160800031 CTCCATCTTGAGGAGGGGCTTGG + Intergenic
1018302295 6:162416284-162416306 CACCAGGTAGAGGTGGGGTCTGG - Intronic
1018416483 6:163606372-163606394 CTCCATATGGTGCTGGGGCCAGG - Intergenic
1018862787 6:167723018-167723040 CAGGAGGTGGAGGTGGGGCCTGG + Intergenic
1019373503 7:676422-676444 CTCGTTGGGGAGATGGGGCCGGG - Intronic
1019464773 7:1181601-1181623 CTCCACGGGGCTGTGGGGCCTGG + Intergenic
1019470512 7:1217943-1217965 CGACCTGTGCAGGTGGGGCCTGG + Intergenic
1019629756 7:2042563-2042585 CCAAAGGTGGAGGTGGGGCCTGG + Intronic
1019780480 7:2936946-2936968 CTCCACGGGGAGGTGGGGACTGG + Intronic
1019924078 7:4180874-4180896 CCCAACGTGCAGGTGGGGCCTGG - Intronic
1020225164 7:6273632-6273654 ATCGATGTGGAGCAGGGGCCAGG - Intergenic
1020973363 7:14976004-14976026 CTGCTGTTGGAGGTGGGGCCTGG - Intergenic
1021949981 7:25765217-25765239 CTTCAGGTGTAGGTGGGTCCAGG - Intergenic
1022249607 7:28594093-28594115 CTCCACTGGGAGGTGGGGGCAGG - Intronic
1022292184 7:29015350-29015372 CCCAATTTGGAGGTGGGGCCTGG + Intronic
1022385576 7:29895849-29895871 CCCAATTTAGAGGTGGGGCCTGG - Intronic
1022795435 7:33727903-33727925 CTCCTTGTGGGGGTGGGGCAGGG + Exonic
1023081970 7:36534327-36534349 GTCCAGCTGGAGGTGGAGCCAGG - Intronic
1024618111 7:51132957-51132979 TCCCAGTTGGAGGTGGGGCCTGG - Intronic
1024704114 7:51938678-51938700 CACCATGTGGATCTGGAGCCTGG + Intergenic
1024838910 7:53560656-53560678 CCACATGTGGAGGGGGGACCTGG + Intergenic
1024948831 7:54837711-54837733 CTCTATGTGAAGGCAGGGCCTGG - Intergenic
1026132803 7:67634401-67634423 CCGAATTTGGAGGTGGGGCCTGG + Intergenic
1026948673 7:74332940-74332962 CTGCCTGTGGAGGTGGGGACTGG - Intronic
1027202706 7:76073419-76073441 CTGCAGGTGGGGGTTGGGCCTGG + Intergenic
1028936957 7:96475675-96475697 CTACATGTGGAGGTGCCTCCAGG + Intergenic
1029269223 7:99366800-99366822 CTCAGTGTTGGGGTGGGGCCTGG - Intronic
1030320952 7:108166841-108166863 CTCCAGCTGGAGATGGGGGCTGG - Intronic
1030848953 7:114458968-114458990 CTTCATCCGGAGGTGGGGCTGGG + Intronic
1032305818 7:130732426-130732448 CTCCATGTAGATGTGTGGCTGGG - Exonic
1033658294 7:143387673-143387695 CTCTGTGTGGGGGTGGGGCTGGG + Intronic
1034213774 7:149387374-149387396 CTTCCTGTGGAGGTGGGGCGTGG - Intergenic
1034481104 7:151320943-151320965 CTCCATGTGCTCTTGGGGCCTGG + Intergenic
1034930589 7:155158623-155158645 TGGCATTTGGAGGTGGGGCCTGG - Intergenic
1035324737 7:158057660-158057682 CCTCATGAGGAAGTGGGGCCTGG - Intronic
1036127440 8:6075859-6075881 CTGCTTGTGGATGTCGGGCCTGG - Intergenic
1036446883 8:8829252-8829274 CTCCAGGTGGGGGTGCAGCCCGG - Intronic
1036653619 8:10661688-10661710 GTCATTGTGGAGGTGGGGGCAGG - Intronic
1038005683 8:23427907-23427929 CTCCCAGACGAGGTGGGGCCAGG + Intronic
1041257582 8:55992472-55992494 CTCCATATGGAGCTGGGGTGAGG - Intronic
1042129573 8:65574166-65574188 CTAATTTTGGAGGTGGGGCCTGG + Intergenic
1042516348 8:69663108-69663130 CTCCAGGTTGAGGTGGGGCTGGG - Intergenic
1043581592 8:81721378-81721400 CTACAGGTGGGGGCGGGGCCTGG + Intronic
1045676008 8:104608390-104608412 CCACATGTGGGGGAGGGGCCTGG + Intronic
1047329350 8:123872236-123872258 CCCAATGTTGAGGTGGGGCCTGG - Intronic
1049203351 8:141352222-141352244 CTCCTTTTTGAGGTGGCGCCTGG + Intergenic
1049371361 8:142269274-142269296 CTCCATGTGTAACTGGGGTCAGG + Intronic
1049441846 8:142613153-142613175 CTCCACCGGGAGGTGGGGGCCGG + Exonic
1049499526 8:142954282-142954304 CTCCAGGTGGGGGTGGCGCAAGG - Intergenic
1049996937 9:1043183-1043205 CTCCACGGGGATGTGGGGGCGGG - Intergenic
1050230770 9:3524737-3524759 CTTCATGTGGAGGTGGGAGGGGG - Intronic
1050351162 9:4741770-4741792 CGCCAGGTGGAGGTGGGGCCAGG - Intronic
1054350744 9:64015630-64015652 CGCCGTGGAGAGGTGGGGCCTGG - Intergenic
1055529069 9:77165368-77165390 CTCCATATAGAGGTGGGCTCAGG - Intergenic
1055905809 9:81292392-81292414 CACCAGGTGGGGGTGGGGCTAGG + Intergenic
1057431199 9:94996004-94996026 CTGCATGTGGAGGTGGAGAGTGG - Intronic
1059160020 9:112025236-112025258 CCCAATGTTGGGGTGGGGCCTGG + Intergenic
1060733652 9:126052804-126052826 CCCCAGGTGGAGATGAGGCCGGG + Intergenic
1062159280 9:135070745-135070767 CTCCATGTAGAGGTGGGTGTGGG - Intergenic
1062216523 9:135392481-135392503 GTCCATGTGCTGGTGAGGCCTGG + Intergenic
1062541155 9:137042113-137042135 TTCCAAATGGAGGTGGGCCCAGG - Intronic
1185593186 X:1291962-1291984 GTCCAGGTGGAGGTGGTGCAGGG - Intronic
1185593210 X:1292087-1292109 GTCCAGGTGGAGGTGGTGCAGGG - Intronic
1185593244 X:1292259-1292281 GTCCAGGTAGAGGTGGGGCAGGG - Intronic
1185593456 X:1293609-1293631 GTCCAGGTGGAGGTGGGGCAGGG - Intronic
1185593476 X:1293696-1293718 GTCCAGGTGGAGATGGGGCAGGG - Intronic
1185593496 X:1293783-1293805 GTCCAGGTGGAGGTGGGGCAGGG - Intronic
1185593517 X:1293869-1293891 GTCCAGGTGGAGGTGGGGCAGGG - Intronic
1185593546 X:1293999-1294021 GTCCAGGTGGAGGTGGGGCAGGG - Intronic
1185593566 X:1294083-1294105 GTCCAGGTAGAGGTGGGGCAGGG - Intronic
1185593578 X:1294126-1294148 GTCCAGGTGGAGATGGGGCAGGG - Intronic
1185593904 X:1295725-1295747 GTCTCTGTGGAGGTGGGGCAGGG - Intronic
1185659925 X:1719573-1719595 GTCCAGGAGGAGGTGGGGCTTGG + Intergenic
1186075132 X:5870241-5870263 GTCCAACTGGAGGAGGGGCCTGG - Intronic
1186322114 X:8439006-8439028 GTCCAATTGGAGGAGGGGCCAGG - Intergenic
1186502962 X:10066661-10066683 ATCCATGTGGAGGTGCATCCAGG + Intronic
1186765586 X:12767638-12767660 CTTCATTTGGAGGCGGGGGCTGG - Intergenic
1186830329 X:13383806-13383828 CCCCATGTTGGGGTGGGGGCTGG - Intergenic
1188045332 X:25419868-25419890 CTGAAGTTGGAGGTGGGGCCAGG + Intergenic
1190756321 X:53405001-53405023 CTGAATCTGCAGGTGGGGCCTGG - Exonic
1191019207 X:55841988-55842010 CTCCATGTGGTGGTTGGTGCTGG + Intergenic
1191121813 X:56914266-56914288 TTATATTTGGAGGTGGGGCCTGG + Intergenic
1194501013 X:94680819-94680841 CCCCATGTGGAGGTGGAGCCTGG + Intergenic
1195936102 X:110127108-110127130 CTCCATATGGAGCAGGGACCAGG + Intronic
1197953706 X:131923927-131923949 CACCAGGTGGGGGTGGGGCTAGG - Intergenic
1198202640 X:134437205-134437227 CTCCATCTGGATATGGGGCTTGG - Intergenic
1198313513 X:135444001-135444023 CCCAATTTGGAGGTGGGGCCTGG - Intergenic
1199373227 X:147075961-147075983 CCCCATCTGCAGGTGGGGCCTGG - Intergenic
1200278844 X:154759750-154759772 GTTCATGTGGAGGTGATGCCTGG - Intergenic
1201226867 Y:11826999-11827021 CTGCATCTGGAGGTGGGTCCTGG + Intergenic
1202068817 Y:20969142-20969164 CCCCATTTGGAAGTGGGGCCTGG - Intergenic
1202195062 Y:22291626-22291648 ATTGATATGGAGGTGGGGCCAGG - Intergenic