ID: 950155983

View in Genome Browser
Species Human (GRCh38)
Location 3:10722053-10722075
Sequence ATGTTTATGCAGGTGAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950155979_950155983 -4 Left 950155979 3:10722034-10722056 CCTCGGCTCCCTCTAACAGATGT No data
Right 950155983 3:10722053-10722075 ATGTTTATGCAGGTGAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950155983 Original CRISPR ATGTTTATGCAGGTGAAGCT AGG Intergenic
No off target data available for this crispr