ID: 950155042

View in Genome Browser
Species Human (GRCh38)
Location 3:10715690-10715712
Sequence ATGCTGGAGCTGAGTGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950155037_950155042 13 Left 950155037 3:10715654-10715676 CCACAGGTAGGGTTGGGAATTGT No data
Right 950155042 3:10715690-10715712 ATGCTGGAGCTGAGTGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950155042 Original CRISPR ATGCTGGAGCTGAGTGTGGT GGG Intergenic
No off target data available for this crispr