ID: 950158115

View in Genome Browser
Species Human (GRCh38)
Location 3:10739096-10739118
Sequence GTTAAGTGCAGATCTTCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950158107_950158115 10 Left 950158107 3:10739063-10739085 CCCCTGGTGTCCAATGAAAGAGG No data
Right 950158115 3:10739096-10739118 GTTAAGTGCAGATCTTCCAGGGG No data
950158106_950158115 11 Left 950158106 3:10739062-10739084 CCCCCTGGTGTCCAATGAAAGAG No data
Right 950158115 3:10739096-10739118 GTTAAGTGCAGATCTTCCAGGGG No data
950158110_950158115 8 Left 950158110 3:10739065-10739087 CCTGGTGTCCAATGAAAGAGGCG No data
Right 950158115 3:10739096-10739118 GTTAAGTGCAGATCTTCCAGGGG No data
950158111_950158115 0 Left 950158111 3:10739073-10739095 CCAATGAAAGAGGCGCAACTGCC No data
Right 950158115 3:10739096-10739118 GTTAAGTGCAGATCTTCCAGGGG No data
950158109_950158115 9 Left 950158109 3:10739064-10739086 CCCTGGTGTCCAATGAAAGAGGC No data
Right 950158115 3:10739096-10739118 GTTAAGTGCAGATCTTCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950158115 Original CRISPR GTTAAGTGCAGATCTTCCAG GGG Intergenic