ID: 950151328

View in Genome Browser
Species Human (GRCh38)
Location 3:10689749-10689771
Sequence GCTGTACTCCAGCACGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950151323_950151328 8 Left 950151323 3:10689718-10689740 CCTCGTTTGGTTGCCGGGAAACC 0: 1
1: 0
2: 0
3: 2
4: 20
Right 950151328 3:10689749-10689771 GCTGTACTCCAGCACGTGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 115
950151321_950151328 13 Left 950151321 3:10689713-10689735 CCTGGCCTCGTTTGGTTGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 51
Right 950151328 3:10689749-10689771 GCTGTACTCCAGCACGTGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 115
950151317_950151328 23 Left 950151317 3:10689703-10689725 CCAGCATTGCCCTGGCCTCGTTT 0: 1
1: 0
2: 0
3: 39
4: 147
Right 950151328 3:10689749-10689771 GCTGTACTCCAGCACGTGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 115
950151319_950151328 14 Left 950151319 3:10689712-10689734 CCCTGGCCTCGTTTGGTTGCCGG 0: 1
1: 0
2: 0
3: 0
4: 41
Right 950151328 3:10689749-10689771 GCTGTACTCCAGCACGTGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 115
950151324_950151328 -5 Left 950151324 3:10689731-10689753 CCGGGAAACCACTCAGATGCTGT 0: 1
1: 0
2: 2
3: 35
4: 289
Right 950151328 3:10689749-10689771 GCTGTACTCCAGCACGTGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950151328 Original CRISPR GCTGTACTCCAGCACGTGGA GGG Intronic
902175473 1:14646945-14646967 CTTCTGCTCCAGCACGTGGATGG + Intronic
904851975 1:33466447-33466469 ACTGTGCTGCAGAACGTGGAGGG + Intergenic
905945998 1:41901934-41901956 GCTGTACCCCAGCACCTAGGAGG + Intronic
907128309 1:52072308-52072330 CCTGTAATCCAGCACTTGGGAGG - Intronic
907350207 1:53823220-53823242 GCTGTTCTCCAGCCTGGGGATGG - Intronic
912997433 1:114545071-114545093 GCTGTACTTCAACAGGTGAATGG - Intergenic
915365358 1:155312247-155312269 ATTGTACTCCAGGACCTGGAGGG - Exonic
915948437 1:160171255-160171277 GCTGTCCTCCCGAAGGTGGATGG - Exonic
917561823 1:176166381-176166403 CCTGTAATCCAGCACTTGGGAGG - Intronic
917567532 1:176228638-176228660 CCTGTATTCCAGCACTTTGAAGG - Intergenic
923589192 1:235303464-235303486 CCTGTAATCCAGCACTTTGAGGG + Intronic
1064059682 10:12127571-12127593 ACTGTACTCCAGCAAGCGGCGGG - Intergenic
1065912866 10:30324743-30324765 CCTGTAATCCAGCACTTGGGAGG + Intronic
1069728894 10:70598665-70598687 GCTGTCCAGCAGCACGTGCAGGG + Exonic
1071136852 10:82463457-82463479 GCTATACAGCAGCAAGTGGAAGG + Intronic
1073118893 10:101109101-101109123 ACTGCACTCCAGCCTGTGGATGG + Intronic
1073542332 10:104324232-104324254 GCTTTGCTCCAGCAAGTGCAAGG + Intronic
1074864985 10:117539698-117539720 GCTGCACTCCAGCCCCTTGAAGG - Intergenic
1075734897 10:124658589-124658611 GCTGTTCTCCAGGACTTGTATGG - Intronic
1076126636 10:127979162-127979184 GTTGTCCTCCAGCAAGGGGAAGG - Intronic
1078447132 11:11412858-11412880 GCTCTGCCCCAGCATGTGGAAGG + Intronic
1078779672 11:14425257-14425279 CCTGTAATCCAGCACTTGGGAGG + Intergenic
1080448462 11:32358842-32358864 GCTGAACTCCAGCACTTGAAGGG - Intergenic
1085035986 11:73300327-73300349 ACTGTACTCCAGCCTGGGGACGG + Intergenic
1090134977 11:124188120-124188142 GCTTAACTCCAGAACGTAGATGG + Intergenic
1091701780 12:2668168-2668190 GCTGTACGCCAGCATGTGCTGGG - Intronic
1098175388 12:67784908-67784930 ACTGTATTCCAGGAAGTGGAAGG + Intergenic
1098331276 12:69356315-69356337 CCTGTAATCCAGCACCTGGGAGG - Intergenic
1101490748 12:105207109-105207131 TCTGTACTGCAGCGCGTTGAGGG + Exonic
1102294783 12:111727976-111727998 GCAGTACTCCATCACATAGAAGG - Exonic
1104362930 12:128151057-128151079 TCTGAACTCCAGCTGGTGGAAGG - Intergenic
1104698934 12:130886473-130886495 GATGTCCTCCAGCAGGTGAAAGG + Intergenic
1113914389 13:113862189-113862211 GCTGTCCTCCAGGACCTGCAGGG - Intronic
1114168286 14:20244518-20244540 ACTGTACTCCAGCCCATCGACGG - Intergenic
1116467026 14:45245686-45245708 GGGGTACTCCAGCATTTGGAAGG - Intronic
1117723117 14:58646392-58646414 GCCGTTCTCCAGCCCCTGGAGGG - Exonic
1118214196 14:63792933-63792955 CCTGTAATCCAGCACTTGGGAGG - Intergenic
1202853651 14_GL000225v1_random:37000-37022 GCTGGGCTGGAGCACGTGGACGG - Intergenic
1126682006 15:51211281-51211303 GCTTTACCCCAGCACATGAAAGG - Intronic
1127133775 15:55897362-55897384 GAAGTACTCTAGGACGTGGAGGG + Intronic
1128048915 15:64645126-64645148 ACTGTACTCCAGCCTGAGGAAGG - Intronic
1129171250 15:73809586-73809608 TCTGTTCTCCAGCATCTGGAAGG - Intergenic
1132484054 16:181143-181165 GCTTTACTCAAACACGGGGAAGG - Exonic
1137378955 16:47980012-47980034 GCTGTTCTGCAGAATGTGGAAGG - Intergenic
1140214991 16:73000099-73000121 GCTGCTCTCCAACAGGTGGAGGG + Intronic
1141134800 16:81458263-81458285 GCTGAACCCCATCACCTGGAAGG + Intronic
1141532644 16:84657490-84657512 GATGTTCTCCAGCACCTGGCGGG - Exonic
1141846291 16:86611168-86611190 GCTGGACTCCAGCCTGTTGAAGG - Intergenic
1142708720 17:1711795-1711817 GCGGTACTCCACCATCTGGATGG + Intergenic
1143370264 17:6435073-6435095 GCTCTGCTCCTGAACGTGGAAGG - Exonic
1147323494 17:39659453-39659475 GATGTACTCCCGCTCCTGGACGG - Exonic
1150050383 17:61956794-61956816 CCTGTAATCCAGCACTTTGAGGG - Intronic
1153275944 18:3367997-3368019 GCTGTGCTGCAGCAAGTGAAAGG + Intergenic
1158168122 18:54565044-54565066 ACTGCACTCCAGCATGGGGACGG - Intergenic
1158994110 18:62899705-62899727 GCTGCACTCCAGCCTGTAGAAGG - Intronic
1160613260 18:80105602-80105624 GCTGTCCTCCGGGACCTGGATGG - Intergenic
1160688857 19:451156-451178 GCTGTATTTCAGCGTGTGGATGG + Intronic
1160688873 19:451270-451292 GCTGTATTTCAGCATGTGGATGG + Intronic
1161137742 19:2630137-2630159 GCAGTACTCCTGCAAGAGGAAGG + Intronic
1163366162 19:16877197-16877219 GCTGACCTCCAGGACGTTGAGGG - Intronic
1166624908 19:44342730-44342752 GCTGGAATCCAGGAGGTGGAGGG + Intronic
926137507 2:10347114-10347136 GCTGAACTCCAGCACCTGCGGGG - Intronic
928140229 2:28722157-28722179 CCTGTAATCCAGCACTTGGGAGG + Intergenic
929596863 2:43181521-43181543 GCTGTACTCCAGTAGCTGAAGGG + Intergenic
933176769 2:79183007-79183029 GCTGTCCTCAAGCAAGTGAAAGG - Intergenic
933999372 2:87694380-87694402 GTTGTACCCCAGCAGGTGAATGG + Intergenic
934110560 2:88738393-88738415 GCTGTAGTCCAGCTCCTGGAAGG - Intronic
934711663 2:96519241-96519263 TTTGTAATCCAGCACTTGGAAGG + Intergenic
936294480 2:111256511-111256533 GTTGTACCCCAGCAGGTGAATGG - Intergenic
937988915 2:127651502-127651524 GCGGTAGTGCAGCACGTAGACGG - Exonic
938458356 2:131481689-131481711 CCTGTAATCCAGCACTTGGGAGG - Intronic
945291118 2:208128338-208128360 GCAGCCCTCCAGCACGTGGAGGG + Exonic
945292827 2:208142773-208142795 GCTGCCCTCCAGCACATTGAGGG + Exonic
945294928 2:208160939-208160961 GCAGCCCTCCAGTACGTGGAGGG + Exonic
947925196 2:233915015-233915037 GCTGTACTGGAGCTGGTGGAAGG - Intergenic
948686717 2:239674882-239674904 GCTCTGTTCTAGCACGTGGAGGG + Intergenic
1168750706 20:279220-279242 GCTGTTCTCCATCTCCTGGATGG + Exonic
1171325767 20:24291140-24291162 GCTGTACTCCAGCATGGTGCTGG + Intergenic
1172838630 20:37888660-37888682 GCTGGACTCCAGCTCAGGGATGG - Intergenic
1174251591 20:49223913-49223935 ACTGCACTCCAGCCTGTGGATGG - Intronic
1178424677 21:32469831-32469853 GATGAACTCCACCACGTGGATGG - Intronic
1181067330 22:20313098-20313120 GCTGTTCTCCAGGGCGTGGCAGG - Intergenic
1183448245 22:37874487-37874509 GATGTTCTCCAGCACCTTGATGG - Exonic
1183840446 22:40495809-40495831 CCTGTAATCCAGCACTTGGGAGG + Intronic
1184946218 22:47805861-47805883 GCTCAACTCTAGCACATGGAGGG - Intergenic
950151328 3:10689749-10689771 GCTGTACTCCAGCACGTGGAGGG + Intronic
951216921 3:20033716-20033738 CCTGTAATCCAGCACTTTGAGGG - Intergenic
963899165 3:150717470-150717492 CCTGTAATCCAGCACATTGAAGG - Intergenic
970687980 4:18590048-18590070 GCTATCCTCCAGCAAGAGGAAGG - Intergenic
972716031 4:41646925-41646947 GCTGAACTCCAGGGAGTGGATGG + Intronic
974059750 4:57021086-57021108 GCCGCACTCCAGAAAGTGGAAGG + Intronic
983546275 4:168967692-168967714 TCTGTACTGGAGCAGGTGGATGG + Intronic
996544323 5:124661584-124661606 GCTCTCCTCCAGCACAGGGAAGG + Intronic
997232948 5:132257340-132257362 GCGGTGCTCCAGCCCGAGGAGGG - Intronic
998333741 5:141352062-141352084 GCTGGCCTGCAGCACGTGGTAGG - Exonic
998334814 5:141361949-141361971 GCTGGCCTGCAGCACGTGGTAGG - Exonic
998343731 5:141441932-141441954 GCTGGCCTGCAGCACGTGGTAGG - Intronic
1000243909 5:159433275-159433297 GCTGTATCCCAGCACCTGCATGG - Intergenic
1004291382 6:14370474-14370496 ACTGCACTCCAGCTGGTGGATGG + Intergenic
1004420083 6:15461428-15461450 GCTGTAATCCAGGAGGAGGAGGG + Intronic
1004878056 6:19976177-19976199 GCTGTACGCCAGTATGTGTACGG + Intergenic
1011880661 6:92020603-92020625 GATGTTCTTCAGCAAGTGGAAGG - Intergenic
1012340217 6:98111943-98111965 GATGTAATCCAGCAGGTGAATGG + Intergenic
1012639089 6:101586609-101586631 CCTGTAATCCAGCACTTTGAGGG + Intronic
1014248592 6:119093710-119093732 GCTGTCCTCCAGCAAGAGGCAGG + Intronic
1017819287 6:158038113-158038135 GCTGTACCCCAGGAGCTGGAAGG - Intronic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1019652975 7:2170627-2170649 TCTTCACTCCAGCACTTGGAGGG - Intronic
1020003801 7:4771095-4771117 GCTGCACCCCAGCACCGGGAGGG + Exonic
1020013186 7:4817316-4817338 GCTGTTCTCCTGCACGCTGACGG - Exonic
1020437108 7:8176259-8176281 GCAGTACAGAAGCACGTGGATGG - Intronic
1023994597 7:45151553-45151575 CCTGTACTCCAGCAGGAGGGCGG + Intergenic
1027735312 7:81925273-81925295 GCTGAACTCTAGCACGGGGACGG - Intergenic
1031011042 7:116525685-116525707 GCAGAGCTCCAGCGCGTGGAGGG - Intronic
1037981624 8:23258461-23258483 CCTCTACTCCAGCACTTGGCTGG + Intronic
1040905967 8:52470059-52470081 GCCTTCCTCCAGCACCTGGAAGG + Intergenic
1048486008 8:134848095-134848117 CCTGCACTCCAGCCTGTGGATGG - Intergenic
1055463463 9:76541167-76541189 GCTATACTCCGGGAAGTGGAGGG - Intergenic
1057176705 9:93005381-93005403 CCTGTAATCCAGCACTTGGGAGG - Intronic
1057962159 9:99467270-99467292 GCTGTACTCCATCACCTGAATGG - Intergenic
1059499949 9:114743682-114743704 ACTGCACTCCAGCTCCTGGAGGG + Intergenic
1189732763 X:44038887-44038909 GCTGTAGTTCAGCAGGTGAAAGG + Intergenic
1199817902 X:151415672-151415694 GATGTACTTCAGCAGGTGAATGG - Intergenic