ID: 950157426

View in Genome Browser
Species Human (GRCh38)
Location 3:10733169-10733191
Sequence CATCCATCAGCTATGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950157418_950157426 22 Left 950157418 3:10733124-10733146 CCAAAATAAAATACAGGGAGTAA No data
Right 950157426 3:10733169-10733191 CATCCATCAGCTATGGAACAAGG No data
950157417_950157426 23 Left 950157417 3:10733123-10733145 CCCAAAATAAAATACAGGGAGTA No data
Right 950157426 3:10733169-10733191 CATCCATCAGCTATGGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950157426 Original CRISPR CATCCATCAGCTATGGAACA AGG Intergenic
No off target data available for this crispr