ID: 950161434

View in Genome Browser
Species Human (GRCh38)
Location 3:10764038-10764060
Sequence GTGAGTGAGGGGAAGGCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950161434_950161443 18 Left 950161434 3:10764038-10764060 CCTGTTGCCTTCCCCTCACTCAC No data
Right 950161443 3:10764079-10764101 TTCAGAGCTCAACTCACATCCGG 0: 1
1: 0
2: 0
3: 13
4: 120
950161434_950161445 20 Left 950161434 3:10764038-10764060 CCTGTTGCCTTCCCCTCACTCAC No data
Right 950161445 3:10764081-10764103 CAGAGCTCAACTCACATCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 90
950161434_950161444 19 Left 950161434 3:10764038-10764060 CCTGTTGCCTTCCCCTCACTCAC No data
Right 950161444 3:10764080-10764102 TCAGAGCTCAACTCACATCCGGG 0: 1
1: 0
2: 1
3: 19
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950161434 Original CRISPR GTGAGTGAGGGGAAGGCAAC AGG (reversed) Intergenic
No off target data available for this crispr