ID: 950152583

View in Genome Browser
Species Human (GRCh38)
Location 3:10699040-10699062
Sequence CTGGAAGGCCGGAGGGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 252}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950152583 Original CRISPR CTGGAAGGCCGGAGGGAACC AGG (reversed) Intronic
900187203 1:1338029-1338051 CTGGTAGGCAGGCGGGAAGCAGG + Exonic
900657668 1:3767740-3767762 CTGGAAAGGAGGAGGGCACCTGG + Intronic
901195135 1:7436179-7436201 CTGGGAGGCGAGAGGGAGCCGGG + Intronic
901919823 1:12528069-12528091 CTGGATGACAGGAGGGAGCCAGG + Intergenic
904393261 1:30199505-30199527 CTGGAAGCCTGGGAGGAACCAGG + Intergenic
904449472 1:30601716-30601738 CTGAATGGCCTGTGGGAACCAGG + Intergenic
906234923 1:44200501-44200523 CTGGAAGGCTTGAGGGAAGCGGG - Intergenic
906517909 1:46450454-46450476 CTGGAAGGGCTGAGGGAACAGGG - Intergenic
906577049 1:46900456-46900478 CTGGAAAGCCTGAGAGAACTGGG + Intergenic
910993541 1:93079813-93079835 TTGGAGGGCAGGAAGGAACCTGG + Intronic
912519007 1:110232707-110232729 CTGGAAGGCATGAGGAACCCAGG - Exonic
914516530 1:148379263-148379285 CTGAAAGGCCGGTGGGCTCCCGG + Intergenic
914831539 1:151174299-151174321 CTGGAAGGTGAGAGGGAAACTGG + Intronic
915273878 1:154774883-154774905 CTGCAAGGCCGGAAGAAACTAGG + Intronic
918052959 1:180990664-180990686 CTGGAAAGCCTGAAGGACCCTGG - Intronic
918078713 1:181189987-181190009 CTGGAGGCCCAGAGGGCACCCGG - Intergenic
919866745 1:201788445-201788467 CTGGAAGGACAGAGGGAAGGGGG - Intronic
920030606 1:203035320-203035342 CTGGTAGGCAGGAGGGAGCCAGG + Intronic
920112761 1:203598737-203598759 CTTGAAGGCAGGAAGGAACTTGG - Intergenic
920491650 1:206420303-206420325 CTTGATGACTGGAGGGAACCAGG + Intronic
920684934 1:208102171-208102193 CTGGAGGGAGGGAGGGAAGCTGG - Intronic
920931702 1:210394749-210394771 CTGGAAGGCTGCAGGGAGCAGGG + Intronic
921725542 1:218519485-218519507 GAGGAAGGCCAGAGGGAGCCTGG + Intergenic
922755924 1:228096956-228096978 CTGGAAGCCTGCAGGGAAACAGG - Intronic
923191075 1:231621375-231621397 CTGGAAAGCCAGAAGGACCCTGG - Intronic
924828021 1:247562377-247562399 CTGGGAAGCAGGAGGAAACCTGG - Intronic
1065045000 10:21739231-21739253 CGGGAAGGGTGGAGGGAGCCAGG - Intronic
1067039225 10:42940155-42940177 CTGAAAGGCCGCAGAGCACCGGG - Intergenic
1069904043 10:71721956-71721978 TTGGAAGGATGGAGGAAACCTGG - Intronic
1070594403 10:77821908-77821930 CTGGAAGACAGGAAGGAGCCAGG - Exonic
1071246849 10:83774094-83774116 CTTGAAGGCAGGAGAGAAGCTGG - Intergenic
1072465074 10:95656107-95656129 CTGGAGGGCCGCGGGGAACTAGG + Intronic
1074930135 10:118116657-118116679 TTGGGAGGCAGGAGGGAACCAGG + Intergenic
1076840690 10:133043806-133043828 CTGGAAGACCTGAGGGAGTCTGG + Intergenic
1077554853 11:3220962-3220984 CTGGCTGGACGGAGGGCACCCGG + Intergenic
1080572684 11:33570350-33570372 CTGGAAAGTCTGAGGGAAGCGGG + Intronic
1080686764 11:34522446-34522468 CAGGAAGGGCAGAGGCAACCAGG + Intergenic
1083578986 11:63813275-63813297 CGGGAAGGGCCGAGGGGACCCGG - Intergenic
1083601656 11:63952428-63952450 CTGGAAGGACCGAGAGAAACGGG + Exonic
1083631146 11:64096130-64096152 CTGGAGGCCAGGAGGGGACCAGG + Intronic
1085203008 11:74713076-74713098 CTGGAAGGCCCAAGGGAGACTGG + Intronic
1085690481 11:78660079-78660101 CTGGAGTGCAGGAGGGAGCCTGG + Intronic
1089560324 11:119340292-119340314 CTGGAAGGCCGGGGTGCCCCGGG + Exonic
1089644889 11:119872402-119872424 CTGGAGGGCAGGAAGGAGCCAGG - Intergenic
1089974688 11:122722311-122722333 CTGGAGTGCAGGAGAGAACCAGG - Intronic
1090561273 11:127935451-127935473 CTGGCAGGCAGGAGGGAGGCTGG - Intergenic
1091305013 11:134531278-134531300 CTGGAAGGGAGGAGGGATGCAGG - Intergenic
1091725694 12:2845216-2845238 CTGGAGGGTCGCAGGGAAGCTGG + Intronic
1092002923 12:5045836-5045858 CTGCAAGGCTGGGGGGACCCTGG + Exonic
1092259614 12:6946051-6946073 CTGGAAAGGCAGAGGGAATCAGG - Intergenic
1092546365 12:9455263-9455285 CTGGAGGGGCGGAGAGAAACAGG + Intergenic
1094506576 12:31066811-31066833 CTGGAGGGGCGGAGAGAAACAGG - Intergenic
1101084984 12:101226628-101226650 CTGTAAGGCTGGAGGAAACCAGG - Intergenic
1103008316 12:117439131-117439153 CTGGCAGGTTGGAGGGACCCAGG + Intronic
1105944272 13:25176323-25176345 CTGGAAGCCTGGGGGGAACATGG - Intergenic
1107260993 13:38490999-38491021 GTGGGAGGCTGGTGGGAACCAGG - Intergenic
1108181140 13:47841149-47841171 CTGGAAATCCGGAGGCACCCTGG + Intergenic
1108412213 13:50161240-50161262 CTGGAAGGCCTAACGGAATCTGG - Intronic
1112128006 13:96491323-96491345 GTGGCAGGTCGGAGGGAATCAGG + Intronic
1115731065 14:36270590-36270612 CTGGAGGCCCTGAGGGATCCAGG + Intergenic
1117073652 14:52079039-52079061 CTGGAAGGCGGGAGGAAGACTGG - Intergenic
1117498642 14:56330639-56330661 CTGGATGGGCTGAGGGAGCCTGG - Intergenic
1121098503 14:91234004-91234026 CTGGAAGGCCGGGTGGAGCTTGG + Exonic
1121312903 14:92944749-92944771 CTGGCAGGTATGAGGGAACCAGG - Intronic
1121866230 14:97365227-97365249 ATGGAAGGCTGGAGGGCACTAGG - Intergenic
1122761652 14:104033226-104033248 TTGGAAGGCCCTAGGGGACCTGG - Intronic
1122816611 14:104317111-104317133 CAGGATGGCGGGAGGGAAGCAGG - Intergenic
1122860420 14:104579982-104580004 CGGGGAGCCAGGAGGGAACCAGG + Exonic
1125743700 15:41984906-41984928 CTGGAAGGGCGACTGGAACCAGG + Intronic
1128084764 15:64878103-64878125 CTGGAGGGCCAGAGGGACCCCGG + Intronic
1129323218 15:74786329-74786351 CTGGGAGGCAGGAGGCAGCCAGG - Intronic
1132152992 15:99475521-99475543 CAGGGAGGCAGGAGGGACCCAGG - Intergenic
1132682864 16:1150777-1150799 GTGGCAGGCCGGAGGGAGCCGGG - Intergenic
1133021579 16:2969266-2969288 CTGGCCGGCCGGCGGGAACTAGG + Exonic
1134230342 16:12424021-12424043 CTGGTTGGCCAGAGGGAATCAGG + Intronic
1134301350 16:12994176-12994198 TTGGAAGGGCTGAGGGAGCCAGG + Intronic
1134430402 16:14199212-14199234 CTAAAAAGGCGGAGGGAACCAGG - Intronic
1137044039 16:35639752-35639774 GGGTAAGGCAGGAGGGAACCAGG - Intergenic
1137495433 16:48965672-48965694 AATGAAGGCTGGAGGGAACCAGG + Intergenic
1138072154 16:54003156-54003178 CTGGATGGCAGGAGGGACTCTGG + Intronic
1141177960 16:81733079-81733101 CTGGAGGACAGGAGTGAACCCGG + Intergenic
1141186757 16:81793151-81793173 CTGGAAAGCAATAGGGAACCTGG - Intronic
1141635486 16:85311908-85311930 CTGGGCCGGCGGAGGGAACCCGG - Intergenic
1141725069 16:85782582-85782604 ATGGAAGGGAGGAGGGAAGCTGG - Intronic
1142031774 16:87842136-87842158 CAGGTAGGCAGGAGGGGACCCGG - Intronic
1142262002 16:89047425-89047447 CTGGATGGCAGGAAGGAAGCAGG - Intergenic
1143875622 17:9988478-9988500 CTGGTGCGCAGGAGGGAACCAGG - Intronic
1145122171 17:20269766-20269788 CAGGAAGTCCCGAGGAAACCAGG - Intronic
1147245705 17:39119075-39119097 CTGGAAAGCTGTTGGGAACCAGG - Intronic
1148105721 17:45117904-45117926 CTGGAAGGACGGAGGGCAGCTGG + Intronic
1148784051 17:50136674-50136696 CTGGAAGCTGGGAGAGAACCAGG - Intronic
1150280538 17:63927655-63927677 CTGGGCTGCTGGAGGGAACCAGG - Intergenic
1150280581 17:63927785-63927807 CTGGAATTCCAGAGGGAATCTGG + Intergenic
1150645730 17:66976456-66976478 CTGGAAGGAGGGAGGGAAGTTGG - Intronic
1151305378 17:73259778-73259800 CTGGGGGGCTGGAGGGGACCAGG - Intronic
1151343081 17:73484357-73484379 CTGGGAGGCTGGAGTGAGCCCGG - Intronic
1151379032 17:73712150-73712172 CTGGAAGGCTGGCGGGAGCCAGG - Intergenic
1152147361 17:78576525-78576547 CTGAAAGCCCTGTGGGAACCTGG - Intronic
1152584183 17:81181780-81181802 CTGCAAGGCCAGCGGGGACCCGG - Intergenic
1152618054 17:81346719-81346741 CGGGAAGGAAGGAGGGTACCTGG + Intergenic
1152759633 17:82101172-82101194 CTGGAAGCCAGGTGGGCACCTGG - Intergenic
1152906537 17:82973624-82973646 CTGGGACACAGGAGGGAACCTGG + Intronic
1153631299 18:7072865-7072887 CTGGAGGGCTGGAGGGAGGCAGG + Intronic
1154060666 18:11056641-11056663 CAGGAAGGCTGCAGGGAGCCAGG + Intronic
1156351619 18:36306918-36306940 CTCCAAGGCCGGAGGGCAACTGG - Intronic
1156594064 18:38525755-38525777 ATGGAAGGCTAGAGGGAACTGGG - Intergenic
1156851763 18:41736938-41736960 TTGGAAGGCAGGAGGGAAGGAGG + Intergenic
1157557345 18:48621545-48621567 CAGTGAGGCAGGAGGGAACCAGG + Intronic
1157718553 18:49906177-49906199 CTGGTAGGATGGAGGGAGCCTGG + Intronic
1160343529 18:78110423-78110445 CAGGAGGGTCGGAGGGAACCGGG - Intergenic
1161210611 19:3063299-3063321 CAGGAAGGCCGGAGGGAGGCAGG + Intergenic
1161322072 19:3645935-3645957 CCGCAAGGCGGGAGGGACCCTGG - Intronic
1161668358 19:5590409-5590431 CTGGAAGGCAGGAGAGGAACAGG + Intronic
1162109095 19:8390586-8390608 CGGGAAGGCCGGAGCCGACCGGG + Intronic
1162320546 19:9968710-9968732 CTGGGAGGCCAGAGGGCCCCTGG + Exonic
1162535049 19:11258303-11258325 CTGGCATGCGGGAGGGAGCCAGG + Intronic
1162909809 19:13842749-13842771 GTGGAAGTCAGGAGGGACCCAGG - Intergenic
1163578882 19:18126358-18126380 CTGGAGGGCAGGAGGTGACCAGG + Intronic
1163588677 19:18177936-18177958 ATGGAAGGCGAGTGGGAACCCGG + Exonic
1164130129 19:22354545-22354567 GTGGAAGGACAGAGGGACCCAGG - Intergenic
1164222053 19:23203827-23203849 CGGGAAGGACAGAGGGACCCAGG - Intergenic
1165156935 19:33794940-33794962 CTGGAAGCCCGGAGGTACCGGGG + Intergenic
1165263088 19:34637265-34637287 CTGCAAGGCCTTAGGGCACCAGG + Intronic
1166332666 19:42088007-42088029 CTGGGGGGCTGGAGGGAGCCAGG - Intronic
1166560614 19:43730121-43730143 CTTGAAAGCAGGAGGAAACCAGG + Exonic
1168250854 19:55141150-55141172 GAGGAAGACCGGGGGGAACCCGG + Intronic
925170835 2:1749467-1749489 CTGGGAAGACGGTGGGAACCAGG - Intergenic
925211862 2:2056257-2056279 CTGGAGAGCCTGAGGGACCCAGG - Intronic
925346356 2:3174785-3174807 CAGGAAGTCAGGAGCGAACCAGG + Intergenic
925375123 2:3378674-3378696 CTGGAAGCCCCGGTGGAACCAGG - Intergenic
927920870 2:26970969-26970991 CGCCAAGGCCGGAGGGAACCCGG - Intronic
929580464 2:43078957-43078979 CTGGAATGACGGAGGGCACTGGG + Intergenic
932077599 2:68679642-68679664 CTGCAAGGCCGCAGAGAAGCTGG - Intronic
932306583 2:70707926-70707948 GAGCAAGGCCGGAGGGAGCCAGG - Intronic
932770139 2:74496575-74496597 CTGGAAGGCAGAAGGGAATCTGG - Intergenic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
935571135 2:104661128-104661150 CTGGGAGGGTGGAGGGAATCAGG - Intergenic
937251200 2:120524894-120524916 CTGTGAGGTCAGAGGGAACCAGG - Intergenic
938108609 2:128549850-128549872 CTGGCAGGCAGGAGGGACCATGG - Intergenic
938236157 2:129708712-129708734 CTGGGAGCCTGGAGGGGACCAGG + Intergenic
939629126 2:144513646-144513668 GTGGGAGGCAGGAGGGAAGCAGG + Intronic
946311279 2:218883755-218883777 CTGGACGGCTGGAGGGGCCCGGG - Intronic
948397960 2:237661465-237661487 CTGGAAGGAAGGAGGGAGTCTGG - Intronic
948618182 2:239215022-239215044 CTGGAAGGCAGGTGAGATCCAGG + Intronic
1169020588 20:2328042-2328064 CTGGAAGGCCCTGGGGAATCGGG + Intronic
1169077492 20:2770190-2770212 ATGGAAGGCCACAGGGAAGCAGG - Intergenic
1170921165 20:20681072-20681094 CTAGAAGGCTGGAGGTAAGCAGG + Intronic
1170926352 20:20727944-20727966 CTGGAAGGACAGAGGGAAGAGGG + Intergenic
1172951031 20:38723775-38723797 CTGGACGGGCGGAGAGAACCCGG + Intergenic
1175444910 20:59013310-59013332 CTGGAAAGCCAGTGGCAACCGGG - Intergenic
1175847572 20:62066410-62066432 CTGGGAGGCGGGCGGGAACGGGG + Intergenic
1176056528 20:63151834-63151856 CTGGAGAGCCAGAGGGAGCCGGG + Intergenic
1176286855 21:5022974-5022996 CTGGAAGGAGGGAGGGAAGGCGG + Intronic
1176329553 21:5536211-5536233 CTGGAAGAACCCAGGGAACCTGG - Intergenic
1176398204 21:6284740-6284762 CTGGAAGAACCCAGGGAACCTGG + Intergenic
1176414678 21:6467698-6467720 CGGGCAGGCCGGAGGGTCCCAGG - Intergenic
1176438953 21:6704364-6704386 CTGGAAGAACCCAGGGAACCTGG - Intergenic
1176463215 21:7031433-7031455 CTGGAAGAACCCAGGGAACCTGG - Intergenic
1176486776 21:7413212-7413234 CTGGAAGAACCCAGGGAACCTGG - Intergenic
1178488517 21:33033454-33033476 CTGAAAGGCCTGCAGGAACCAGG + Intergenic
1179296267 21:40065650-40065672 CTGGAAGGCAGGAGAGTACTGGG - Intronic
1179690178 21:43076020-43076042 CGGGCAGGCCGGAGGGTCCCAGG - Intronic
1179870326 21:44240501-44240523 CTGGAAGGAGGGAGGGAAGGCGG - Intronic
1180082956 21:45494905-45494927 CTGGACGGCCGGTGAGGACCTGG + Exonic
1181266413 22:21633440-21633462 CTGGAAGTCAGGAGGAAACAAGG - Intronic
1181856571 22:25785405-25785427 CTGGAAGCACAGAAGGAACCAGG - Intronic
1182304805 22:29360481-29360503 CTGGAGGGTCGCAGGGAAGCAGG + Intronic
1182312119 22:29416619-29416641 CTGGAGGGTCGCAGGGAAGCAGG + Intronic
1183386814 22:37519580-37519602 CTGGAGAGCCGGCGGGAAACAGG - Intergenic
1183714832 22:39527544-39527566 CTGGAAGGCAGCAGGGAGCTGGG - Intergenic
1184724481 22:46335625-46335647 GGGGAAGGCCGGACGGAACGCGG + Exonic
950152583 3:10699040-10699062 CTGGAAGGCCGGAGGGAACCAGG - Intronic
950513940 3:13451738-13451760 CTGTAAGGCAGGAGGCAGCCGGG + Intergenic
950579638 3:13853885-13853907 CTTCAAGGCAGGAGGGAGCCTGG + Intronic
951317967 3:21209458-21209480 CTGGAAGGTGGAAGGGGACCTGG - Intergenic
952175609 3:30859224-30859246 CTGGGAGGCTGGGGGGAAGCAGG + Intronic
952268083 3:31806205-31806227 CTGGGAGGGCTGAGGGAACAAGG - Intronic
952437491 3:33286752-33286774 CTGCAAGGCAGGAGAGAAGCTGG - Intronic
953030049 3:39173724-39173746 GTGGAAGGAAGGAGGGAATCAGG - Intergenic
953659564 3:44882273-44882295 CTGGGAGGCTGGAGGAATCCTGG - Intronic
954987724 3:54810263-54810285 TTGGAGGGCTGGAGTGAACCTGG + Intronic
957085151 3:75670779-75670801 ATGGATGGACGGAGGGACCCTGG + Intergenic
957572158 3:81960923-81960945 CTAGAAGCTCGGAGGGAAGCAGG - Intergenic
959922539 3:111884576-111884598 CTGGAAGGTCGGAAGGCATCTGG + Exonic
961382735 3:126506186-126506208 CTGGAAGGCGAGAGGGGACAAGG - Intronic
961575536 3:127833066-127833088 CTGGAAGGCCACACAGAACCTGG - Intergenic
961821674 3:129578513-129578535 CAGGAAGGCAGGACTGAACCAGG - Intronic
962587458 3:136856796-136856818 CTGGAAGGCAGAAGGGAAGAAGG + Intergenic
968075606 3:195814522-195814544 CTGGAAAGCAGAAGGGAAACGGG - Intergenic
968914649 4:3492156-3492178 CTGGCAGGCGGGAGGCAGCCTGG + Intronic
969117653 4:4881958-4881980 CTTGAGGGGCAGAGGGAACCTGG - Intergenic
969347484 4:6578521-6578543 CTGGAGGTCCTGAGGGACCCTGG - Intronic
969630470 4:8332978-8333000 CTGGAAGGCCCCAGGCTACCTGG + Intergenic
976794256 4:88914475-88914497 CTGGAAGGCAGGAAGGGACTTGG - Intronic
982108088 4:152028768-152028790 CTGGAAGGCTGGTGGGAAGAAGG + Intergenic
982636434 4:157902938-157902960 ATGGAAGGAAGGAGGGAAGCAGG - Intergenic
985445792 4:190020787-190020809 ATGGATGGACGGAGGGACCCTGG - Intergenic
985629178 5:1005861-1005883 CTGGAATGGCTGAGGGGACCAGG + Intergenic
992199174 5:74367366-74367388 CTGGGATACAGGAGGGAACCGGG + Intergenic
995381824 5:111543815-111543837 CAGGAAGGAAGGAGGGAACAAGG - Intergenic
997293852 5:132757397-132757419 CAGGAAGGCAGGAGGAAGCCAGG + Intronic
997630042 5:135360407-135360429 CTGGAAGGCTGGGGGGATCCCGG - Intronic
998134650 5:139668346-139668368 CTGGGAGGCGGCAGGGAGCCGGG - Intronic
998849639 5:146340591-146340613 AGAGAAGGCCGGAGGCAACCAGG - Intergenic
1001083805 5:168685928-168685950 CTGGAAGGCAGGAGAGAATGGGG + Intronic
1001633458 5:173193454-173193476 CTGGAATGCAGGCTGGAACCAGG + Intergenic
1003224122 6:4189389-4189411 CTGGAAGGACAGAGAGAAACGGG + Intergenic
1006143763 6:31946195-31946217 TTGGAAGGCAGGAGAGAAGCTGG - Exonic
1006611290 6:35295986-35296008 CTGAAAGGATGGAGGGACCCAGG - Intergenic
1007322809 6:41039426-41039448 CTGGAAGGAAGGAGGGAGGCAGG + Intronic
1007667641 6:43524846-43524868 CTGGAAGGCCAGATGGACCAGGG + Exonic
1007745780 6:44042289-44042311 CTTGAAGTTCAGAGGGAACCTGG - Intergenic
1008961839 6:57274342-57274364 CTGCAAGGCCGCAGGGAGGCTGG - Intergenic
1010461680 6:76120769-76120791 CTGGAAAGCAAGAGGGAATCTGG + Intergenic
1013304691 6:108837542-108837564 CAGGAAGGCAGGAAGGAACAAGG + Intergenic
1013330287 6:109094498-109094520 TGGGAACGCCGGAGAGAACCCGG - Exonic
1018565659 6:165148987-165149009 CTGGAAGGCTGGAGGTAAGTTGG - Intergenic
1018998063 6:168725160-168725182 GTGGAAAGCAGCAGGGAACCAGG - Intergenic
1019174706 6:170154190-170154212 CTGGAAGGCCTGTGTGCACCAGG - Intergenic
1020242778 7:6408735-6408757 CTGGAAAGCGGGAAGAAACCTGG - Intergenic
1021911444 7:25389355-25389377 CTTGGAGGCCGCAGGGGACCTGG - Intergenic
1024842188 7:53600120-53600142 CTGGAAGCCCAGAGGAAAGCGGG + Intergenic
1025912674 7:65840682-65840704 CTGGGAGGCAGGCGGGAACTTGG - Intergenic
1026896493 7:74012888-74012910 CTGGAGTGCAGGAGGGAAGCTGG + Intergenic
1027264382 7:76486012-76486034 TTGTAAGTCAGGAGGGAACCAGG + Intronic
1027315752 7:76984126-76984148 TTGTAAGTCAGGAGGGAACCAGG + Intergenic
1028014160 7:85686109-85686131 CTGGAAGGCAGCAGGGAGCCAGG - Intergenic
1031922095 7:127609500-127609522 CTGCAAGGACAGCGGGAACCCGG - Intergenic
1032688576 7:134259818-134259840 CTCCAGGGCCCGAGGGAACCGGG + Intronic
1034324780 7:150220520-150220542 CTGGGACCCCGGAGGGAAGCCGG + Intergenic
1034768411 7:153748711-153748733 CTGGGACCCCGGAGGGAAGCCGG - Intergenic
1035314301 7:157988642-157988664 CAGGGGGGCTGGAGGGAACCGGG + Intronic
1035401871 7:158570888-158570910 GAGGAAGGCCAGAGGTAACCAGG - Intronic
1038432536 8:27511643-27511665 CTGGAAGGCAGGAGGGAGAATGG + Intronic
1040062300 8:43114329-43114351 CTGCAAGGCCGCAGCGAGCCTGG - Intronic
1040449228 8:47527296-47527318 CAGGAAGGCTGGAGGAAATCTGG - Intronic
1042137341 8:65644911-65644933 CAGGGAGGCCGGCGGGATCCTGG + Intronic
1042351321 8:67780569-67780591 CTGGTAGGCCTGAGGGAAGAAGG - Intergenic
1042611889 8:70608620-70608642 CAGGAGGGCAGGAGGGCACCCGG - Exonic
1044480530 8:92682120-92682142 CTGACAGGCCTGAGGGAAGCCGG + Intergenic
1049229948 8:141476802-141476824 CTGGAATGCCTGAGGGCCCCGGG - Intergenic
1049503561 8:142982265-142982287 CTGGAAGGCTGGATGGAGCCAGG + Intergenic
1049776186 8:144406437-144406459 CTGGAAGGCAGGGGGAAAGCTGG - Intronic
1050972531 9:11895175-11895197 GTGGAAGGCCGCAGGGACCTCGG - Intergenic
1053204050 9:36171626-36171648 GTGAAAGACCGGAGGGAAGCAGG - Intergenic
1055303071 9:74902395-74902417 GTGTAAGGATGGAGGGAACCCGG - Intergenic
1057183328 9:93041313-93041335 CTTGATGGCAGGAGGGAGCCTGG + Intergenic
1057528922 9:95826973-95826995 CTGGAAGGCAAGAGGGAGCAGGG - Intergenic
1059079823 9:111236698-111236720 CTGGAAGACCCCAGTGAACCAGG + Intergenic
1059433936 9:114265427-114265449 CTGGGGGGCCTGAGGGACCCGGG - Exonic
1060052871 9:120389743-120389765 TCGGAAGGCCAGAGGAAACCTGG - Exonic
1060878882 9:127103864-127103886 CGGGAAGGCTGGAGGGGAACTGG - Intronic
1061454279 9:130686016-130686038 CTGCAAGGCAGGAGGGAAGCTGG - Intergenic
1062060978 9:134494863-134494885 CTGGAAGGCCTGAGGGCCGCAGG - Intergenic
1062137722 9:134938509-134938531 CTGGAGGGCAGGAGGGCAACAGG - Intergenic
1062261204 9:135664030-135664052 CTGGAAGGGCGGAGGGGTTCTGG + Intronic
1062426679 9:136509216-136509238 CAGGGAGGCCAGTGGGAACCCGG + Intronic
1203761158 EBV:13420-13442 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203762087 EBV:16492-16514 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203763016 EBV:19564-19586 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203763945 EBV:22636-22658 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203764874 EBV:25708-25730 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203765803 EBV:28780-28802 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203766732 EBV:31852-31874 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203767661 EBV:34924-34946 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203432542 Un_GL000195v1:104115-104137 CTGGAAGAACCCAGGGAACCTGG + Intergenic
1187723185 X:22173250-22173272 CTGGAAGGTTGGGGGGCACCAGG - Intronic
1190318560 X:49166104-49166126 CTGGAGGGCCGGAGGTAACGGGG + Exonic
1191050317 X:56184294-56184316 CTGCAAGGCGGGAGTGAGCCTGG + Intergenic
1194885923 X:99316134-99316156 CTTTAAGGCAGGAGGGAACATGG - Intergenic
1199850700 X:151723327-151723349 GTGAAAGGGAGGAGGGAACCAGG - Intergenic
1201600938 Y:15727913-15727935 CTGCAAGGCCGCAGCGAAGCTGG - Intergenic