ID: 950161953

View in Genome Browser
Species Human (GRCh38)
Location 3:10766901-10766923
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950161953_950161955 -4 Left 950161953 3:10766901-10766923 CCCTGTGGTTTATCTGAATTGAA No data
Right 950161955 3:10766920-10766942 TGAACCCTGTACAACAGACATGG No data
950161953_950161956 -3 Left 950161953 3:10766901-10766923 CCCTGTGGTTTATCTGAATTGAA No data
Right 950161956 3:10766921-10766943 GAACCCTGTACAACAGACATGGG No data
950161953_950161960 23 Left 950161953 3:10766901-10766923 CCCTGTGGTTTATCTGAATTGAA No data
Right 950161960 3:10766947-10766969 CAAAAGTCTTGAGATTGTTAGGG No data
950161953_950161961 24 Left 950161953 3:10766901-10766923 CCCTGTGGTTTATCTGAATTGAA No data
Right 950161961 3:10766948-10766970 AAAAGTCTTGAGATTGTTAGGGG No data
950161953_950161959 22 Left 950161953 3:10766901-10766923 CCCTGTGGTTTATCTGAATTGAA No data
Right 950161959 3:10766946-10766968 GCAAAAGTCTTGAGATTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950161953 Original CRISPR TTCAATTCAGATAAACCACA GGG (reversed) Intergenic
No off target data available for this crispr