ID: 950155042 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:10715690-10715712 |
Sequence | ATGCTGGAGCTGAGTGTGGT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
950155037_950155042 | 13 | Left | 950155037 | 3:10715654-10715676 | CCACAGGTAGGGTTGGGAATTGT | No data | ||
Right | 950155042 | 3:10715690-10715712 | ATGCTGGAGCTGAGTGTGGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
950155042 | Original CRISPR | ATGCTGGAGCTGAGTGTGGT GGG | Intergenic | ||
No off target data available for this crispr |