ID: 950161956

View in Genome Browser
Species Human (GRCh38)
Location 3:10766921-10766943
Sequence GAACCCTGTACAACAGACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
950161951_950161956 5 Left 950161951 3:10766893-10766915 CCCTGCTTCCCTGTGGTTTATCT No data
Right 950161956 3:10766921-10766943 GAACCCTGTACAACAGACATGGG No data
950161952_950161956 4 Left 950161952 3:10766894-10766916 CCTGCTTCCCTGTGGTTTATCTG No data
Right 950161956 3:10766921-10766943 GAACCCTGTACAACAGACATGGG No data
950161954_950161956 -4 Left 950161954 3:10766902-10766924 CCTGTGGTTTATCTGAATTGAAC No data
Right 950161956 3:10766921-10766943 GAACCCTGTACAACAGACATGGG No data
950161953_950161956 -3 Left 950161953 3:10766901-10766923 CCCTGTGGTTTATCTGAATTGAA No data
Right 950161956 3:10766921-10766943 GAACCCTGTACAACAGACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
950161956 Original CRISPR GAACCCTGTACAACAGACAT GGG Intergenic
No off target data available for this crispr