ID: 950158107

View in Genome Browser
Species Human (GRCh38)
Location 3:10739063-10739085
Sequence CCTCTTTCATTGGACACCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950158107_950158114 9 Left 950158107 3:10739063-10739085 CCCCTGGTGTCCAATGAAAGAGG No data
Right 950158114 3:10739095-10739117 CGTTAAGTGCAGATCTTCCAGGG No data
950158107_950158113 8 Left 950158107 3:10739063-10739085 CCCCTGGTGTCCAATGAAAGAGG No data
Right 950158113 3:10739094-10739116 CCGTTAAGTGCAGATCTTCCAGG No data
950158107_950158115 10 Left 950158107 3:10739063-10739085 CCCCTGGTGTCCAATGAAAGAGG No data
Right 950158115 3:10739096-10739118 GTTAAGTGCAGATCTTCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950158107 Original CRISPR CCTCTTTCATTGGACACCAG GGG (reversed) Intergenic