ID: 950161951

View in Genome Browser
Species Human (GRCh38)
Location 3:10766893-10766915
Sequence AGATAAACCACAGGGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950161951_950161955 4 Left 950161951 3:10766893-10766915 CCCTGCTTCCCTGTGGTTTATCT No data
Right 950161955 3:10766920-10766942 TGAACCCTGTACAACAGACATGG No data
950161951_950161956 5 Left 950161951 3:10766893-10766915 CCCTGCTTCCCTGTGGTTTATCT No data
Right 950161956 3:10766921-10766943 GAACCCTGTACAACAGACATGGG No data
950161951_950161959 30 Left 950161951 3:10766893-10766915 CCCTGCTTCCCTGTGGTTTATCT No data
Right 950161959 3:10766946-10766968 GCAAAAGTCTTGAGATTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950161951 Original CRISPR AGATAAACCACAGGGAAGCA GGG (reversed) Intergenic
No off target data available for this crispr