ID: 950158114

View in Genome Browser
Species Human (GRCh38)
Location 3:10739095-10739117
Sequence CGTTAAGTGCAGATCTTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950158111_950158114 -1 Left 950158111 3:10739073-10739095 CCAATGAAAGAGGCGCAACTGCC No data
Right 950158114 3:10739095-10739117 CGTTAAGTGCAGATCTTCCAGGG No data
950158107_950158114 9 Left 950158107 3:10739063-10739085 CCCCTGGTGTCCAATGAAAGAGG No data
Right 950158114 3:10739095-10739117 CGTTAAGTGCAGATCTTCCAGGG No data
950158104_950158114 30 Left 950158104 3:10739042-10739064 CCAGCTCTGCAGTGATGGCGCCC No data
Right 950158114 3:10739095-10739117 CGTTAAGTGCAGATCTTCCAGGG No data
950158109_950158114 8 Left 950158109 3:10739064-10739086 CCCTGGTGTCCAATGAAAGAGGC No data
Right 950158114 3:10739095-10739117 CGTTAAGTGCAGATCTTCCAGGG No data
950158106_950158114 10 Left 950158106 3:10739062-10739084 CCCCCTGGTGTCCAATGAAAGAG No data
Right 950158114 3:10739095-10739117 CGTTAAGTGCAGATCTTCCAGGG No data
950158110_950158114 7 Left 950158110 3:10739065-10739087 CCTGGTGTCCAATGAAAGAGGCG No data
Right 950158114 3:10739095-10739117 CGTTAAGTGCAGATCTTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950158114 Original CRISPR CGTTAAGTGCAGATCTTCCA GGG Intergenic